Downloaded 294 times
Uploaded byVia Christi Health
Breast cancer genetic testing: Is it right for you?
The document discusses the implications of genetic testing for breast cancer, particularly focusing on the BRCA1 and BRCA2 genes and their association with increased risks of breast and ovarian cancer. It highlights notable cases like Angelina Jolie and Christina Applegate, who opted for preventive surgeries after testing positive for BRCA mutations. Furthermore, it provides statistical data on breast and ovarian cancer prevalence, genetic mutation rates, and the evolutionary history of BRCA gene discovery.
More Related Content
![HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.](https://cdn.slidesharecdn.com/ss_thumbnails/hboc1-150312034459-conversion-gate01-thumbnail.jpg?width=640&height=640&fit=bounds)
Similar to Breast cancer genetic testing: Is it right for you?
More from Via Christi Health
Breast cancer genetic testing: Is it right for you?
- 1. Breast cancer genetictesting: Is it right for you? Patty Tenofsky, MD FACS Women‘s Connection October 8, 2013
- 2.
- 3.
- 4. Angelina Jolie‘s decision •“The truth is I carry a „faulty‟ gene, BRCA 1, which sharply increases my risk of developing breast cancer and ovarian cancer.” • Her mother had previously battled breast cancer, but then developed ovarian cancer at age 49 and died of the disease at age 56 • Her Grandmother died of ovarian cancer at age 45 • Her maternal aunt died of breast cancer • She chose to have bilateral preventive double mastectomies. • She plans to have her ovaries removed once she has decided that she does not want any more children.
- 5. Christina Applegate • Shewas diagnosed with breast cancer, and then found to have the BRCA 1 gene at age 36 • She chose to have bilateral mastectomies
- 6. Breast & OvarianCancer • 200,000 cases of Breast Cancer/year in the U.S. – Lifetime risk is around 10-13% – Risk factors • Being a woman and getting older • Family history, early menarche, late or no pregnancy, hormone replacement, alcohol use, obesity, lack of exercise • 25,000 cases of Ovarian Cancer/year in the U.S. – Lifetime risk is <2%
- 7. Most Women DevelopBreast Cancer WITHOUT a Family History
- 8. Hereditary Breast &Ovarian Cancer Syndrome (BRCA) • Characterized by significantly increased risks for breast and ovarian cancer – 1:800 people in the general population have a BRCA genetic mutation – 1:40 people of Eastern European Jewish descent will have the gene. • Most cases are caused by a BRCA1 or BRCA2 mutation • Clinical testing is available to identify individuals with mutations
- 9. DNA • Double Helix •Made up of 4 building blocks that get together in pairs – Adenine (A), thymine (T) , guanine (G), cytosine (C) • These 4 ―letters‖ create a ―word‖ that codes for a certain amino acid. Amino Acids are the building blocks of our proteins – these proteins are what lead to our characteristics and features • Misplaced letters or words can lead to severely incorrect proteins (mutations)
- 10. Sickle Cell Anemia– only one base code incorrect
- 11. What is thepurpose of our normal BRCA genes? • BRCA gene‘s purpose: It codes for proteins that function to fight changes in your DNA that can lead to breast and ovarian cancer. – Changes may occur in your DNA which can lead to cancer when normal cells divide and are exposed to cancer inducing substances – BRCA gene is therefore a cancer fighter • BRCA gene that is mutated: The body is less able to find and repair mistakes and cancer is more likely.
- 12. Background • 1990 –Families who had many women with breast and ovarian cancer underwent DNA studies and scientists identified the first gene associated with breast cancer: BRCA 1 on Chromosome 17. • 1994 – BRCA 2 gene was discovered on Chromosome 13. • Jewish families were found to have a much higher rate of the gene mutations. • By the late 1990s – we were able to test for the gene mutations.
- 13.
- 14. Laboratory Testing for GeneticMutations • BRCA1: > 5,500 bp– AGCTCGCTGAGACTTCCTGGACCCCGCACCAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAGTTCATTGGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCC ATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTG TGCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTC TCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCA AAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAG AACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTAGATCTGAATGCTGATCCCCTGTGTGAGAGAAAA GAATGGAATAAGCAGAAACTGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATGCCAAAGTAGCTGATGTATTGGACGTTCTA AATGAGGTAGATGAATATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTTAATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTGAAGACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAATCTAAT TATAGGAGCATTTGTTACTGAGCCACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGAGACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTGGCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGAGCAGAATGGTCAAGTGATGAAT ATTACTAATAGTGGTCATGAGAATAAAACAAAAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCACTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCTAAAAAGAATAGGCTGAGGAG GAAGTCTTCTACCAGGCATATTCATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCAAATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAATGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAACCTGCAACTGGAGCC AAGAAGAGTAACAAGCCAAATGAACAGACAAGTAAAAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTCTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGC TGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGCATTTGA AAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAAATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGTCGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAAT CCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTT GATAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGTTCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACTTTTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAA CATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGA ACTAGGTAGAAACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCTGAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGATTTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTA TGGGAAGTAGTCATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATGGTGAAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAGTTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCATACACATTTGGCTCAGGGTT ACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTT AAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGA GTTGGTCTGAGTGACAAGGAATTGGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAGAGCAAAGCATGGATTCAAACTTAGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGA GGGATACCATGCAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAGCAGTATTAACTTCACAGAAAAGTAGTG AATACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGG AGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGG CAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTG GCCTGACCCCAGAAGAATTTATGCTCGTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCA GTCTATTAAAGAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGATCAACTGGAATGGATGGTACAG CTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGA GCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGCAG • BRCA2: > 11,000 bp– GGTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCTCTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGGTTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCG GACTTATTTACCAAGCATTGGAGGAATATCGTAGGTAAAAATGCCTATTGGATCCAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATA AAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGGCTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAATGTTCCCAATAGTAGACATAAAAGTCTTCGCA CAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGTATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGGTCGTCAGACACCAAAACATATTTCTGAAAGTCTA GGAGCTGAGGTGGATCCTGATATGTCTTGGTCAAGTTCTTTAGCTACACCACCCACCCTTAGTTCTACTGTGCTCATAGTCAGAAATGAAGAAGCATCTGAAACTGTATTTCCTCATGATACTACTGCTAATGTGAAAAGCTATTTTTCCAATCATGATGAAAGTCTGAAGAAAAATGATAGATTTATCGCTTCTGT GACAGACAGTGAAAACACAAATCAAAGAGAAGCTGCAAGTCATGGATTTGGAAAAACATCAGGGAATTCATTTAAAGTAAATAGCTGCAAAGACCACATTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAAACAGTTGTAGATACCTCTGAAGAAGATAGTTTTTCATTATGTTTTTCTAAATGTA GAACAAAAAATCTACAAAAAGTAAGAACTAGCAAGACTAGGAAAAAAATTTTCCATGAAGCAAACGCTGATGAATGTGAAAAATCTAAAAACCAAGTGAAAGAAAAATACTCATTTGTATCTGAAGTGGAACCAAATGATACTGATCCATTAGATTCAAATGTAGCACATCAGAAGCCCTTTGAGAGTGGAAGTGAC AAAATCTCCAAGGAAGTTGTACCGTCTTTGGCCTGTGAATGGTCTCAACTAACCCTTTCAGGTCTAAATGGAGCCCAGATGGAGAAAATACCCCTATTGCATATTTCTTCATGTGACCAAAATATTTCAGAAAAAGACCTATTAGACACAGAGAACAAAAGAAAGAAAGATTTTCTTACTTCAGAGAATTCTTTGCC ACGTATTTCTAGCCTACCAAAATCAGAGAAGCCATTAAATGAGGAAACAGTGGTAAATAAGAGAGATGAAGAGCAGCATCTTGAATCTCATACAGACTGCATTCTTGCAGTAAAGCAGGCAATATCTGGAACTTCTCCAGTGGCTTCTTCATTTCAGGGTATCAAAAAGTCTATATTCAGAATAAGAGAATCACCTA AAGAGACTTTCAATGCAAGTTTTTCAGGTCATATGACTGATCCAAACTTTAAAAAAGAAACTGAAGCCTCTGAAAGTGGACTGGAAATACATACTGTTTGCTCACAGAAGGAGGACTCCTTATGTCCAAATTTAATTGATAATGGAAGCTGGCCAGCCACCACCACACAGAATTCTGTAGCTTTGAAGAATGCAGG TTTAATATCCACTTTGAAAAAGAAAACAAATAAGTTTATTTATGCTATACATGATGAAACATCTTATAAAGGAAAAAAAATACCGAAAGACCAAAAATCAGAACTAATTAACTGTTCAGCCCAGTTTGAAGCAAATGCTTTTGAAGCACCACTTACATTTGCAAATGCTGATTCAGGTTTATTGCATTCTTCTGTGAAAA GAAGCTGTTCACAGAATGATTCTGAAGAACCAACTTTGTCCTTAACTAGCTCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTTCTAATAATACAGTAATCTCTCAGGATCTTGATTATAAAGAAGCAAAATGTAATAAGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCAT GCCTGCAGGAAGGACAGTGTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATAAAAGAAGAGGTCTTGGCTGCAGCATGTCACCCAGTACAACATTCAAAAGTGGAATACAGTGATACTGACTTTCAATCCCAGAAAAGTCTTTTATATGATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCCAAG GATGTTCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGTCAGACAAGCTCAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAAAATATTCCCATGGAAAAGAATCAAGATGTATGTGCTTTAAATGAAAATTATAAAAACGTTGAGCTGTTGCCACCTGAAAAATACATGAGAGTA GCATCACCTTCAAGAAAGGTACAATTCAACCAAAACACAAATCTAAGAGTAATCCAAAAAAATCAAGAAGAAACTACTTCAATTTCAAAAATAACTGTCAATCCAGACTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTTGTCTTCCAAGTAGCTAATGAAAGGAATAATCTTGCTTTAGGAAATACTAAGGAAC TTCATGAAACAGACTTGACTTGTGTAAACGAACCCATTTTCAAGAACTCTACCATGGTTTTATATGGAGACACAGGTGATAAACAAGCAACCCAAGTGTCAATTAAAAAAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAAATAGTGTAAAGCAGCATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGAC ATCTCCTTGAATATAGATAAAATACCAGAAAAAAATAATGATTACATGAACAAATGGGCAGGACTCTTAGGTCCAATTTCAAATCACAGTTTTGGAGGTAGCTTCAGAACAGCTTCAAATAAGGAAATCAAGCTCTCTGAACATAACATTAAGAAGAGCAAAATGTTCTTCAAAGATATTGAAGAACAATATCCTACT AGTTTAGCTTGTGTTGAAATTGTAAATACCTTGGCATTAGATAATCAAAAGAAACTGAGCAAGCCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGTAGTGTAGTTGTTTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGCAGGATTTTAATTCAAACCATAATTTAACACCTAGCC AAAAGGCAGAAATTACAGAACTTTCTACTATATTAGAAGAATCAGGAAGTCAGTTTGAATTTACTCAGTTTAGAAAACCAAGCTACATATTGCAGAAGAGTACATTTGAAGTGCCTGAAAACCAGATGACTATCTTAAAGACCACTTCTGAGGAATGCAGAGATGCTGATCTTCATGTCATAATGAATGCCCCATCG ATTGGTCAGGTAGACAGCAGCAAGCAATTTGAAGGTACAGTTGAAATTAAACGGAAGTTTGCTGGCCTGTTGAAAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAAAATGAAGTGGGGTTTAGGGGCTTTTATTCTGCTCATGGCACAAAACTGAATGTTTCTACTGAAGCTCTGCAAAAAGCTG TGAAACTGTTTAGTGATATTGAGAATATTAGTGAGGAAACTTCTGCAGAGGTACATCCAATAAGTTTATCTTCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAAATCATAATGATAAAACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTACAAAATAATATTGAAATGACTACTGGCACT TTTGTTGAAGAAATTACTGAAAATTACAAGAGAAATACTGAAAATGAAGATAACAAATATACTGCTGCCAGTAGAAATTCTCATAACTTAGAATTTGATGGCAGTGATTCAAGTAAAAATGATACTGTTTGTATTCATAAAGATGAAACGGACTTGCTATTTACTGATCAGCACAACATATGTCTTAAATTATCTGGCC AGTTTATGAAGGAGGGAAACACTCAGATTAAAGAAGATTTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAGCTCAAGAAGCATGTCATGGTAATACTTCAAATAAAGAACAGTTAACTGCTACTAAAACGGAGCAAAATATAAAAGATTTTGAGACTTCTGATACATTTTTTCAGACTGCAAGTGGGAAAAATATTA GTGTCGCCAAAGAGTCATTTAATAAAATTGTAAATTTCTTTGATCAGAAACCAGAAGAATTGCATAACTTTTCCTTAAATTCTGAATTACATTCTGACATAAGAAAGAACAAAATGGACATTCTAAGTTATGAGGAAACAGACATAGTTAAACACAAAATACTGAAAGAAAGTGTCCCAGTTGGTACTGGAAATCAACT AGTGACCTTCCAGGGACAACCCGAACGTGATGAAAAGATCAAAGAACCTACTCTGTTGGGTTTTCATACAGCTAGCGGGAAAAAAGTTAAAATTGCAAAGGAATCTTTGGACAAAGTGAAAAACCTTTTTGATGAAAAAGAGCAAGGTACTAGTGAAATCACCAGTTTTAGCCATCAATGGGCAAAGACCCTAAA GTACAGAGAGGCCTGTAAAGACCTTGAATTAGCATGTGAGACCATTGAGATCACAGCTGCCCCAAAGTGTAAAGAAATGCAGAATTCTCTCAATAATGATAAAAACCTTGTTTCTATTGAGACTGTGGTGCCACCTAAGCTCTTAAGTGATAATTTATGTAGACAAACTGAAAATCTCAAAACATCAAAAAGTATCT TTTTGAAAGTTAAAGTACATGAAAATGTAGAAAAAGAAACAGCAAAAAGTCCTGCAACTTGTTACACAAATCAGTCCCCTTATTCAGTCATTGAAAATTCAGCCTTAGCTTTTTACACAAGTTGTAGTAGAAAAACTTCTGTGAGTCAGACTTCATTACTTGAAGCAAAAAAATGGCTTAGAGAAGGAATATTTGATG GTCAACCAGAAAGAATAAATACTGCAGATTATGTAGGAAATTATTTGTATGAAAATAATTCAAACAGTACTATAGCTGAAAATGACAAAAATCATCTCTCCGAAAAACAAGATACTTATTTAAGTAACAGTAGCATGTCTAACAGCTATTCCTACCATTCTGATGAGGTATATAATGATTCAGGATATCTCTCAAAAAA TAAACTTGATTCTGGTATTGAGCCAGTATTGAAGAATGTTGAAGATCAAAAAAACACTAGTTTTTCCAAAGTAATATCCAATGTAAAAGATGCAAATGCATACCCACAAACTGTAAATGAAGATATTTGCGTTGAGGAACTTGTGACTAGCTCTTCACCCTGCAAAAATAAAAATGCAGCCATTAAATTGTCCATATC TAATAGTAATAATTTTGAGGTAGGGCCACCTGCATTTAGGATAGCCAGTGGTAAAATCGTTTGTGTTTCACATGAAACAATTAAAAAAGTGAAAGACATATTTACAGACAGTTTCAGTAAAGTAATTAAGGAAAACAACGAGAATAAATCAAAAATTTGCCAAACGAAAATTATGGCAGGTTGTTACGAGGCATTGG ATGATTCAGAGGATATTCTTCATAACTCTCTAGATAATGATGAATGTAGCACGCATTCACATAAGGTTTTTGCTGACATTCAGAGTGAAGAAATTTTACAACATAACCAAAATATGTCTGGATTGGAGAAAGTTTCTAAAATATCACCTTGTGATGTTAGTTTGGAAACTTCAGATATATGTAAATGTAGTATAGGGA AGCTTCATAAGTCAGTCTCATCTGCAAATACTTGTGGGATTTTTAGCACAGCAAGTGGAAAATCTGTCCAGGTATCAGATGCTTCATTACAAAACGCAAGACAAGTGTTTTCTGAAATAGAAGATAGTACCAAGCAAGTCTTTTCCAAAGTATTGTTTAAAAGTAACGAACATTCAGACCAGCTCACAAGAGAAGAA AATACTGCTATACGTACTCCAGAACATTTAATATCCCAAAAAGGCTTTTCATATAATGTGGTAAATTCATCTGCTTTCTCTGGATTTAGTACAGCAAGTGGAAAGCAAGTTTCCATTTTAGAAAGTTCCTTACACAAAGTTAAGGGAGTGTTAGAGGAATTTGATTTAATCAGAACTGAGCATAGTCTTCACTATTCA CCTACGTCTAGACAAAATGTATCAAAAATACTTCCTCGTGTTGATAAGAGAAACCCAGAGCACTGTGTAAACTCAGAAATGGAAAAAACCTGCAGTAAAGAATTTAAATTATCAAATAACTTAAATGTTGAAGGTGGTTCTTCAGAAAATAATCACTCTATTAAAGTTTCTCCATATCTCTCTCAATTTCAACAAGACA AACAACAGTTGGTATTAGGAACCAAAGTCTCACTTGTTGAGAACATTCATGTTTTGGGAAAAGAACAGGCTTCACCTAAAAACGTAAAAATGGAAATTGGTAAAACTGAAACTTTTTCTGATGTTCCTGTGAAAACAAATATAGAAGTTTGTTCTACTTACTCCAAAGATTCAGAAAACTACTTTGAAACAGAAGCAG TAGAAATTGCTAAAGCTTTTATGGAAGATGATGAACTGACAGATTCTAAACTGCCAAGTCATGCCACACATTCTCTTTTTACATGTCCCGAAAATGAGGAAATGGTTTTGTCAAATTCAAGAATTGGAAAAAGAAGAGGAGAGCCCCTTATCTTAGTGGGAGAACCCTCAATCAAAAGAAACTTATTAAATGAATTT GACAGGATAATAGAAAATCAAGAAAAATCCTTAAAGGCTTCAAAAAGCACTCCAGATGGCACAATAAAAGATCGAAGATTGTTTATGCATCATGTTTCTTTAGAGCCGATTACCTGTGTACCCTTTCGCACAACTAAGGAACGTCAAGAGATACAGAATCCAAATTTTACCGCACCTGGTCAAGAATTTCTGTCTAA ATCTCATTTGTATGAACATCTGACTTTGGAAAAATCTTCAAGCAATTTAGCAGTTTCAGGACATCCATTTTATCAAGTTTCTGCTACAAGAAATGAAAAAATGAGACACTTGATTACTACAGGCAGACCAACCAAAGTCTTTGTTCCACCTTTTAAAACTAAATCACATTTTCACAGAGTTGAACAGTGTGTTAGGAAT ATTAACTTGGAGGAAAACAGACAAAAGCAAAACATTGATGGACATGGCTCTGATGATAGTAAAAATAAGATTAATGACAATGAGATTCATCAGTTTAACAAAAACAACTCCAATCAAGCAGCAGCTGTAACTTTCACAAAGTGTGAAGAAGAACCTTTAGATTTAATTACAAGTCTTCAGAATGCCAGAGATATACAG GATATGCGAATTAAGAAGAAACAAAGGCAACGCGTCTTTCCACAGCCAGGCAGTCTGTATCTTGCAAAAACATCCACTCTGCCTCGAATCTCTCTGAAAGCAGCAGTAGGAGGCCAAGTTCCCTCTGCGTGTTCTCATAAACAGCTGTATACGTATGGCGTTTCTAAACATTGCATAAAAATTAACAGCAAAAATG CAGAGTCTTTTCAGTTTCACACTGAAGATTATTTTGGTAAGGAAAGTTTATGGACTGGAAAAGGAATACAGTTGGCTGATGGTGGATGGCTCATACCCTCCAATGATGGAAAGGCTGGAAAAGAAGAATTTTATAGGGCTCTGTGTGACACTCCAGGTGTGGATCCAAAGCTTATTTCTAGAATTTGGGTTTATAA TCACTATAGATGGATCATATGGAAACTGGCAGCTATGGAATGTGCCTTTCCTAAGGAATTTGCTAATAGATGCCTAAGCCCAGAAAGGGTGCTTCTTCAACTAAAATACAGATATGATACGGAAATTGATAGAAGCAGAAGATCGGCTATAAAAAAGATAATGGAAAGGGATGACACAGCTGCAAAAACACTTGTT CTCTGTGTTTCTGACATAATTTCATTGAGCGCAAATATATCTGAAACTTCTAGCAATAAAACTAGTAGTGCAGATACCCAAAAAGTGGCCATTATTGAACTTACAGATGGGTGGTATGCTGTTAAGGCCCAGTTAGATCCTCCCCTCTTAGCTGTCTTAAAGAATGGCAGACTGACAGTTGGTCAGAAGATTATTCT TCATGGAGCAGAACTGGTGGGCTCTCCTGATGCCTGTACACCTCTTGAAGCCCCAGAATCTCTTATGTTAAAGATTTCTGCTAACAGTACTCGGCCTGCTCGCTGGTATACCAAACTTGGATTCTTTCCTGACCCTAGACCTTTTCCTCTGCCCTTATCATCGCTTTTCAGTGATGGAGGAAATGTTGGTTGTGT TGATGTAATTATTCAAAGAGCATACCCTATACAGTGGATGGAGAAGACATCATCTGGATTATACATATTTCGCAATGAAAGAGAGGAAGAAAAGGAAGCAGCAAAATATGTGGAGGCCCAACAAAAGAGACTAGAAGCCTTATTCACTAAAATTCAGGAGGAATTTGAAGAACATGAAGAAAACACAACAAAACCA TATTTACCATCACGTGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCAGCAGACCCAGCTTACCTTGAGGGTTATTTCAGTGAAGAGCAGTTAAGAGCCTTGAATAATCACAGGCAAATGTTGAATGATAAGAAACAAGCTCAGATCCAGTTGGAAATT AGGAAGGCCATGGAATCTGCTGAACAAAAGGAACAAGGTTTATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATTCAGTTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTC AAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCGGTTTCAGATGAAATTTTATTTCAGATTTACCAGCCACGGGAGCCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGAGGTGGACCTAATAGGATTTGTCGTTT CTGTTGTGAAAAAAACAGGACTTGCCCCTTTCGTCTATTTGTCAGACGAATGTTACAATTTACTGGCAATAAAGTTTTGGATAGACCTTAATGAGGACATTATTAAGCCTCATATGTTAATTGCTGCAAGCAACCTCCAGTGGCGACCAGAATCCAAATCAGGCCTTCTTACTTTATTTGCTGGAGATTTTTCTGTG TTTTCTGCTAGTCCAAAAGAGGGCCACTTTCAAGAGACATTCAACAAAATGAAAAATACTGTTGAGAATATTGACATACTTTGCAATGAAGCAGAAAACAAGCTTATGCATATACTGCATGCAAATGATCCCAAGTGGTCCACCCCAACTAAAGACTGTACTTCAGGGCCGTACACTGCTCAAATCATTCCTGGTAC AGGAAACAAGCTTCTGATGTCTTCTCCTAATTGTGAGATATATTATCAAAGTCCTTTATCACTTTGTATGGCCAAAAGGAAGTCTGTTTCCACACCTGTCTCAGCCCAGATGACTTCAAAGTCTTGTAAAGGGGAGAAAGAGATTGATGACCAAAAGAACTGCAAAAAGAGAAGAGCCTTGGATTTCTTGAGTAGA CTGCCTTTACCTCCACCTGTTAGTCCCATTTGTACATTTGTTTCTCCGGCTGCACAGAAGGCATTTCAGCCACCAAGGAGTTGTGGCACCAAATACGAAACACCCATAAAGAAAAAAGAACTGAATTCTCCTCAGATGACTCCATTTAAAAAATTCAATGAAATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGA AGAACTTGCATTGATAAATACCCAAGCTCTTTTGTCTGGTTCAACAGGAGAAAAACAATTTATATCTGTCAGTGAATCCACTAGGACTGCTCCCACCAGTTCAGAAGATTATCTCAGACTGAAACGACGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTTCCCAGGCCAGTACGGAAGAATGTGAGAAAAAT AAGCAGGACACAATTACAACTAAAAAATATATCTAAGCATTTGCAAAGGCGACAATAAATTATTGACGCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACACATTAGTACTTATGTTGCACAATGAGAAAAGAAATTAGTTTCAAATTTACCTCAGCGTTTGTGTATCGGGCAAAAATCGTTTTGC CCGATTCCGTATTGGTATACTTTTGCTTCAGTTGCATATCTTAAAACTAAATGTAATTTATTAACTAATCAAGAAAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAACACTTTGAGAAGCTGAGGTGGGAGGAGTGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACATAGGGAGACCC CCATCTTTACGAAGAAAAAAAAAAAGGGGAAAAGAAAATCTTTTAAATCTTTGGATTTGATCACTACAAGTATTATTTTACAATCAACAAAATGGTCATCCAAACTCAAACTTGAGAAAATATCTTGCTTTCAAATTGACACTA GGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCAT
- 15. ―Founder Effect‖ • Themajority of people tested have a unique mutation – one that is specific to them and their family. – Hundreds of unique mutations have been found. – Some are recurring, however. • Ashkenazi Jewish population has 3 specific genes that recur: Two BRCA1 and One BRCA2 – 185delAG; 5382insC; 6174delT – 1996 study by Muto,et.al: • 19% of Jewish women with ovarian cancer in Mass and Israel had 185delAG • 12% of breast cancers in Ashkenazi Jews are attributable to BRCA 1 or BRCA 2 (Journal of National Cancer Institute, 1999) – Genes come from groups of people who do not go out of their small groups to find a mate (interbreeding).
- 16. How do youget the bad gene?
- 17. BRCA Mutation IncreasesBreast and Ovarian Cancer Risks AJHG 1995;56:265-271 Science 2003: 643-646 JCO 2005 23 (8): 1656-63 NCI 2005 20 40 60 80 100 Breast cancer by age 50 Breast cancer by age 70 Ovarian cancer by age 70 2% Up to 50% 8% Up to 87% RiskofCancer(%) <1% Up to 44% General Population BRCA Mutation Lancet 1994;343:692-695 NEJM 1997;336:1401-1408 AJHG 2003;72:1117-1130
- 18. BRCA Mutation IncreasesRisk of Second Breast Cancer Lancet 1998;351:316-21 JCO 2004;22:2328-35 Lancet 1994;3343:692-5 Gynecol Oncol. 2005 Jan;96(1):222-6 0 20 40 60 Breast Cancer after 5 years Breast Cancer by age 70 Up to 3.5% Up to 27% Up to 11% Up to 64% RiskofCancer(%) General Population BRCA Mutation Ca Epi Biomarkers Prev. 1999;8(10):855-61 JNCI 1999;15:1310-6 JCO 1998;16:2417-25
- 19. Risks in MenWith a BRCA Mutation JCO 2004;22: 735-42 Breast Cancer by age 80 Prostate Cancer by age 80 General Population BRCA Mutation* 5 10 15 20 25 <1% 7% 15% 20% RiskofCancer(%) *Risks refer to BRCA2 mutation carriers. Risks for male BRCA1 mutation carriers are less characterized
- 20. ―Red Flags‖ forHereditary Breast and Ovarian Cancer Syndrome • For Women or Men with a newly diagnosed breast cancer: – Diagnosed at < 45 with or without FH – Diagnosed at 45-50 with at a least one close blood relative with breast cancer and/or at least one close blood relative with ovarian cancer. Some would test all women in their 40s – Bilateral breast cancer – Diagnosed >50 with two or more close blood relatives with breast or ovarian cancer at any age – Close male relative with breast cancer – Personal history of ovarian cancer – Specific ethnicity associated with founder mutations (Ashkenazi Jewish, Icelandic, Swedish, Hungarian) especially along with family history
- 21. ―Red Flags‖ forWomen & Men who do not have Cancer • Women or Men who do not currently have cancer are at risk: – Family member with known BRCA 1 or BRCA 2 mutation – Previous history of breast cancer from the previously stated risk factors. (The test has only been available for ten years) – Personal history of ovarian cancer – One or more close male relatives with breast cancer – Two or more female relatives with breast cancer especially at age <50 on either maternal or paternal side – One or more close female relatives with ovarian cancer – Specific ethnicity as stated previously along with family history • REMEMBER: The family member who had the cancer diagnosis should always be tested FIRST if possible.
- 22. Family History Considerations •One-half of BRCA carriers inherit the mutation from their father • Ovarian cancer is a very important indicator • Early onset breast cancer is more important than the number of affected family members Science 2003:302(5645):643-6
- 23. New Considerations • TripleNegative Breast Cancer: – Research has shown that women who have breast cancer not sensitive to hormones or a drug called Herceptin are more inclined to have the BRCA gene even without a family history. – Testing is indicated if you have triple negative breast cancer under age 60 • Pancreatic Cancer: – If two or more people in the family have had pancreatic cancer that may be a criteria for testing – The gene will be found in 17-19% of those families
- 24. Prevalence of BRCA Mutations– Non Jewish www.brcacalculator.com Ovarian cancer in one relative, no breast cancer <50 21.1%23.1%8.8% Ovarian cancer, no breast cancer 16.9%15.8%6.8% Breast cancer <50 5.6%4.5%2.8% No breast or ovarian cancer Breast cancer <50, no ovarian cancer No breast cancer <50 or ovarian cancer Patient‟s History Family History
- 25. Prevalence of Mutationsin Ashkenazi Jewish Individuals www.brcacalculator.com 42.0%37.0%22.2% Ovarian cancer, no breast cancer 38.8%24.2%12.0% Breast cancer <50 15.6%13.7%6.9% No breast or ovarian cancer Breast cancer <50, no ovarian cancer No breast cancer <50 or ovarian cancer Patient‟s History Family History Ovarian cancer in one relative, no breast cancer <50
- 26. Genetic Testing • Benefits –Allows for individualized medical management – Accurate risk assessment – Alleviates uncertainty and anxiety • Limitations – Genetic testing for BRCA1 and BRCA2 does not identify all causes of hereditary breast or ovarian cancer © 2007 Myriad Genetic Laboratories, Inc.
- 27. Interpreting Test Results •Positive for a deleterious mutation • No mutation detected (negative test) – Mutation has been previously identified in the family – No known mutation in the family or the family hasn‘t been tested • Genetic variant of uncertain significance © 2007 Myriad Genetic Laboratories, Inc.
- 28. Positive for a DeleteriousMutation • BRCA-associated cancer risks • 50% chance for first degree relatives to have the same mutation – Children – Siblings – Parents • Test relatives for identified familial mutation © 2007 Myriad Genetic Laboratories, Inc.
- 29. Negative Test (no mutationdetected) • Does not mean that the patient cannot or will not develop breast cancer. • Only means that they are not at risk for developing hereditary breast cancer related to the BRCA mutations for which they were tested.
- 30. Negative Test (no mutationdetected) • Family History is positive for the gene • General population cancer risks—if no cancer history on the other side of the family • Avoid unnecessary screening/surgery • Can‘t pass on the gene • Family History is negative or unknown for the gene • Most difficult to interpret • Risk is based on total family history and can still be significant. © 2007 Myriad Genetic Laboratories, Inc.
- 31. Family History &BRCA Positive and Negative CancerRisks% 50 Age (Years) 30 50 70 Positive for deleterious BRCA mutation 100 Risk based on family history Negative for familial BRCA mutation Reprinted with permission from Ponder B: Genetic Testing for Cancer Risk. Science 1997; 278:1050-4. Copyright 1997 American Association for the Advancement of Science
- 32. Genetic Variant of uncertainsignificance • Clinical significance not yet known. It is neither positive or negative. • Manage based on personal and family cancer history. • May be further clarified, and then re- classified as positive or negative later on as more information is identified. © 2007 Myriad Genetic Laboratories, Inc.
- 33. Managing Hereditary Cancer Risk •Surveillance • Chemoprevention • Prophylactic surgery *Individual risk reduction may vary based on personal health history
- 34. Screening for Ovarian Cancer •Screening for Familial Ovarian Cancer – Poor Survival – Most cancers are diagnosed at Stage 3 and 4 – Transvaginal U.S. & CA 125 are ineffective in detecting tumors at a sufficiently early stage to influence survival. Only detect 57% stage 1 – Ovarian cancer is 1/8 as common as breast, but 3 times more lethal • Should be followed by an OB/GYN
- 35. Prophylactic Oophorectomy • Recommendbilateral salpingo- oophorectomy (BSO) at age 35 or after childbearing is complete – ~96% ovarian cancer risk reduction in BRCA carriers – Can reduce breast cancer risk by up to 68% for both BRCA1 and BRCA2 mutation carriers if the woman is pre- menopausal JAMA. 2006;296:185-92 Clin Oncol. 2005 Mar 10;23(8):1656-63
- 36. Prophylactic Ovarian removal- Bilateral Oophorectomy (BSO) • Does HRT increase cancer risk after oophorectomy (ovarian removal)? – No measurable effect with ―short term usage‖ of Estrogen alone – Estrogen until menopausal age – 50 • Unopposed estrogen does increase the risk of uterine cancer. Adding a hysterectomy to the BSO would eliminate that risk, however, a much bigger operation.
- 37. Surveillance for BreastCancer www.nccn.org Cancer Procedure Age to begin Frequency Breast self-exam 18 yrs Monthly Clinical breast exam 25 yrs Twice a year Mammography 25 yrs Yearly MRI 25 yrs Yearly
- 38. Screening with MRIin BRCA patients • JAMA, 2004: MRI most sensitive in detecting cancer and can decrease mortality in high risk women. • Adequacy of screening women with BRCA mutations with only Mammo was not shown to be good enough even if the women had fatty or low-dense breasts. • Waiting a year between screening is too long – BRCA patient‘s cancers grow faster than sporadic cancers.
- 39. Chemoprevention of Breast Cancer Tamoxifen •Selective Estrogen Receptor Modulator (SERM) – it blocks hormones from affecting breast cells • Affected BRCA carriers: 50% decrease for contralateral breast cancer • Unaffected BRCA2 carriers: 62% decrease in the risk of cancer • Unaffected high-risk: 45% decrease • Risks – increased risk of uterine cancer and clotting. Low risk in women who took the medication under age 50 Int J Cancer. 2006;118(9):2281-4 Lancet 2000;356:1876-81
- 40. Prophylactic Mastectomy • Greaterthan 90% breast cancer risk reduction in BRCA carriers. May be has high as 95-98% reduction • 100 women having prophylactic surgery 1995- 2006 • 18/100 had abnormal lesions • 3 invasive cancer • 8 in situ cancer • 7 ADH •Eur J Surg Oncol 2008, April 21
- 41. Reconstruction after Mastectomy hascome a long way Postoperative left mastectomy – left latissimus flap and implant Pre-operative view
- 42.
- 43. Insurance Coverage of GeneticTesting • All major carriers provide coverage for genetic testing • Established guidelines – Medicare – Most major carriers – Some insurance companies have genetic exclusions and will not pay no matter what the indication - rare • Cost: $3,350 • Cost if known family mutation: $450 • Supreme Court ruling may allow other companies to compete and the price may go down © 2007 Myriad Genetic
- 44. Genetic Discrimination • Federaland state laws prohibit the use of genetic information as a ‗pre-existing condition‘ – Federal HIPAA legislation – The majority of states have additional laws • Over 175,000 clinical tests performed to date • No documented cases of genetic discrimination AJHG 2000;66:293
- 45. Gina Legislation • U.S.President George W. Bush signed into law May 21, 2008 the first civil rights legislation of the new millennium, the Genetic Information Nondiscrimination Act (GINA). • GINA is the first and only federal legislation that will provide protections against discrimination based on an individual‘s genetic information in health insurance coverage and employment settings.
- 46. How do youtest? • Talk to your Primary Care Physician – Your Doctor may feel comfortable with the discussion and go ahead and test you; or they may send you to a breast specialist to discuss your risks and whether the test is right for you. – The test is either blood or saliva – The results are available in 2-3 weeks if insurance approves • Genetic Counselors – If your BRCA test is negative but you have a very strong FH – may need additional testing • Other rare mutations exist – p53. pTEN/MMAC1 • Dr Jennifer Klemp in Kansas City: 913-588-7750
- 47. Summary/Case Presentations 1. BRCA1 and 2 gene increase the risk of breast and ovarian cancer significantly 2. ―Red Flags‖ such as multiple women with breast or ovarian cancer in a family, especially at a young age clue us in to the possibility that the gene may be present 3. A blood and saliva test is available to identify the gene 4. Options are available to improve screening and decrease risk in women who have the gene © 2007 Myriad Genetic
- 48. Rachel, age 40– no cancer
- 49.
- 50. Rachel--Ovarian Recommendations • Her riskof ovarian cancer is 40-50% • She is 40 and has completed child- bearing – Recommend: bilateral oophorectomy (ovary removal) +/- hysterectomy – Ovarian removal decreases her risk of breast cancer by over 50% – Unopposed Estrogen for 10 years okay, but it increases her risk of uterine cancer if she doesn‘t have a hysterectomy
- 51. Rachel – Breast Recommendations •Risk of Breast Cancer: 50-87% • Options – Increase screening with Mammogram and MRI yearly separated by 6 months – Above + Tamoxifen for 5 years to decrease her risk by 50% – Bilateral prophylactic mastectomies with or without reconstruction
- 52. Rachel – Family Recommendations •Consider testing her Brother – If he tests Negative then his daughter couldn‘t inherit the gene from him • Rachel‘s Children – each has a 50:50 chance of inheriting the gene.
- 53.
- 54. Heather • Heather isat risk because her p Aunt had breast cancer at a young age • The best person to test would be – Heather‘s Aunt – the person affected by cancer • If her aunt is positive then I would test – Heather‘s Father • If he is positive then I would test – Heather
- 55. Heather • Heather‘s auntwas positive • Heather‘s Dad was negative • What is Heather‘s risk? – 10-13%, same as the general population • Does she or her brother or sister need to be tested? – No, their Dad was negative • Does her uncle and other two aunts need to be tested? – Yes, they all have a 50:50 chance of having the gene.
- 56. Conclusion • The BRCAgene is rare, but can significantly increase the risk of breast and ovarian cancer in patient‘s who have this mutation. • In patients who meet criteria, the test can easily be done. • If positive, there are many options available to follow and potentially prevent cancer.
- 57.
Editor's Notes
- #2 Good afternoon, my name is Patty Tenofsky and I am a breast surgeon at the Via Christi Clinic. I will be discussing Breast Cancer Genetic Testing- It is right for you?
- #3 Angelina Jolie said yes it was right for her, making this a very timely and popular recent topic.
- #4 This is Angelina Jolie’s mother – Marcheline Bertrand pictured in 2001 at age 50, about the time she was diagnosed with ovarian cancer.
- #5 This is a quote from her in a letter to the editor in the New York Times, 5/14/13. Her family history is quite extensive. Her mother had previously battled breast cancer, but then developed ovarian cancer at age 49 and died of the disease at age 56Her GM died of ovarian cancer as well at age 45Her m aunt (Her mother’s sister) died of breast cancer at age 61 just this year.Angelina Jolie is 37 years old and does not have cancer, but she chose to have preventative double mastectomies when she found out that she had the BRCA 1 gene. She has said in interview that she plans to have her ovaries removed when she is certain she does not want to have any more children.
- #6 Another famous actress Christian Applegate was being followed very carefully for breast cancer because of family history. She was diagnosed with an early stage of breast cancer at age 36. She was also found to have the BRCA 1 gene like Angelina Jolie. She chose to undergo bilateral mastectomies as well.
- #7 In order to know about the breast cancer gene, we first have to know a little about breast and ovarian cancer statistics. In the U.S., there is 200,000 cases of breast cancer/year. That is a 10-13% lifetime risk of developing breast cancer if you are a woman. The two most important risk factors for breast cancer is being a woman and getting older.Other risk factors include FH, Early age at first menstrual cycle, late or no pregnancy, hormone replacement medication, alcohol use, obesity, and lack of exerciseThere are approximately 25,000 cases of ovarian cancer per year which gives a lifetime risk of <2%
- #8 The vast majority of breast cancers will occur in women who have NO family history of breast cancer and are not linked to heredity or genetics. These nonhereditary cancers are called Sporadic Breast Cancers and are the most common type of breast cancer (see pie chart). The risk of breast cancer increases as a woman ages. It is less likely to occur before age 50. If you live to 90 then your risk of developing breast cancer is 1 in 8 or about 13% even with no family history. Therefore, ALL women over age 40 should be screened for breast cancer with mammograms, even if they have no family history.25% of woman will develop breast cancer with a family history , but there is no known genetic abnormality. Only 10% will develop breast cancer with a mutation of the BRCA gene. It is rare.
- #9 The official name of the BRCA mutation is the Hereditary Breast and Ovarian Cancer Syndrome. The syndrome is characterized by a significantly increased risk of breast and ovarian cancer, but it is RARE: only 1 in 800 people will have it. That means we would have to have 8 roomfuls of people like you to find one mutation on average. BUT, it’s more common if you have a Jewish background – which will discuss in a bit. You will learn that most cases are caused by a mutation in the BRCA 1 or 2 gene. We will discuss it’s characteristics, testing and treatment. Hopefully at the conclusion of our discussion you will understand more about the decision Angelina Jolie made and if genetic testing is something you need to be concerned about.
- #11 One of the easier mutations to understand is sickle cell anemiaIn Sickle Cell Anemia there is only 1 letter that is out of place and it completely alters the person’s Red Blood Cell.If you look at the top normal chain – the letters spellGTG- ValineCAC-HistidineCTG-LeucineACT-ThreonineCCT-ProlineGAG-Glutamic AcidGAG-Glutamic AcidNow look at the Lower DNA chain: It is all the same except a T is substituted for an A and GTG spells valine not Glutamic acid. That alters the RBC shape so that it is Sickled instead of donut shaped. It cannot carry oxygen as well and therefore the patient develops sickle cell anemia.
- #12 The purpose of the previous gene was to make the Red Blood Cells that carry our oxygen. The purpose of the BRCA gene on the other hand is to make proteins that fight changes in your DNA that can occur when normal cells divide. These proteins seek out and eliminate errors that occur. In other words it is a cancer fighter gene. If a change occurs in your normal DNA, then the cell and DNA start to divide rapidly and can become cancer cells. Think of them as speeders on the highway. The purpose of BRCA is to act as a highway patrol man to stop the speeders and not allow them to proceed on to become cancer. There are many of these repair highway patrolmen throughout your DNA – this is just one of them. If your BRCA gene is mutated – it is like the highway patrolmen has a flat tire and is stuck on the side of the road. He can’t catch the speeders and they can go on to become cancer. If the BRCA gene isn’t right this alteration interferes with normal gene activity and makes the person with the altered gene more susceptible to developing breast or ovarian cancer.
- #17 This type of mutation is considered autosomal dominant which means that if one of your parents have the gene then you have a 50:50 chance of having the mutation.We are all born with 2 copies of our genes. One from our Mom and one from our Dad. In this slides the little b means normal BRCA gene and the capital B means a mutated BRCA gene. The father has 2 normal BRCA genes and the Mother has one normal and one mutated BRCA gene. The mutated gene is dominant, so the mother has the BRCA syndrome.Look at the 4 children now:1st Daughter – She got the mutated gene from her mother and the normal gene from her father – she is therefore BRCA +2nd Daughter – Normal genes from both parents and therefore she is BRCA-3rd Son – He got the mutated gene from his mother and is therefore BRCA +4th Son – He got two normal genes and is therefore BRCA –Statistics say that if there are 4 children two would be positive and two would be negative. But each child has a 50:50 chance. You could flip a coin 4 times and turn up heads each time. So it would be possible that all 4 could be positive or negative. The only way to know would be to test.
- #22 These are the “Red Flags” for women and men who do not have cancer, but are at risk – like Angelina Jolie.
- #24 Research on women who have a certain type of cancer called triple negative has shown a very high risk of carrying the breast cancer gene – even without a family history. Triple negative means that the cancer was NOT sensitive to estrogen, progesterone, or Herceptin. If a women has a triple negative breast cancer under age 60 then she is a candidate for testing.Unfortunately, Pancreatic cancer has also been linked to this gene. If two or more people in the family have had pancreatic cancer, this could be a criteria for testing and the gene could be found in 17-19% of those families.The risk of pancreatic cancer is only 0.05 % by age 50 and is .5% by age 70.With the BRCA gene it increases that risk to .5% and 5%Overall it increases the risk of pancreatic cancer 3.5 to 10x over the general population.If you have pancreatic cancer and no family history your risk of having the gene is 5-10%SO the BRCA gene has been linked to breast, ovarian, pancreatic and prostate cancer in men
- #34 Now that we have a positive BRCA test there are three main management strategies. SurveillanceChemopreventionProphylactic surgery
- #37 If your ovaries are removed, then you will go into menopause. Is it safe to take HRT when you still have breasts with the BRCA gene. Surprisingly it is safe for a short period of time 10-15 years or until natural menopause age. But, only with unopposed estrogen NOT with combination with progesterone. Unfortunately unopposed estrogen increases the risk of uterine cancer. Adding a hysterectomy to BSO would eliminate that risk but is a bigger operation.
- #42 The last picture showed mastectomies without reconstruction. Reconstruction has come a long way. In this picture the woman had a mastectomy on one side and has her native breast on the other. Her nipple was removed. Notice that the match is pretty good and the newly created nipple looks fairly normal.
- #43 Even newer is nipple sparing mastectomies which in smaller breasted women can give an exceptionally good cosmetic result with preventative surgery. The incision is hidden below the breast so it looks like the breasts are scarless.
- #46 Because of concern that genetic mutations could be potentially used against persons who have them, President George Bush signed into law the GINA legislation (Genetic Information Nondiscrimination Act). It is considered a civil rights law and protects persons against losing their health care or their job due to finding a genetic mutation.
- #47 If you have red flags – and are concerned about the BRCA mutation – what do you do?Talk to your PCPThey may test or send you to a breast specialist to discuss it further.If your family history is extensive and the test is negative it may be beneficial to see a genetic counselor to see if there are other rare mutations such as p53 or pten. The closest breast genetic counselor is Dr. Klemp in KC
- #49 Let’s do a case together: This is Rachel and she is 40. This is her family tree. She has 2 sisters who are affected by cancer – breast and ovarian, a niece with breast her own mother with ovarian. Her mother has passed. Rachel is at significant risk for the BRCA gene mutation. Rachel’s sisters were tested and were positive so they want to test Rachel at the same site of mutation has her sisters.
- #50 Here is her test result. She unfortunately is also positive. Remember we get a normal gene from our one parent and the bad gene from the other parent. This is her DNA test showing the deletion of AG at the 185 position. This is one of the most common BRCA one mutations known.
- #51 She is positive so let’s discuss what to do about her ovarian cancer risk which is 40-50%.The recommendation would be ovarian removal with or without a hysterectomyOvarian removal decreases risk of breast cancer by over 50%Estrogen is okay but will increase her risk of uterine cancer if she doesn’t have a hysterectomy
- #52 Now we discuss her breast options. Remember her risk of cancer is 50-87% depending on what she does with her ovaries and if she goes on tamoxifen.Her options are:ScreeningScreening + tamoxifenPreventative mastectomies.
- #53 Her sister both tested positive. Her Brother can consider testing. If he is negative then he can not pass it to his daughter which can lower her anxiety of developing breast and ovarian cancerAs for Rachel’s children – they all have a 50:50 chance of inheriting the gene.
- #54 Heather is 38 and has a paternal aunt who had breast cancer at age 41. Is Heather at risk and who would you test if you could test any of these patients?
- #55 Why test her aunt – Because if she is positive then her 3 siblings could be tested to see if they inherited the gene. It would also help heather know that the gene does run in her family Why test her Dad first? Because there are three children and if he is positive they are all at risk but if he is negative then none are at risk.
- #57 The BRCA gene is rare, but can significantly increase the risk of both breast and ovarian cancer in patient’s who have this mutation.In patient’s who meet criteria, the test can easily be doneIf positive, there are many options available to follow and potentially prevent cancer
- #58 This a poster from an old movie staring Madeline Kahn and Gilda Radner. (FIRST FAMILY, 1980) Both women were Jewish and both died of ovarian cancer at young ages. It is very likely that they both had BRCA mutations, but they died before science discovered the genes. The hope is that now that we know about these mutations, we can test and hopefully we can prevent deaths such as with these women.