Regulation of synthesis and oxidation of fatty acids by adiponectin receptors (AdipoR1/R2) and insulin receptor substrate isoforms (IRS-1/-2) of the liver in a nonalcoholic steatohepatitis animal model

1. Regulation of synthesis and oxidation of fatty acids by adiponectin
receptors (AdipoR1/R2) and insulin receptor substrate isoforms (IRS-1/-2)
of the liver in a nonalcoholic steatohepatitis animal model
Tokio Matsunami, Yukita Sato⁎, Satomi Ariga, Takuya Sato, Toshiko Shimomura,
Haruka Kashimura, Yuki Hasegawa, Masayoshi Yukawa
Laboratory of Biomedical Science, Department of Veterinary Medicine, College of Bioresource Sciences, Nihon University, Fujisawa 252-0880, Japan
Received 15 March 2010; accepted 26 July 2010
Abstract
Nonalcoholic steatohepatitis (NASH) is one of the most frequent causes of abnormal liver dysfunction associated with synthesis and
oxidation of fatty acids. Adiponectin receptors (AdipoR1/R2) and insulin receptor substrates (IRS-1/-2) are known as modulators of these
fatty acid metabolisms in the liver; however, the regulatory roles of these receptors in the synthesis and oxidation of fatty acids are unclear in
the liver of NASH. In this study, we examined the roles of hepatic AdipoR1/R2 and IRS-1/-2 in NASH using an animal model. After feeding
a high-fat and high-cholesterol diet to obese fa/fa Zucker rats for 8 weeks, rats showed fatty liver spontaneously with inflammation and
fibrosis that are characteristic of NASH. The expression levels of AdipoR1/R2 and IRS-2 were significantly decreased, whereas IRS-1 was
significantly increased, in NASH. As a result of the decrease of AdipoR1/R2 expression, the messenger RNA expression levels of genes
located downstream of AdipoR1/R2, adenosine monophosphate–activated protein kinase α1/α2, which inhibits fatty acid synthesis, and
peroxisome proliferator–activated receptor α, which activates fatty acid oxidation, also decreased. Expression level of sterol regulatory
element binding protein–1c was found to be elevated, suggesting the up-regulation of IRS-1, and resulted in increased fatty acid synthesis.
Furthermore, increase of forkhead box protein A2 expression was observed, which might be associated with the down-regulation of IRS-2,
facilitating fatty acid oxidation. Taken together, increased synthesis and oxidation of fatty acids by up- or down-regulation of AdipoR or IRS
may contribute to the progression of NASH. Thus, AdipoR and IRS might be crucially important regulators for the synthesis and oxidation of
fatty acids in the liver of NASH.
© 2010 Elsevier Inc. All rights reserved.
1. Introduction
Obesity, especially visceral fat accumulation, causes
insulin resistance, a common risk factor for hepatic steatosis.
Fatty liver is thought to represent the first step toward the
subsequent development of liver fibrosis. Impaired mito-
chondrial function provides the second “hit” and promotes
the generation of reactive oxygen species (ROS), which
promote lipid peroxidation, the release of inflammatory
cytokines, death of hepatocytes, and activation of hepatic
stellate cells [1]. Nonalcoholic steatohepatitis (NASH) is a
progressive disorder that can lead to liver cirrhosis and even
hepatocellular carcinoma [2]. Nonalcoholic steatohepatitis is
often associated with obesity and/or insulin resistance;
however, the precise cause of NASH remains unclear. It is
important, therefore, to characterize lipid metabolism,
particularly fatty acid metabolism, in NASH.
Adiponectin is a 30-kd hormone produced by adipose
tissue that plays an important role in the regulation of
whole-body insulin sensitivity [3,4]. The insulin-sensitizing
effect of adiponectin appears to be mediated by an increase
in fatty acid oxidation, leading to a reduction in the lipid
content of liver and skeletal muscle [4,5]. Two types of
adiponectin receptors (AdipoR1/R2) clearly differ in their
signaling pathways. AdipoR1 is more tightly linked to the
activation of the adenosine monophosphate–activated
protein kinase (AMPK) pathway and regulates the
inhibition of hepatic glucose production together with
Available online at www.sciencedirect.com
Metabolism Clinical and Experimental xx (2010) xxx–xxx
www.metabolismjournal.com
⁎ Corresponding author. Tel.: +81 466 84 3445; fax: +81 466 84 3445.
E-mail address: sato.yukita@nihon-u.ac.jp (Y. Sato).
0026-0495/$ – see front matter © 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.metabol.2010.07.032

2. increased fatty acid oxidation, whereas AdipoR2 is mainly
involved in the activation of the peroxisome proliferator–
activated receptor α (PPARα) pathway, which stimulates
energy dissipation by increasing fatty acid oxidation [6].
Recently, it was reported that adiponectin showed an
hepatoprotective action in nonalcoholic fatty liver disease
(NAFLD) [7]. Plasma adiponectin level is decreased in
patients with steatosis and NASH, correlating with the
severity of liver histology [8]. Considering adiponectin
receptors, contradictory results have been published,
AdipoR1/R2 expressions being reported as either signifi-
cantly decreased [9] or increased [10] in the liver of NASH.
Therefore, the association between adiponectin receptors
and NASH remains unclear.
Insulin is a well-known stimulator of lipogenesis and
activates the hepatic expression of sterol regulatory element
binding protein–1c (SREBP-1c) [11,12]. Insulin receptor
substrate (IRS) proteins, a family of docking molecules,
transmit insulin receptor activation signals to essential
downstream cascades; and the 2 major isoforms, IRS-1/-2,
are expressed in the liver [13]. Generally, IRS-2 is linked
more closely to lipid metabolism and both IRS-1/-2 are
linked to fatty acid oxidation through the inhibition of a
transcription factor, forkhead box protein A2 (Foxa2)
[14,15]. It is well known that insulin resistance is associated
with decreased expression of IRS-1/-2 [16-18], whereas it
has been reported that IRS-1 protein levels, but not IRS-2,
were slightly increased in the liver of rats fed a high-fat diet
[19]. However, the regulatory roles of IRS-1/-2 remain
poorly understood in the liver of NASH. Moreover, to our
knowledge, there is no study on the modulating roles of
synthesis and oxidation of fatty acids by AdipoR1/R2 and
IRS-1/-2 in the NASH condition. Therefore, in the present
study, we examined the lipid metabolism roles of AdipoR1/
R2 and IRS-1/-2 expression in the liver of NASH, using a
high-fat and high-cholesterol (HFC) diet–fed obese rats
(Zucker fatty). To achieve this aim, we analyzed (1)
metabolic parameters, such as blood biochemical, oxidative
stress, lipid peroxidation, and histopathology, in an animal
model of NASH; (2) adiponectin expression in the epidi-
dymal fat depots, and adiponectin receptors (AdipoR1/R2)
and insulin receptor substrate (IRS-1/-2) expression in the
liver; (3) the expression of genes related to de novo synthesis
of fatty acids in AdipoR1/R2 or IRS-1/-2 downstream
effectors (AMPKα1/α2, acetyl–coenzyme A [CoA] carbo-
xylase [ACC], fatty acid synthase [FAS], SREBP-1c); and
(4) the expression of genes related to fatty acid oxidation in
mitochondria, peroxisomes, and microsomes in AdipoR1/R2
or IRS-1/-2 downstream effectors (carnitine palmitoyltrans-
ferase [CPT]-1a, PPARα, uncoupling protein [UCP]–2,
straight-chain acyl-CoA oxidase [ACOX], cytochrome
P-450 [CYP] 2E1/CYP4A1, Foxa2). Furthermore, we
investigated the expression of genes related to synthesis of
monounsaturated fatty acids from saturated fatty acids
(stearoyl-CoA desaturase 1 [SCD1]), and endoplasmic
reticulum (ER) stress (activation transcription factor 3
[ATF3], X-box–binding protein–1 [XBP1], CCAAT/
enhancer-binding homologous protein [CHOP]).
2. Materials and methods
2.1. Animal study design
Eight-week-old obese fa/fa Zucker rats (n = 16 males)
were obtained from Japan SLC Inc (Shizuoka, Japan) and fed
rat chow for 1 week. All experimental procedures were
implemented in accordance with the Institutional Guidelines
for Animal Experiments at the College of Bioresource
Sciences, Nihon University, under the permission of the
Committee of Experimental Animal in our college. All rats
were housed in an animal facility with controlled tempera-
ture and a 12-hour light/dark cycle (light on at 7:00 AM and
off at 7:00 PM) and had unlimited access to water. The rats
(n = 16) were allowed to acclimatize for 1 week before
treatment and then randomly divided into 2 groups: control
diet (the control rats) or HFC diet groups (the HFC rats), and
fed with either a control diet or an HFC diet for 8 weeks,
respectively. The control diet (3.6 kcal/g) was low in total fat
(5% of total calories were from fat provided by soy oil), and
most of the fat was linoleic acid (Table 1, 47% linoleic acid).
The HFC diet (4.7 kcal/g) contained 50% of total calories as
lard and beef tallow and 5% cholesterol, and was enriched in
oleic acid and the saturated fatty acids palmitic and stearic
acids (Table 1). Both diets were purchased from Oriental
Yeast (Tokyo, Japan). Rats fed the control diet had free
access to water, and rats fed the HFC diet had free access to a
sodium chloride solution (1%) ad libitum at all times. The
mean food intake of the animals in all groups was measured
3 times a week and then averaged to calculate daily food
intake. Body weight and biochemical indices were moni-
tored once a week for 8 weeks. After 8 weeks of monitoring,
the rats were fasted overnight before a blood sampling was
performed. Blood samples were collected from the inferior
vena cava just before the rats were killed. Blood samples
were centrifuged at 3000 rpm for 5 minutes, and then the
plasma or serum was collected and stored at −80°C until
analysis. Animals in both treatment groups were killed the
following day under ether anesthesia, and then liver weight
and intraabdominal fat (epididymal fat pad, mesenteric fat,
and perinephric fat) weight were measured. In addition, a
Table 1
Fatty acid profile of the source of fat in the control and the HFC diets
expressed as a percentage
Fatty acid profile Control HFC
Myristic (14:0) 0.4 2
Palmitic (16:0) 14.6 24.7
Palmitoleic (16:1) 0.7 2.5
Stearic (18:0) 2.6 15.6
Oleic (18:1) 24.6 42.9
Linoleic (18:2) 46.6 7.2
Linolenic (18:3) 3.8 0.6
2 T. Matsunami et al. / Metabolism Clinical and Experimental xx (2010) xxx–xxx

3. liver sample was collected in liquid nitrogen for analysis
of antioxidant defense enzymes, lipid peroxidation, and the
hepatic triglyceride content, and stored at −80°C until
analysis. Similarly, liver and epididymal fat depots
samples were collected in RNAlater solution (Qiagen,
Hilden, Germany) for molecular analysis and stored at
−80°C until analysis. In addition, liver tissues samples
were fixed overnight in 10% buffered formalin for
histopathologic analysis.
2.2. Biochemical analysis
Fasting plasma glucose, total cholesterol, triglyceride,
and alanine aminotransferase (ALT) concentrations were
measured using commercially available enzyme-linked
colorimetric diagnostic kits (DRI-CHEM4000, FUJIFLIM,
Tokyo, Japan); and serum concentration of nonesterified
fatty acids (NEFAs) was measured by an enzyme method
using a JCA-BM2250 (JEOL, Tokyo, Japan). Fasting plasma
insulin concentration was determined using a Rat Insulin
ELISA KIT (AKRIN-010H; Shibayagi, Gunma, Japan).
2.3. Analysis of antioxidant defense enzymes, lipid
peroxidation, and the hepatic triglyceride content
Liver homogenates were prepared as a 1:10 (wt/vol)
dilution in pH-7.4, 10-mmol/L potassium phosphate buffer
using an Ultra-Turrax (IKA Japan, Nara, Japan). Samples
were centrifuged at 3000 rpm for 10 minutes at 4°C, and the
supernatants were collected and immediately assayed for
enzyme activities. For total glutathione (GSH), approxi-
mately 50 μg of liver was homogenized in 5% trichloroacetic
acid at a ratio of 1:10 (wt/vol) and centrifuged for 5 minutes
at 8000 rpm and 4°C. Total GSH was measured in the tissues
as previously described [20]. In addition, total superoxide
dismutase (SOD), catalase (CAT), and total glutathione
peroxidase (GPx) activities were measured according to Sun
et al [21], Aebi [22], and Paglia and Valentine [23],
respectively. Lipid peroxidation levels were measured by
the thiobarbituric acid reaction using the method of Ohkawa
et al [24]. For quantification of the hepatic triglyceride
content, the liver was lysed with the buffer in a commercially
available kit (TG E-test; Wako, Osaka, Japan) and disrupted
by sonication. The triglyceride content of the homogenate
was then determined with the previously mentioned kit
according to the manufacturer's instructions.
2.4. Liver histopathologic examination
Liver tissue samples were fixed overnight in 10%
buffered formalin and embedded in paraffin. Sections
(5 μm) of liver tissue were stained with hematoxylin and
eosin and Mason trichrome. Steatosis, activity (inflamma-
tion), and stage (fibrosis) were semiquantitatively evaluated
according to the standard criteria of grading and staging for
NASH with minor modifications [25]. Degree of steatosis
was scored as the percentage of hepatocytes containing lipid
droplets. Activity was evaluated as the sum of scores (score
0-6) of acinar inflammation (score 0-3) and portal inflam-
mation (score 0-3). Fibrosis was graded from 0 (absent) to 4
(1, perisinusoidal/pericellular fibrosis; 2, periportal fibrosis;
3, bridging fibrosis; 4, cirrhosis).
2.5. RNA extraction and quantitative real-time polymerase
chain reaction
RNA isolation was performed by homogenization with a
Micro Smash-100R (TOMY SEIKO, Tokyo, Japan) using
Isogen (NIPPON GENE, Tokyo, Japan) for liver and
epididymal fat depots. RNA purification was carried out
using the RNeasy Mini kit (Qiagen) in all the tissues studied.
All samples were treated with DNase I (RNase Free DNase
set, Qiagen). The concentrations of total RNA were
measured by absorbance at 260 nm using a NanoDrop
ND-1000 (NanoDrop Products, Wilmington, DE, USA). The
purity was estimated by the 260:280-nm absorbance ratio.
One microgram total RNA was subjected to reverse
transcription using an oligo(dT)12-18 primer and M-MuLV
reverse transcriptase (SuperScript III First-Strand Synthesis;
Invitrogen Life Science, Carlsbad, CA, USA) according to
the manufacturer's instructions. The transcript levels of
specific primers (Table 2) were quantified by real-time
polymerase chain reaction (PCR) (7500 Real-Time PCR
System, Applied Biosystems, Foster City, CA). The
complementary DNA was amplified under the following
conditions: 95°C for 10 minutes, followed by 45 cycles of
15 seconds at 95°C and 1 minute at 59°C, using Power
SYBR Green PCR Master Mix (Applied Biosystems). The
primer concentrations were 400 nmol/L, respectively. After
PCR, a melting curve analysis was performed to
demonstrate the specificity of the PCR product, which
was displayed as a single peak (data not shown). Every
sample was analyzed in triplicate. The relative expression
ratio (R) of a target gene was expressed for the sample vs
the control in comparison to the 18S ribosomal RNA
(rRNA) [26]. R was calculated based on the following
equation [27]: R = 2−ΔΔCt
, where Ct represents the first
cycle at which the fluorescence signal was significantly
different from the background and ΔΔCt is (Ct, target − Ct,
18s rRNA)treatment − (Ct, target − Ct, 18s rRNA)control.
2.6. Data analysis
The results are expressed as means ± standard error of
mean (SEM). An unpaired t test with a P value of b .05 was
used to determine statistical significance.
3. Results
3.1. Metabolic parameters
The general metabolic profiles of the animals are
summarized in Table 3. The baseline body weight of the
rats at the beginning of the study was similar in all groups.
The body weight gain and the final weight of all rats fed the
3T. Matsunami et al. / Metabolism Clinical and Experimental xx (2010) xxx–xxx

4. control diet or the HFC diet were measured at the end of the
8-week treatment period. The HFC diet–fed fa/fa rats (the
HFC rats) showed weight loss (506 ± 26 g, mean ± SEM),
in particular, decreasing significantly (P b .05) compared
with the control diet–fed fa/fa rats (the control rats, 571 ±
5.2 g). Similarly, the mean daily food intake of the HFC rats
decreased significantly (P b .05) compared with the control
rats (Table 3), suggesting that reduction of body weights
might be associated with fatty diarrhea from the beginning
of the feeding in obese fa/fa Zucker rats fed with the HFC
diet and that the HFC diet might be easy to be induced to
the liver. Because the liver weight of the HFC rats was
4-fold higher than that of the control rats (53.2 ± 0.5 vs
13.3 ± 0.5 g, respectively). The weight of the intraabdom-
inal fat was not different between the control and HFC rats.
Concentrations of fasting plasma glucose (8.2 ± 0.5 vs 5.6 ±
0.3 mmol/L, P b .05), cholesterol (1360 ± 74 vs 128 ±
1.5 mg/dL, P b .05), and serum NEFAs (1.77 ± 0.11 vs
1.15 ± 0.19 mEq/L, P b .05) were all significantly higher in
the HFC rats than in the control rats. However, plasma
triglyceride concentrations of the HFC rats were signifi-
cantly lower than those of the control rats (229 ± 13.6 vs
335 ± 30.3 mg/dL, P b .05). Plasma insulin concentrations
were not different between the control and HFC rats (17.4 ±
0.9 vs 15.5 ± 0.5 ng/mL).
3.2. Antioxidant defense activities
Levels of GSH were lowest in the HFC rats (Table 4). The
lowest activities of SOD, GPx, and especially CAT were
found with the HFC rats (Table 4). The thiobarbituric acid
reactive substances (TBARS) levels in the HFC rats
Table 2
Primers sequences used for real-time PCR reactions
Gene GenBank accession no. Forward 5′ → 3′ Reverse 5′ → 3′
Adipoq NM_144744 GGGAGACGCAGGTGTTCTTG CGCTGAATGCTGAGTGATACATG
AdipoR1 NM_207587 TCATCTACCTCTCCATCGTCTGTGT CAAGCCAAGTCCCAGGAACA
AdipoR2 NM_001037979 CATGTTTGCCACCCCTCAGTA ATGCAAGGTAGGGATGATTCCA
IRS-1 NM_012969 TGTGCCAAGCAACAAGAAAG ACGGTTTCAGAGCAGAGGAA
IRS-2 AF087674 CTACCCACTGAGCCCAAGAG CCAGGGATGAAGCAGGACTA
AMPKα1 NM_019142 GGGATCCATCAGCAACTATCG GGGAGGTCACGGATGAGG
AMPKα2 NM_023991 CATTTGTGCAAGGCCCCTAGT GACTGTTGGTATCTGCCTGTTTCC
SREBP-1c XM_213329 GCAACACTGGCAGAGATCTACGT TGGCGGGCACTACTTAGGAA
ACCα NM_022193 TGAAGGGCTACCTCTAATG TCACAACCCAAGAACCAC
FAS M76767 TGGGCCCAGCTTCTTAGCC GGAACAGCGCAGTACCGTAGA
PPARα NM_013196 TGAACAAAGACGGGATG TCAAACTTGGGTTCCATGAT
CPT-1a NM_031559 GGTGGGCCACAAATTACGTG CAGCATCTCCATGGCGTAGT
UCP-2 NM_019354 TCTCCCAATGTTGCCCGAAA GGGAGGTCGTCTGTCATGAG
Foxa2 NM_012743 TGAAGATGGAAGGGCACGAG CCCACATAGGATGACATGTTC
ACOX J02752 ATGGCAGTCCGGAGAATACCC CCTCATAACGCTGGCTTCGAGT
CYP2E1 NM_031543 AAAGCGTGTGTGTGTTGGAGAA AGAGACTTCAGGTTAAAATGCTGCA
CYP4A1 NM_175837 TTGAGCTACTGCCAGATCCCAC CCCATTTTTGGACTTCAGCACA
SCD1 NM_139192 CTCCACTGCTGGACATGAGA AATGAGTGAAGGGGCACAAC
ATF3 M63282 GAGCGAAGACTGGAGCAAAA AAGGTGCTTGTTCTGGATGG
XBP1 NM_001004210 TCTCAATCACAAGCCCATGA GAGCAGCAAGTGGTGGATTT
CHOP U30186 CCAGCAGAGGTCACAAGCAC CGCACTGACCACTCTGTTTC
18s rRNA M11188 GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG
Table 3
Effects of HFC treatment on metabolic parameters in HFC diet–induced rats
with NASH at 8 weeks of treatment
Diet type Obese (fa/fa) Zucker rats
Control HFC
Body weight (g) 571 ± 5.2 506 ± 25.9
Food intake (g/d) 26.3 ± 3.8 21.8 ± 3.8
Liver weight (g) 13.3 ± 0.5 53.2 ± 0.5⁎
Intraabdominal fat weight (g) 37.3 ± 1.7 34.8 ± 4.2
Epididymal fat pad weight (g) 14.6 ± 0.9 12 ± 0.2
Mesenteric fat weight (g) 7.2 ± 0.4 6.1 ± 0.5
Perinephric fat weight (g) 15.7 ± 1.6 17.2 ± 3.7
Plasma glucose (mmol/L) 5.6 ± 0.3 8.2 ± 0.5⁎
Plasma insulin (ng/mL) 17.4 ± 0.9 15.5 ± 0.5
Plasma total cholesterol (mg/dL) 128 ± 1.5 1360 ± 74⁎
Plasma triglycerides (mg/dL) 335 ± 30.3 229 ± 13.6
Serum NEFAs (mEq/L) 1.15 ± 0.19 1.77 ± 0.11⁎
Values are expressed as mean ± SEM (n = 8).
⁎ P b .05 for HFC diet–induced rats vs control diet–induced rats.
Table 4
Effects of HFC treatment on antioxidant defense enzymes in HFC diet–
induced rats with NASH at 8 weeks of treatment
Treatment GSH SOD CAT GPx
fa/fa control 61 ± 5.5 96 ± 10 5956 ± 278 604 ± 20
fa/fa HFC 42 ± 5⁎ 54 ± 7.1⁎ 1381 ± 141⁎ 356 ± 43⁎
Values are expressed as mean ± SEM (n = 8). Levels of GSH were measured
and expressed as nanomoles per milligram of protein. The activities of total
SOD, CAT, and total GPx were measured and expressed as units per
milligram of protein.
⁎ P b .05 for HFC diet–induced rats vs control diet–induced rats.
4 T. Matsunami et al. / Metabolism Clinical and Experimental xx (2010) xxx–xxx

5. increased significantly (P b .05) compared with the control
rats (Fig. 1).
3.3. Liver histopathology and the hepatic triglyceride
content in the HFC rats
Foci of lobular inflammation appeared scattered in the
livers of the HFC rats (Fig. 2A). The HFC rats developed
steatohepatitis and ballooning degeneration, and also
showed significant macrosteatosis extending beyond the
periportal area into the lobule and the central zone
(Fig. 2A). Thus, the HFC diet–induced steatosis and
inflammation were more severe in the HFC rats at
8 weeks than in the control rats (P b .05; Fig. 2A, C). In
addition, the HFC diet accelerated the severity of fibrosis,
which appeared perisinusoidal/pericellular and as portal
fibrosis with focal or extensive bridging fibrosis in the fa/fa
Fig. 1. Comparison of lipid peroxidation levels (TBARS) in the liver and
erythrocytes between control diet–induced rats (control) and HFC diet–
induced rats (HFC). The TBARS values are indicated as nanomoles per
milligram protein in the liver and as nanomoles per gram hemoglobin in
erythrocytes. Values are expressed as mean ± SEM (n = 8). ⁎P b .05 for HFC
diet–induced rats vs control diet–induced rats.
Fig. 2. Liver histopathology. Photomicrographs of liver samples stained with hematoxylin and eosin (A) and Mason trichrome (B) after 8 weeks on the control
diet or HFC diet. Hepatocyte ballooning is shown in the insets. Arrows indicate infiltration of the inflammatory cells in hepatic parenchyma and portal tract.
Original magnification, 100×. Criteria for each score are described in “Materials and methods.” Histologic diagnosis at 8 weeks (C). Values are expressed as
mean ± SEM (n = 8). ⁎P b .05 for HFC diet–induced rats vs control diet–induced rats.
5T. Matsunami et al. / Metabolism Clinical and Experimental xx (2010) xxx–xxx

6. rats (Fig. 2B), and also caused progression of fibrosis in
these rats (P b .05; Fig. 2B, C).
The HFC rats showed macrovesicular steatosis in the
liver (Fig. 2A). Therefore, the hepatic triglyceride content
was measured to evaluate the progression of steatosis
quantitatively after 8 weeks (Fig. 3A). Hepatic triglyceride
content increased significantly in the HFC diet (P b .05 vs
the control rats). Plasma ALT levels were about 1.9-fold
higher in the HFC rats than in the control rats (Fig. 3B).
As observed above, the HFC rats met the definitions
of NASH.
3.4. Expression of adiponectin, adiponectin receptors
(AdipoR1/R2), and insulin receptor substrate (IRS-1/-2)
In the adipose tissue of NASH, the gene expression level
of adiponectin was lower than in control rats; however, there
were no significant differences between NASH and control
rats, respectively (Fig. 4A). The expression levels of the
adiponectin receptor (AdipoR1/R2) genes were significantly
down-regulated (0.74- and 0.67-fold, respectively) in the
liver of NASH compared with control rats (Fig. 4A).
In the liver of NASH, the expression level of IRS-1 was
significantly increased 2.8-fold; and IRS-2 was significantly
decreased 0.48-fold compared with control rats (Fig. 4A).
3.5. Expression of genes related to de novo synthesis of
fatty acids
In the process of fatty acid synthesis, on binding,
AdipoR1/R2 activates AMPK, triggering the phosphoryla-
tion of ACC; and then ACC converts acetyl-CoA, an
essential substrate of fatty acids, to malonyl-CoA [28]. In
addition, both ACC and FAS are positively regulated by
SREBP-1c [29,30]. In the liver of NASH, the expression
levels of genes encoding key regulators of fatty acid
synthesis, including ACC, FAS, and SREBP-1c, were
significantly up-regulated (5.5-, 4.8-, and 6.8-fold, respec-
tively) compared with control rats (Fig. 4B).
3.6. Gene expression related to fatty acid oxidation in
mitochondria, peroxisomes, and microsomes
CPT-1a is a regulatory enzyme in mitochondria that
transfers fatty acids from the cytosol to mitochondria before
β-oxidation [31]. In the liver of NASH, the messenger RNA
(mRNA) expression level of CPT-1a was significantly
decreased 0.24-fold compared with control rats (Fig. 5). In
the liver of NASH, gene expression level of PPARα was
significantly down-regulated (5.4-fold) compared with
control rats, whereas the expression levels of UCP-2,
ACOX, CYP4A1, and CYP2E1 were significantly up-
regulated (3.3-, 3.5-, 12.4-, and 3.6-fold, respectively)
compared with control rats (Fig. 5).
Recently, IRSs have been reported to negatively regulate
another transcriptional factor, Foxa2, which enhances β-
oxidation of fatty acids [14]. In the liver of NASH, the
expression level of Foxa2 was 3.0-fold higher than control
rats (Fig. 5).
Fig. 3. Hepatic triglyceride content (A) and plasma ALT levels (B) in control
diet–induced rats (control) and HFC diet–induced rats (HFC) groups.
Hepatic triglyceride content values are indicated as grams per liter in the
liver, and plasma ALT values are indicated as units per liter in the plasma.
Values are expressed as mean ± SEM (n = 8). ⁎P b .05 for HFC diet–
induced rats vs control diet–induced rats.
Fig. 4. Real-time PCR analysis for gene expression of adiponectin and
AdipoR1/R2 and IRS-1/-2 (A) and de novo synthesis (B) of fatty acids in
NASH. Values are expressed as mean ± SEM (n = 8). ⁎P b .05 for NASH
rats vs control rats. Adipoq indicates adiponectin.
6 T. Matsunami et al. / Metabolism Clinical and Experimental xx (2010) xxx–xxx

7. 3.7. Gene expression related to synthesis of
monounsaturated fatty acids from saturated fatty acids
Stearoyl-CoA desaturase 1 converts saturated fatty acids
to monounsaturated fatty acids, which are major substrates
for synthesis of triacylglycerols and other lipids [32]. In the
liver of NASH, the expression level of SCD1 was
significantly increased 2.3-fold compared with control rats
(data not shown).
3.8. Gene expression related to ER stress
Endoplasmic reticulum stress and activation of the
unfolded protein response (UPR) in the liver have been
observed in dietary models of NAFLD and in humans with
NAFLD [33,34]. In the liver of NASH, the expression
levels of genes relating to ER stress, including ATF3,
XBP1, and CHOP, were significantly up-regulated (3.2-,
2.6-, and 3.0-fold, respectively) compared with control rats
(data not shown).
4. Discussion
In the present study, we showed that fa/fa rats fed the
HFC diet for 8 weeks developed insulin resistance,
hyperglycemia, and hyperlipidemia; in addition, the fatty
liver spontaneously developed intralobular inflammation
with ballooning degeneration, Mallory hyaline bodies, and
pericellular fibrosis in the intralobular spaces, which are all
characteristics of NASH. The liver inflammation and fibrosis
observed in this model could be the result of a “second hit” to
NASH, following the known progression of hepatic steatosis
[35]. The development of fatty liver into NASH has been
linked to oxidative stress and lipid peroxidation in the liver,
leading to inflammation [36-38]. We have also shown, for
the first time, the dynamic panel of gene expression related to
de novo synthesis and oxidation of fatty acids under the
controls of AdipoR1/R2 or IRS-1/-2 in the NASH liver.
The liver of NASH showed significantly down-regulated
expression of the genes for AdipoR1/R2, although no
significant changes were observed in adiponectin gene
expression. AdipoR1/R2 expression in humans and mice
of NAFLD with obesity, respectively, has been shown to be
decreased [39,40]. Plasma adiponectin levels and the
expression levels of AdipoR1/R2 have also been shown to
be decreased in obesity and insulin resistance [41]. These
reports suggested that obesity decreases not only plasma
adiponectin levels but also AdipoR1/R2 expression, thereby
reducing adiponectin sensitivity and leading to insulin
resistance, which in turn aggravates hyperinsulinemia,
creating a “vicious cycle” [41]. Thus, AdipoR1/R2 expres-
sions in the liver of NASH with obesity and insulin
resistance might be lower than control rats. Bullen et al
[42], however, reported that AdipoR1/R2 expression in the
liver of high-fat diet–induced mice have been shown to be
increased, suggesting that the model used in this study is a
model of high-fat diet added on the background of functional
leptin deficiency (genetic background of rodents used
herein); and this may explain the differences from data
reported by Bullen et al. Further studies are necessary to
clarify the mechanism of regulation of adiponectin receptors
including leptin or leptin resistance in NASH.
Gene expression levels related to de novo synthesis of
fatty acids in the liver of NASH were significantly up-
regulated compared with control rats, whereas those levels of
AMPKα1/α2, which were activated by AdipoR1/R2, were
down-regulated compared with control rats. In the present
study, a positive correlation was found between ACC, FAS,
and SREBP-1c expressions. Both ACC and FAS expressions
are positively regulated by SREBP-1c [30]. Adenosine
monophosphate–activated protein kinase activation inhibits
ACC expression indirectly via the suppression of SREBP-1c,
and AMPK is activated by adiponectin [28]. Therefore,
hypoadiponectinemia might contribute to the down-regula-
tion of the expression of AMPK in the liver of NASH.
Sterol regulatory element binding protein–1c is sup-
pressed by AMPK, whereas it is activated by insulin
signaling pathways including IRSs [29,43]. In the present
study, IRS-1 expression was significantly elevated and
a positive correlation with SREBP-1c expression was
observed in the liver of NASH; however, IRS-2 expression
was significantly reduced. Recent reports showed that IRS-2
expression, not IRS-1, is down-regulated in the liver of
ob/ob mice with insulin resistance, whereas SREBP-1c
expression is up-regulated [44]. Ide et al [17] reported that
the up-regulation of SREBP-1c expression induces hepatic
insulin resistance through suppression of IRS-2 expression.
Fig. 5. Real-time PCR analysis for gene expression of oxidation of fatty
acids in NASH. Values are expressed as mean ± SEM (n = 8). ⁎P b .05 for
NASH rats vs control rats.
7T. Matsunami et al. / Metabolism Clinical and Experimental xx (2010) xxx–xxx

8. Our study showed that a positive correlation existed between
fatty acid de novo synthesis enzymes of ACC, FAS, and
SREBP-1c in the liver of NASH. Previous reports and our
findings indicated that the up-regulation of SREBP-1c not
only increases ACC and FAS expression, but also suppresses
IRS-2 expression via a negative feedback mechanism. It is
well known that insulin resistance in liver is associated with
the down-regulation of both IRS-1/-2 [16,18]. The present
study, however, showed the up-regulation of IRS-1 in the
liver of NASH, suggesting that the insulin signaling
pathways are disrupted there, particularly in terms of
normally coordinated regulation between IRS-1 and IRS-2.
Generally, IRS-1 is linked more closely to glucose
homeostasis and IRS-2 to lipid metabolism [15]. It has
been shown that in liver-specific knockout of IRS-1 or IRS-2
expression in C57BL/6 mice, the knockout of hepatic IRS-1
resulted in an up-regulation of gene expression of the
gluconeogenic enzymes, whereas knockout of IRS-2
resulted in the up-regulation of lipogenic enzymes of
SREBP-1c and FAS, as well as increased hepatic lipid
accumulation [15]. Taniguchi et al [15] suggested that
hepatic IRS-1/-2 have complementary roles in the control of
hepatocyte metabolism; and in the liver of NASH, the up-
regulation of IRS-1 may be compensated for by the down-
regulation of IRS-2, which was suppressed by SREBP-1c.
Our results suggest that when fatty acids synthesis of IRS-2
failed in the liver of NASH, the switch from IRS-2 to IRS-1
can occur; and the up-regulation of SREBP-1c by IRS-1
might result in enhanced fatty acids synthesis. Interestingly,
in the liver of high-fat–fed rats, IRS-1 protein level, but not
IRS-2, was slightly increased; and insulin-stimulated
tyrosine phosphorylation levels of hepatic IRS-1 were higher
than controls [19]. Further studies are necessary to clarify the
mechanism of up-regulation of hepatic IRS-1 in NASH.
Peroxisome proliferator–activated receptor α up-regulates
the expression of a suite of genes that includes mitochon-
drial, peroxisomal, and microsomal fatty acid oxidation
enzymes in liver. However, PPARα expression in the liver of
NASH in this current study were significantly down-
regulated, whereas mRNA expression of other genes related
to oxidation of fatty acids were significantly up-regulated. A
recent study reported that the down-regulation of AdipoR2
expression is attributable to decreased PPARα expression in
NASH, which agrees with our findings [39]. In this study, we
found the down-regulation of AdipoR2 expression in the
liver of NASH. Thus, AdipoR2 might be a major regulator of
PPARα in the liver of NASH. Uncoupling protein–2 is
known to reduce potential ROS production in mitochondria
[45]. The up-regulation of UCP-2 found in this study
suggested that UCP-2 may increase the mitochondrial β-
oxidation of fatty acids in the liver of NASH [46] and that
excess ROS production occurs by increased β-oxidation. In
addition, in mitochondrial β-oxidation, the mRNA expres-
sion level of CPT-1a, an independent enzyme for β-oxidation
from PPARα, was down-regulated in the liver of NASH,
suggesting that it is attributable to an increase in malonyl-
CoA [47] because the expression of ACC, catalyzing acetyl-
CoA to malonyl-CoA, was increased.
Excessive fatty acids in hepatocytes activate alternative
pathways of fatty acid oxidation, such as β-oxidation
occurring by ACOX in peroxisomes and ω-oxidation by
CYP2E1/CYP4A1 in microsomes [48]. Thus, the observed
elevations of peroxisomal β-oxidation gene expression
(ACOX) and of microsomal ω-oxidation (CYP4A1 and
CYP2E1) might be due to compensation in the liver of
NASH, suggesting that accumulation of fatty acids enhances
oxidation not only in mitochondria but also in peroxisomes
and microsomes in the liver of NASH. In addition, we found
that the enhancement of mRNA expression levels of ACOX
and CYP4A1 (3.5- and 3.6-fold, respectively) was less than
that of CYP2E1 (12.4-fold), which is not regulated by
PPARα. The differences in the expression of oxidation
enzymes of ACOX in peroxisomes and CYP4A1 in
microsomes might be attributable to the down-regulation
of PPARα in the liver of NASH.
Positive fatty acid β-oxidation regulator of Foxa2 is
normally suppressed by both IRS-1 and IRS-2 [14].
However, despite a decrease of IRS-2 expression, the
observed significant increase of Foxa2 expression in the
liver of NASH in comparison might be correlated with
the net balance between decreased IRS-2 and increased
IRS-1. Taken together with our findings, it is suggested that
the up-regulation of Foxa2 was enhanced by suppressed
IRS-2 via a negative feedback of SREBP-1c. Thus, IRS-2
could be a major regulator of Foxa2 in the liver with NASH.
Recently, it was reported that Foxa2 plays a regulation role
in lipid metabolism, such as UCP-2 expression with
mitochondrial β-oxidation in the liver, and improves hepatic
insulin resistance in diabetic or insulin resistance mice [14].
We showed the up-regulation of UCP-2, suggesting that the
up-regulation of Foxa2 and UCP-2 leads to an increase in
fatty acid β-oxidation in the liver of NASH.
In conclusion, our NASH animal model indicated various
gene expression dynamics and suggested their possible
regulatory roles for fatty acids synthesis and oxidation as
follows: (1) The mRNA down-regulation of AdipoR1/R2
and AMPKα1/α2 induced fatty acid synthesis through the
up-regulation of SREBP-1c, which is stimulated by the up-
regulation of IRS-1. (2) The up-regulation of Foxa2 via a
negative feedback of the down-regulation of IRS-2, which is
suppressed by increased SREBP-1c, induced fatty acid β-
oxidation in UCP-2; and mitochondrial fatty acid β-oxidation
was increased to improve fatty acid accumulation. (3)
Despite the down-regulation of AdipoR2 and PPARα, fatty
acid oxidation was increased; and when there is an excess of
fatty acids in hepatocytes, alternative pathways of fatty acid
oxidation, such as peroxisomal β-oxidation and microsomal
ω-oxidation, are increased in compensation. Thus, the
present NASH model system can be applied to further
studies of the pathology, treatment, and prevention of this
recently increasing abnormal liver dysfunction associated
with synthesis and oxidation of fatty acids. In addition, we
8 T. Matsunami et al. / Metabolism Clinical and Experimental xx (2010) xxx–xxx

9. found that the enhancement of mRNA expression levels of
genes related to ER stress. These results suggest that the
UPR responds to the fatty acids environment and also
indicate that the ratio of saturated fatty acids may be an
important determinant of hepatic ER homeostasis. Future
studies are necessary to determine whether ER stress and
activation of the UPR are causally linked to saturated fatty
acid–induced apoptosis and NASH.
Acknowledgment
This study was partially supported by the Academic
Frontier Project “Surveillance and control for zoonoses” and
the Strategic Research Base Development Program “Inter-
national research on epidemiology of zoonoses and training
for young researchers” from the Ministry of Education,
Culture, Sports, Science, and Technology, Japan.
References
[1] Ludwig J, McGill DB, Lindor KD. Review: nonalcoholic steatohepa-
titis. J Gastroenterol Hepatol 1997;12:398-403.
[2] McCullough AJ. Update on nonalcoholic fatty liver disease. J Clin
Gastroenterol 2002;34:255-62.
[3] Fruebis J, Tsao TS, Javorschi S, et al. Proteolytic cleavage product of
30-kDa adipocyte complement-related protein increases fatty acid
oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci
U S A 2001;98:2005-10.
[4] Yamauchi T, Kamon J, Minokoshi Y, et al. Adiponectin stimulates
glucose utilization and fatty-acid oxidation by activating AMP-
activated protein kinase. Nat Med 2002;8:1288-95.
[5] Yamauchi T, Nio Y, Maki T, et al. Targeted disruption of AdipoR1 and
AdipoR2 causes abrogation of adiponectin binding and metabolic
actions. Nat Med 2007;13:332-9.
[6] Kadowaki T, Yamauchi T. Adiponectin and adiponectin receptors.
Endocr Rev 2005;26:439-51.
[7] Musso G, Gambino R, De Michieli F, et al. Nitrosative stress predicts
the presence and severity of nonalcoholic fatty liver at different stages
of the development of insulin resistance and metabolic syndrome:
possible role of vitamin A intake. Am J Clin Nutr 2007;86:661-71.
[8] Tsochatzis E, Papatheodoridis GV, Archimandritis AJ. The evolving
role of leptin and adiponectin in chronic liver diseases. Am J
Gastroenterol 2006;101:2629-40.
[9] Kaser S, Moschen A, Cayon A, et al. Adiponectin and its receptors in
non-alcoholic steatohepatitis. Gut 2005;54:117-21.
[10] Vuppalanchi R, Marri S, Kolwankar D, et al. Is adiponectin involved in
the pathogenesis of nonalcoholic steatohepatitis? A preliminary human
study. J Clin Gastroenterol 2005;39:237-42.
[11] Osborne TF. Sterol regulatory element-binding proteins (SREBPs):
key regulators of nutritional homeostasis and insulin action. J Biol
Chem 2000;275:32379-82.
[12] Matsuzaka T, Shimano H, Yahagi N, et al. Insulin-independent
induction of sterol regulatory element-binding protein–1c expres-
sion in the livers of streptozotocin-treated mice. Diabetes 2004;53:
560-9.
[13] Kerouz NJ, Horsch D, Pons S, Kahn CR. Differential regulation of
insulin receptor substrates–1 and –2 (IRS-1 and IRS-2) and
phosphatidylinositol 3-kinase isoforms in liver and muscle of the
obese diabetic (ob/ob) mouse. J Clin Invest 1997;100:3164-72.
[14] Wolfrum C, Asilmaz E, Luca E, Friedman JM, Stoffel M. Foxa2
regulates lipid metabolism and ketogenesis in the liver during fasting
and in diabetes. Nature 2004;432:1027-32.
[15] Taniguchi CM, Ueki K, Kahn R. Complementary roles of IRS-1 and
IRS-2 in the hepatic regulation of metabolism. J Clin Invest 2005;115:
718-27.
[16] Valverde AM, Arribas M, Mur C, et al. Insulin-induced up-regulated
uncoupling protein–1 expression is mediated by insulin receptor
substrate 1 through the phosphatidylinositol 3-kinase/Akt signaling
pathway in fetal brown adipocytes. J Biol Chem 2003;278:10221-31.
[17] Ide T, Shimano H, Yahagi N, et al. SREBPs suppress IRS-2–mediated
insulin signalling in the liver. Nat Cell Biol 2004;6:351-7.
[18] Dong X, Park S, Lin X, et al. Irs1 and Irs2 signaling is essential for
hepatic glucose homeostasis and systemic growth. J Clin Invest 2006;
116:101-14.
[19] Anai M, Funaki M, Ogihara T, et al. Enhanced insulin-stimulated
activation of phosphatidylinositol 3-kinase in the liver of high-fat–fed
rats. Diabetes 1999;48:158-69.
[20] Meister A. Glutathione deficiency produced by inhibition of its
synthesis, and its reversal; applications in research and therapy.
Pharmacol Ther 1991;51:155-94.
[21] Sun Y, Oberley LW, Li Y. A simple method for clinical assay of
superoxide dismutase. Clin Chem 1988;34:497-500.
[22] Aebi H. Catalase in vitro. Methods Enzymol 1984;105:121-6.
[23] Paglia DE, Valentine WN. Studies on the quantitative and qualitative
characterization of erythrocyte glutathione peroxidase. J Lab Clin Med
1967;70:158-69.
[24] Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal
tissues by thiobarbituric acid reaction. Anal Biochem 1979;95:351-8.
[25] Brunt EM, Janney CG, Di Bisceglie AM, et al. Nonalcoholic
steatohepatitis: a proposal for grading and staging the histological
lesions. Am J Gastroenterol 1999;94:2467-74.
[26] Schmittgen TD, Zakrajsek BA. Effect of experimental treatment on
housekeeping gene expression: validation by real-time, quantitative
RT-PCR. J Biochem Biophys Methods 2000;46:69-81.
[27] Pfaffl MW. A new mathematical model for relative quantification in
real-time RT-PCR. Nucleic Acids Res 2001;29:e45.
[28] Long YC, Zierath JR. AMP-activated protein kinase signaling in
metabolic regulation. J Clin Invest 2006;116:1776-83.
[29] Zhou G, Myers R, Li Y, et al. Role of AMP-activated protein kinase in
mechanism of metformin action. J Clin Invest 2001;108:1167-74.
[30] Leff T. AMP-activated protein kinase regulates gene expression by
direct phosphorylation of nuclear proteins. Biochem Soc Trans 2003;
31:224-7.
[31] Rodriguez MI, Escames G, Lopez LC, et al. Improved mitochondrial
function and increased life span after chronic melatonin treatment in
senescent prone mice. Exp Gerontol 2008;43:749-56.
[32] Ntambi JM, Miyazaki M. Regulation of stearoyl-CoA desaturases and
role in metabolism. Prog Lipid Res 2004;43:91-104.
[33] Wang CH, Leung CH, Liu SC, et al. Safety and effectiveness of
rosiglitazone in type 2 diabetes patients with nonalcoholic fatty liver
disease. J Formos Med Assoc 2006;105:743-52.
[34] Puri P, Mirshahi F, Cheung O, et al. Activation and dysregulation of
the unfolded protein response in nonalcoholic fatty liver disease.
Gastroenterology 2008;134:568-76.
[35] Day CP. Pathogenesis of steatohepatitis. Best Pract Res Clin 2002;16:
663-78.
[36] George J. Ascorbic acid concentrations in dimethylnitrosamine-
induced hepatic fibrosis in rats. Clin Chim Acta 2003;335:39-47.
[37] Browning JD, Horton JD. Molecular mediators of hepatic steatosis and
liver injury. J Clin Invest 2004;114:147-52.
[38] Carmiel-Haggai M, Cederbaum AI, Nieto N. A high-fat diet leads to
the progression of non-alcoholic fatty liver disease in obese rats.
FASEB J 2005;19:136-8.
[39] Tomita K, Oike Y, Teratani T, et al. Hepatic AdipoR2 signaling plays a
protective role against progression of nonalcoholic steatohepatitis in
mice. Hepatology 2008;48:458-73.
[40] Ma H, Gomez V, Lu L, et al. Expression of adiponectin and its
receptors in livers of morbidly obese patients with non-alcoholic fatty
liver disease. J Gastroenterol Hepatol 2009;24:233-7.
9T. Matsunami et al. / Metabolism Clinical and Experimental xx (2010) xxx–xxx

10. [41] Tsuchida A, Yamauchi T, Ito Y, et al. Insulin/Foxo1 pathway regulates
expression levels of adiponectin receptors and adiponectin sensitivity.
J Biol Chem 2004;279:30817-22.
[42] Bullen Jr JW, Bluher S, Kelesidis T, et al. Regulation of
adiponectin and its receptors in response to development of diet-
induced obesity in mice. Am J Physiol Endocrinol Metab 2007;292:
E1079-1086.
[43] Woods A, Azzout-Marniche D, Foretz M, et al. Characterization of the
role of AMP-activated protein kinase in the regulation of glucose-
activated gene expression using constitutively active and dominant
negative forms of the kinase. Mol Cell Biol 2000;20:6704-11.
[44] Shimomura I, Matsuda M, Hammer RE, et al. Decreased IRS-2
and increased SREBP-1c lead to mixed insulin resistance and
sensitivity in livers of lipodystrophic and ob/ob mice. Mol Cell
2000;6:77-86.
[45] Pessayre D, Berson A, Fromenty B, et al. Mitochondria in
steatohepatitis. Semin Liver Dis 2001;21:57-69.
[46] Miele L, Grieco A, Armuzzi A, et al. Hepatic mitochondrial beta-
oxidation in patients with nonalcoholic steatohepatitis assessed by
13C-octanoate breath test. Am J Gastroenterol 2003;98:2335-6.
[47] Grum DE, Hansen LR, Drackley JK. Peroxisomal beta-oxidation of
fatty acids in bovine and rat liver. Comp Biochem Physiol 1994;109:
281-92.
[48] Reddy JK, Hashimoto T. Peroxisomal beta-oxidation and peroxisome
proliferator-activated receptor alpha: an adaptive metabolic system.
Annu Rev Nutr 2001;21:193-230.
10 T. Matsunami et al. / Metabolism Clinical and Experimental xx (2010) xxx–xxx