SlideShare a Scribd company logo
1 of 75
Genomics,
Bioinformatics,
and Pathology
DR. DAN GASTON
BEDARD LAB
DEPARTMENT OF PATHOLOGY
DALHOUSIE UNIVERSITY
MAY 13TH, 2015
Genomic Pathology
Healthcare
Research
Innovation
Why Genomics?
Why Genomics?
Cost
Knowledge Utility
$398,000 -> $0.40
 NGS: Next-Generation Sequencing. A group of
different sequencing technologies defined by
high throughput and low cost
A Short Primer on Common Terms
 NGS: Next-Generation Sequencing. A group of
different sequencing technologies defined by
high throughput and low cost
 Short Read: The output from most NGS
sequencing technologies. Range from 30bp to
300bp
A Short Primer on Common Terms
 NGS: Next-Generation Sequencing. A group of
different sequencing technologies defined by
high throughput and low cost
 Short Read: The output from most NGS
sequencing technologies. Range from 30bp to
300bp
 Mapping: Placing sequencing reads on to a
reference genome
A Short Primer on Common Terms
 NGS: Next-Generation Sequencing. A group of
different sequencing technologies defined by
high throughput and low cost
 Short Read: The output from most NGS
sequencing technologies. Range from 30bp to
300bp
 Mapping: Placing sequencing reads on to a
reference genome
 Variant Calling: Identifying sites of genetic
variation between a sample and a reference
genome
A Short Primer on Common Terms
A Short Primer on Common Terms
 NGS: Next-Generation Sequencing. A group of
different sequencing technologies defined by
high throughput and low cost
 Short Read: The output from most NGS
sequencing technologies. Range from 30bp to
300bp
 Mapping: Placing sequencing reads on to a
reference genome
 Variant Calling: Identifying sites of genetic
variation between a sample and a reference
genome
 Paired End: Two short reads from the same
fragment of the genome, one from each end
The Players
The Players
Next-Gen Sequencing Overview
Next-Gen Sequencing Overview
Illumina Sequencing: The Basics
Targeted Sequencing
Targeted Sequencing
The Data
The Data: FastQ Format
Read ID
Sequence
Quality line
NGS Bioinformatics Workflow
Unpacking the Black Box
Unpacking the Black Box
 Quality assurance of primary data
Unpacking the Black Box
 Quality assurance of primary data
 Map short reads to a reference
Unpacking the Black Box
 Quality assurance of primary data
 Map short reads to a reference
 Quality assurance of mapping process
Unpacking the Black Box
 Quality assurance of primary data
 Map short reads to a reference
 Quality assurance of mapping process
 Identify genetic variation (mutations,
translocations, etc)
Unpacking the Black Box
 Quality assurance of primary data
 Map short reads to a reference
 Quality assurance of mapping process
 Identify genetic variation (mutations,
translocations, etc)
 Quality assurance of variants
Unpacking the Black Box
 Quality assurance of primary data
 Map short reads to a reference
 Quality assurance of mapping process
 Identify genetic variation (mutations,
translocations, etc)
 Quality assurance of variants
 Variant annotation
Unpacking the Black Box
 Quality assurance of primary data
 Map short reads to a reference
 Quality assurance of mapping process
 Identify genetic variation (mutations,
translocations, etc)
 Quality assurance of variants
 Variant annotation
 Variant filtering
Unpacking the Black Box
 Quality assurance of primary data
 Map short reads to a reference
 Quality assurance of mapping process
 Identify genetic variation (mutations,
translocations, etc)
 Quality assurance of variants
 Variant annotation
 Variant filtering
 Reporting (Text, Visualization)
Genomic Oncology
Tumour Sample
DNA
Non-Tumour
Sample
DNA
Databases and
Annotations
Sequence
Tumour
Specific
Mutations
Tumour
Classification
Drugs
Short Read Mapping
Short Read Mapping
AGCTGGGATTTCGGAAAAGTCCGATCCCTTTAAGCGAA
AGCTGGGAT
GATTTCGGAAAA
TCGGAAAAGTC TTTAAGCGAA
TCCCTTTAAG
GTCCGATCCC
GAAAAGTCCGATCC
TGGGATTTCGG
TTCGGAAAAG CGATCCCTTTAAGC
AAAGTCCGATCC
Variant Calling
AGCTGGGATTTCGGAAAAGTCCGATCCCTTTAAGCGAA
AGCTGGGAT
GATTTCGGAAAA
TCGGAAAAGTC TTTAAGCGAA
TCCCTTTAAG
GTCCGATCCC
GAAAAGTCCGAGCC
TGGGATTTCGG
TTCGGAAAAG CGAGCCCTTTAAGC
AAAGTCCGAGCC
Variant Annotation
Variant Databases
Public Databases
Clinical Testing Databases
Pharmaceutical Company
Databases
Important Considerations
Timeline to Action
Day 0 Day 30 ?
Timeline to Action
Day 0 Day 14?
Timeline to Action
Day 0 Day 7?
Data Storage
Data Storage: Sequencing
Centres
Data Storage: Sequencing
Centres
Data Storage: Smaller
Sequencing Centres
Data Storage: Smaller
Sequencing Centres
Data Storage: Focused
Sequencing
Data Storage: Focused
Sequencing
Data Storage: Focused
Sequencing
Data Sharing
Clinical Bioinformatics
Validate, validate, validate!
Clinical Reporting
Genetic Variant Reporting
Genetic Variant Reporting
Genetic Variant Reporting
Genetic Variant Reporting
Levels of
Evidence/Support
Algorithmic Prediction
Levels of
Evidence/Support
Algorithmic Prediction+ Gene of Clinical Significance
Algorithmic Prediction
Levels of
Evidence/Support
Algorithmic Prediction+ Gene of Clinical Significance
Algorithmic Prediction
Clinical Variant in Other Malignancy
Levels of
Evidence/Support
Algorithmic Prediction+ Gene of Clinical Significance
Algorithmic Prediction
Clinical Variant in Other Malignancy
Clinical Variant in Malignancy
Algorithmic Prediction+ Gene of Clinical Significance
Algorithmic Prediction
Variants of Unknown
Significance
Incidental Findings
 ACMG Recommendations
 56 Genes
 Report on known
pathogenic mutations for all
 Report on suspected
(predicted) pathogenic for
some
 Based on actionability
 Allow for patient opt-out?
The Future
Monitoring For Cancer
Chemotherapy Resistance
Field Sequencing and Real-Time
Analysis
Takeaways and Key
Points
Conclusions
 Clinical sequencing is here
Conclusions
 Clinical sequencing is here
 Bit of a learning curve but pay-off is potentially
huge
Conclusions
 Clinical sequencing is here
 Bit of a learning curve but pay-off is potentially
huge
 Future proofing
Conclusions
 Clinical sequencing is here
 Bit of a learning curve but pay-off is potentially
huge
 Future proofing
 Be comfortable with genetics
Conclusions
 Clinical sequencing is here
 Bit of a learning curve but pay-off is potentially
huge
 Future proofing
 Be comfortable with genetics
 Make friends with your friendly local
bioinformatician
Conclusions
 Clinical sequencing is here
 Bit of a learning curve but pay-off is potentially
huge
 Future proofing
 Be comfortable with genetics
 Make friends with your friendly local
bioinformatician
 Leveraging 'Big Data' to make big decisions
Conclusions
 Clinical sequencing is here
 Bit of a learning curve but pay-off is potentially
huge
 Future proofing
 Be comfortable with genetics
 Make friends with your friendly local
bioinformatician
 Leveraging 'Big Data' to make big decisions
 Future: Clinical trails of size 1
Conclusions
Cost
Knowledge Utility
Conclusions
Pathologists
Bioinformaticians Geneticists

More Related Content

What's hot

Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation SequencingShelomi Karoon
 
Big Data and Genomic Medicine by Corey Nislow
Big Data and Genomic Medicine by Corey NislowBig Data and Genomic Medicine by Corey Nislow
Big Data and Genomic Medicine by Corey NislowKnome_Inc
 
Aug2013 NIST highly confident genotype calls for NA12878
Aug2013 NIST highly confident genotype calls for NA12878Aug2013 NIST highly confident genotype calls for NA12878
Aug2013 NIST highly confident genotype calls for NA12878GenomeInABottle
 
Bioinformatics as a tool for understanding clinically significant variations ...
Bioinformatics as a tool for understanding clinically significant variations ...Bioinformatics as a tool for understanding clinically significant variations ...
Bioinformatics as a tool for understanding clinically significant variations ...Despoina Kalfakakou
 
Illumina-General-Overview-Q1-17
Illumina-General-Overview-Q1-17Illumina-General-Overview-Q1-17
Illumina-General-Overview-Q1-17Matthew Holguin
 
The clinical application development and validation of cell free dna assays -...
The clinical application development and validation of cell free dna assays -...The clinical application development and validation of cell free dna assays -...
The clinical application development and validation of cell free dna assays -...Candy Smellie
 
Next generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsNext generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsDr. Gerry Higgins
 
Next Generation Sequencing application in virology
Next Generation Sequencing application in virologyNext Generation Sequencing application in virology
Next Generation Sequencing application in virologyEben Titus
 
NGS in Clinical Research: Meet the NGS Experts Series Part 1
NGS in Clinical Research: Meet the NGS Experts Series Part 1NGS in Clinical Research: Meet the NGS Experts Series Part 1
NGS in Clinical Research: Meet the NGS Experts Series Part 1QIAGEN
 
Analysis and Interpretation of Cell-free DNA
Analysis and Interpretation of Cell-free DNAAnalysis and Interpretation of Cell-free DNA
Analysis and Interpretation of Cell-free DNAQIAGEN
 
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practiceAug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practiceGenomeInABottle
 
Analysis of Single-Cell Sequencing Data by CLC/Ingenuity: Single Cell Analysi...
Analysis of Single-Cell Sequencing Data by CLC/Ingenuity: Single Cell Analysi...Analysis of Single-Cell Sequencing Data by CLC/Ingenuity: Single Cell Analysi...
Analysis of Single-Cell Sequencing Data by CLC/Ingenuity: Single Cell Analysi...QIAGEN
 
Invicta eshre-poster-pregnancy rate after frozen blastocyst
Invicta eshre-poster-pregnancy rate after frozen blastocystInvicta eshre-poster-pregnancy rate after frozen blastocyst
Invicta eshre-poster-pregnancy rate after frozen blastocystINVICTA GENETICS
 
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2QIAGEN
 
Achieve improved variant detection in single cell sequencing infographic
Achieve improved variant detection in single cell sequencing infographicAchieve improved variant detection in single cell sequencing infographic
Achieve improved variant detection in single cell sequencing infographicQIAGEN
 
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
APPLICATION OF  NEXT GENERATION SEQUENCING (NGS)  IN CANCER TREATMENTAPPLICATION OF  NEXT GENERATION SEQUENCING (NGS)  IN CANCER TREATMENT
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTDinie Fariz
 
High-Throughput Sequencing
High-Throughput SequencingHigh-Throughput Sequencing
High-Throughput SequencingMark Pallen
 
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Reid Robison
 
Avances en genética. Utilidad de la NGS y la bioinformática.
Avances en genética. Utilidad de la NGS y la bioinformática.Avances en genética. Utilidad de la NGS y la bioinformática.
Avances en genética. Utilidad de la NGS y la bioinformática.BBK Innova Sarea
 

What's hot (20)

Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
Big Data and Genomic Medicine by Corey Nislow
Big Data and Genomic Medicine by Corey NislowBig Data and Genomic Medicine by Corey Nislow
Big Data and Genomic Medicine by Corey Nislow
 
Aug2013 NIST highly confident genotype calls for NA12878
Aug2013 NIST highly confident genotype calls for NA12878Aug2013 NIST highly confident genotype calls for NA12878
Aug2013 NIST highly confident genotype calls for NA12878
 
Bioinformatics as a tool for understanding clinically significant variations ...
Bioinformatics as a tool for understanding clinically significant variations ...Bioinformatics as a tool for understanding clinically significant variations ...
Bioinformatics as a tool for understanding clinically significant variations ...
 
Illumina-General-Overview-Q1-17
Illumina-General-Overview-Q1-17Illumina-General-Overview-Q1-17
Illumina-General-Overview-Q1-17
 
The clinical application development and validation of cell free dna assays -...
The clinical application development and validation of cell free dna assays -...The clinical application development and validation of cell free dna assays -...
The clinical application development and validation of cell free dna assays -...
 
Next generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsNext generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomics
 
Rossen eccmid2015v1.5
Rossen eccmid2015v1.5Rossen eccmid2015v1.5
Rossen eccmid2015v1.5
 
Next Generation Sequencing application in virology
Next Generation Sequencing application in virologyNext Generation Sequencing application in virology
Next Generation Sequencing application in virology
 
NGS in Clinical Research: Meet the NGS Experts Series Part 1
NGS in Clinical Research: Meet the NGS Experts Series Part 1NGS in Clinical Research: Meet the NGS Experts Series Part 1
NGS in Clinical Research: Meet the NGS Experts Series Part 1
 
Analysis and Interpretation of Cell-free DNA
Analysis and Interpretation of Cell-free DNAAnalysis and Interpretation of Cell-free DNA
Analysis and Interpretation of Cell-free DNA
 
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practiceAug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practice
 
Analysis of Single-Cell Sequencing Data by CLC/Ingenuity: Single Cell Analysi...
Analysis of Single-Cell Sequencing Data by CLC/Ingenuity: Single Cell Analysi...Analysis of Single-Cell Sequencing Data by CLC/Ingenuity: Single Cell Analysi...
Analysis of Single-Cell Sequencing Data by CLC/Ingenuity: Single Cell Analysi...
 
Invicta eshre-poster-pregnancy rate after frozen blastocyst
Invicta eshre-poster-pregnancy rate after frozen blastocystInvicta eshre-poster-pregnancy rate after frozen blastocyst
Invicta eshre-poster-pregnancy rate after frozen blastocyst
 
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
 
Achieve improved variant detection in single cell sequencing infographic
Achieve improved variant detection in single cell sequencing infographicAchieve improved variant detection in single cell sequencing infographic
Achieve improved variant detection in single cell sequencing infographic
 
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
APPLICATION OF  NEXT GENERATION SEQUENCING (NGS)  IN CANCER TREATMENTAPPLICATION OF  NEXT GENERATION SEQUENCING (NGS)  IN CANCER TREATMENT
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
 
High-Throughput Sequencing
High-Throughput SequencingHigh-Throughput Sequencing
High-Throughput Sequencing
 
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
 
Avances en genética. Utilidad de la NGS y la bioinformática.
Avances en genética. Utilidad de la NGS y la bioinformática.Avances en genética. Utilidad de la NGS y la bioinformática.
Avances en genética. Utilidad de la NGS y la bioinformática.
 

Similar to Genomics, Bioinformatics, and Pathology

20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA Roberto Scarafia
 
Bioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesisBioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesisDespoina Kalfakakou
 
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...Golden Helix Inc
 
Pattern Recognition in clinical data
Pattern Recognition in clinical dataPattern Recognition in clinical data
Pattern Recognition in clinical dataSaket Choudhary
 
Pattern Recognition in Clinical Data
Pattern Recognition in Clinical DataPattern Recognition in Clinical Data
Pattern Recognition in Clinical DataSaket Choudhary
 
Visual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationVisual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationNils Gehlenborg
 
Bioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisBioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisDespoina Kalfakakou
 
160627 giab for festival sv workshop
160627 giab for festival sv workshop160627 giab for festival sv workshop
160627 giab for festival sv workshopGenomeInABottle
 
160628 giab for festival of genomics
160628 giab for festival of genomics160628 giab for festival of genomics
160628 giab for festival of genomicsGenomeInABottle
 
Forum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decadeForum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decadeJoaquin Dopazo
 
Rare Variant Analysis Workflows: Analyzing NGS Data in Large Cohorts
Rare Variant Analysis Workflows: Analyzing NGS Data in Large CohortsRare Variant Analysis Workflows: Analyzing NGS Data in Large Cohorts
Rare Variant Analysis Workflows: Analyzing NGS Data in Large CohortsGolden Helix Inc
 
Bioinformatics in dermato-oncology
Bioinformatics in dermato-oncologyBioinformatics in dermato-oncology
Bioinformatics in dermato-oncologyJoaquin Dopazo
 
Oncogenomics july 2012
Oncogenomics july 2012Oncogenomics july 2012
Oncogenomics july 2012Elsa von Licy
 
171017 giab for giab grc workshop
171017 giab for giab grc workshop171017 giab for giab grc workshop
171017 giab for giab grc workshopGenomeInABottle
 
Hot Topics Our Genomic Future: Tim hubbard
Hot Topics Our Genomic Future: Tim hubbardHot Topics Our Genomic Future: Tim hubbard
Hot Topics Our Genomic Future: Tim hubbardNesta
 
Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...
Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...
Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...Docker, Inc.
 
2015 TriCon - Clinical Grade Annotations - Public Data Resources for Interpre...
2015 TriCon - Clinical Grade Annotations - Public Data Resources for Interpre...2015 TriCon - Clinical Grade Annotations - Public Data Resources for Interpre...
2015 TriCon - Clinical Grade Annotations - Public Data Resources for Interpre...Gabe Rudy
 

Similar to Genomics, Bioinformatics, and Pathology (20)

20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
 
Bioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesisBioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesis
 
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
Big Data at Golden Helix: Scaling to Meet the Demand of Clinical and Research...
 
Pattern Recognition in clinical data
Pattern Recognition in clinical dataPattern Recognition in clinical data
Pattern Recognition in clinical data
 
Pattern Recognition in Clinical Data
Pattern Recognition in Clinical DataPattern Recognition in Clinical Data
Pattern Recognition in Clinical Data
 
Visual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationVisual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient Stratification
 
Bioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisBioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysis
 
Oncogenomics 2013
Oncogenomics 2013Oncogenomics 2013
Oncogenomics 2013
 
Bio conference live 2013
Bio conference live 2013Bio conference live 2013
Bio conference live 2013
 
160627 giab for festival sv workshop
160627 giab for festival sv workshop160627 giab for festival sv workshop
160627 giab for festival sv workshop
 
160628 giab for festival of genomics
160628 giab for festival of genomics160628 giab for festival of genomics
160628 giab for festival of genomics
 
Forum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decadeForum on Personalized Medicine: Challenges for the next decade
Forum on Personalized Medicine: Challenges for the next decade
 
Rare Variant Analysis Workflows: Analyzing NGS Data in Large Cohorts
Rare Variant Analysis Workflows: Analyzing NGS Data in Large CohortsRare Variant Analysis Workflows: Analyzing NGS Data in Large Cohorts
Rare Variant Analysis Workflows: Analyzing NGS Data in Large Cohorts
 
Bioinformatics in dermato-oncology
Bioinformatics in dermato-oncologyBioinformatics in dermato-oncology
Bioinformatics in dermato-oncology
 
Oncogenomics july 2012
Oncogenomics july 2012Oncogenomics july 2012
Oncogenomics july 2012
 
171017 giab for giab grc workshop
171017 giab for giab grc workshop171017 giab for giab grc workshop
171017 giab for giab grc workshop
 
Hot Topics Our Genomic Future: Tim hubbard
Hot Topics Our Genomic Future: Tim hubbardHot Topics Our Genomic Future: Tim hubbard
Hot Topics Our Genomic Future: Tim hubbard
 
Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...
Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...
Cool Genes: The Search for a Cure Using Genomics, Big Data, and Docker - Jame...
 
2015 10 21_pathology_wim_vancriekinge
2015 10 21_pathology_wim_vancriekinge2015 10 21_pathology_wim_vancriekinge
2015 10 21_pathology_wim_vancriekinge
 
2015 TriCon - Clinical Grade Annotations - Public Data Resources for Interpre...
2015 TriCon - Clinical Grade Annotations - Public Data Resources for Interpre...2015 TriCon - Clinical Grade Annotations - Public Data Resources for Interpre...
2015 TriCon - Clinical Grade Annotations - Public Data Resources for Interpre...
 

More from Dan Gaston

Population and evolutionary genetics 1
Population and evolutionary genetics 1Population and evolutionary genetics 1
Population and evolutionary genetics 1Dan Gaston
 
Human genetics evolutionary genetics
Human genetics   evolutionary geneticsHuman genetics   evolutionary genetics
Human genetics evolutionary geneticsDan Gaston
 
2015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and22015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and2Dan Gaston
 
Bioc4700 2014 Guest Lecture
Bioc4700   2014 Guest LectureBioc4700   2014 Guest Lecture
Bioc4700 2014 Guest LectureDan Gaston
 
Protein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human HealthProtein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human HealthDan Gaston
 
Bioc4010 sample questions
Bioc4010 sample questionsBioc4010 sample questions
Bioc4010 sample questionsDan Gaston
 
Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2Dan Gaston
 
Dgaston dec-06-2012
Dgaston dec-06-2012Dgaston dec-06-2012
Dgaston dec-06-2012Dan Gaston
 
Bioinformatics in Gene Research
Bioinformatics in Gene ResearchBioinformatics in Gene Research
Bioinformatics in Gene ResearchDan Gaston
 

More from Dan Gaston (9)

Population and evolutionary genetics 1
Population and evolutionary genetics 1Population and evolutionary genetics 1
Population and evolutionary genetics 1
 
Human genetics evolutionary genetics
Human genetics   evolutionary geneticsHuman genetics   evolutionary genetics
Human genetics evolutionary genetics
 
2015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and22015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and2
 
Bioc4700 2014 Guest Lecture
Bioc4700   2014 Guest LectureBioc4700   2014 Guest Lecture
Bioc4700 2014 Guest Lecture
 
Protein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human HealthProtein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human Health
 
Bioc4010 sample questions
Bioc4010 sample questionsBioc4010 sample questions
Bioc4010 sample questions
 
Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2
 
Dgaston dec-06-2012
Dgaston dec-06-2012Dgaston dec-06-2012
Dgaston dec-06-2012
 
Bioinformatics in Gene Research
Bioinformatics in Gene ResearchBioinformatics in Gene Research
Bioinformatics in Gene Research
 

Recently uploaded

Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactdawncurless
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfAyushMahapatra5
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfagholdier
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxAreebaZafar22
 
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17  How to Extend Models Using Mixin ClassesMixin Classes in Odoo 17  How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17 How to Extend Models Using Mixin ClassesCeline George
 
fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingTeacherCyreneCayanan
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Celine George
 
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...Shubhangi Sonawane
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxVishalSingh1417
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104misteraugie
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdfQucHHunhnh
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introductionMaksud Ahmed
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityGeoBlogs
 
psychiatric nursing HISTORY COLLECTION .docx
psychiatric  nursing HISTORY  COLLECTION  .docxpsychiatric  nursing HISTORY  COLLECTION  .docx
psychiatric nursing HISTORY COLLECTION .docxPoojaSen20
 
SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...
SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...
SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...KokoStevan
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfJayanti Pande
 

Recently uploaded (20)

Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impact
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdf
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdf
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
 
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17  How to Extend Models Using Mixin ClassesMixin Classes in Odoo 17  How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
 
fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writing
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17
 
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdf
 
Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introduction
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activity
 
psychiatric nursing HISTORY COLLECTION .docx
psychiatric  nursing HISTORY  COLLECTION  .docxpsychiatric  nursing HISTORY  COLLECTION  .docx
psychiatric nursing HISTORY COLLECTION .docx
 
SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...
SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...
SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...
 
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdf
 
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
 

Genomics, Bioinformatics, and Pathology