The SRLY rules for consolidated tax returns are designed to keep corpo.docx
•Download as DOCX, PDF•
0 likes•5 views
The SRLY rules for consolidated tax returns are designed to keep corporations from trafficking their net operating losses. Explain. Solution The SRLY ( Seperate Return Limitation Year) is applicable in case of consolidation of financial statement of parent company with subsidary companies. According to this rules if a company take over by another company where the subsidary company having losses in that case its losses cannot be merge with the profit of parent company at the time of consolidation. the subsidary company have to file a seperate return till the losses turn into profit. This rule is mainly made to keep the track of losses of coperate sector & to show the actual picture of the corporate groups. By following this rules Coperates are not allowed to hide the losses by merging with another company. Secondly they can\'t take the benefit of tax by adjusting losses with profit. Thirdly the true picture of every entity is showed so that stakeholders can\'t be cheated. .
Report
Share
Report
Share
Recommended
Definition of an LLC: Limited Liability Company
An LLC can be made up of a single partner (one-person company with limited responsibilities), or of several (up to a limit of 100). They can be natural or legal persons (a company can therefore be associated with a Limited Company Registration). The particularity of the LLC for the partners is the limit of losses to the amounts of their contribution. Even if in some cases, which we will see below, this limit can be lifted. In return for their contributions, the partners have the right to vote during meetings and they can participate in decisions in the life of the company.
https://bit.ly/2TF4OhS
M4A1 Keno Enriquez posted Mar 5, 2018 1146 AMC CorporationsC .docx
M4A1 Keno Enriquez posted Mar 5, 2018 11:46 AM
C Corporations
C corporation is a business term that is used to distinguish this type of entity from others, as its profits are taxed separately from its owners under subchapter C of the Internal Revenue Code. In an S corporation, the profits are passed on to the shareholders, and are taxed based on personal returns. A regular corporation (also known as a C corporation) is taxed as a separate entity. The corporation must file a Form 1120 each year to report its income and to claim its deductions and credits.
A C corporation can deduct the cost of benefit as a business expense. For example, they can write off the entire costs of health plans established for employees as business expenses. These benefits are tax-free even for those receiving them.
S Corporations
S corporations are corporations that elect to pass corporate income, losses, deductions, and credits through to their shareholders for federal tax purposes. Shareholders of S corporations report the flow-through of income and losses on their personal tax returns and are assessed tax at their individual income tax rates. This allows S corporations to avoid double taxation on the corporate income. S corporations are responsible for tax on certain built-in gains and passive income at the entity level.
The big benefit of S-corp taxation is that S-corporation shareholders do not have to pay self-employment tax on their share of the business’s profits. For example, Larissa is the sole owner of her S-corporation, an advertising agency. Her revenues from the business are $50,000 per year, and her annual expenses (not counting salary) total $10,000. Therefore, her S-corp’s profit for the year (before subtracting her own salary) is $40,000.
Limited Liability Companies (LLCs)
A limited liability company (LLC) is a corporate structure whereby the members of the company cannot be held personally liable for the company's debts or liabilities. Limited liability companies are essentially hybrid entities that combine the characteristics of a corporation and a partnership or sole proprietorship
Although LLCs have some attractive features, they also have a number of disadvantages, especially in relation to the structure of a corporation. A LLC has to be dissolved upon the death or bankruptcy of a member, unlike a corporation, which can exist in perpetuity. Also, a LLC may not be a suitable option when the objective of the founder is to eventually become a publicly listed company.
LLC members are considered self-employed business owners rather than employees of the LLC so they are not subject to tax withholding. Instead, each LLC member is responsible for setting aside enough money to pay taxes on that member's share of the profits. The members must estimate the amount of tax they'll owe for the year and make quarterly payments to the IRS.
References:
IRS (2017). S Corporations. Retrieved from https://www.irs.gov/businesses/small-businesses-self-employed/s-cor ...
ESR for holding company business in UAE
Economic Substance Regulations in the UAE is a principle and law that requires a business license holder to adhere to Economic Substance Return on the gross income generated from their relevant activity. The ESR law for holding companies, along with other licensed companies, was adopted in 2019.
Entrepreneurship.docx
As a student of entrepreneurship, critically illustrate and explain the different types of business.
S corporation tax strategy
S corporations are legally structured in a way that allow them to go untaxed. This is because income that is recognized by owners is taxed at the personal level and not via the business. Moreover, an S corporation is a pass-through or flow-through entity, which means income passes through to the shareholders. This newsletter details tax management information and methods used by and relevant to S corporations.
Recommended
Definition of an LLC: Limited Liability Company
An LLC can be made up of a single partner (one-person company with limited responsibilities), or of several (up to a limit of 100). They can be natural or legal persons (a company can therefore be associated with a Limited Company Registration). The particularity of the LLC for the partners is the limit of losses to the amounts of their contribution. Even if in some cases, which we will see below, this limit can be lifted. In return for their contributions, the partners have the right to vote during meetings and they can participate in decisions in the life of the company.
https://bit.ly/2TF4OhS
M4A1 Keno Enriquez posted Mar 5, 2018 1146 AMC CorporationsC .docx
M4A1 Keno Enriquez posted Mar 5, 2018 11:46 AM
C Corporations
C corporation is a business term that is used to distinguish this type of entity from others, as its profits are taxed separately from its owners under subchapter C of the Internal Revenue Code. In an S corporation, the profits are passed on to the shareholders, and are taxed based on personal returns. A regular corporation (also known as a C corporation) is taxed as a separate entity. The corporation must file a Form 1120 each year to report its income and to claim its deductions and credits.
A C corporation can deduct the cost of benefit as a business expense. For example, they can write off the entire costs of health plans established for employees as business expenses. These benefits are tax-free even for those receiving them.
S Corporations
S corporations are corporations that elect to pass corporate income, losses, deductions, and credits through to their shareholders for federal tax purposes. Shareholders of S corporations report the flow-through of income and losses on their personal tax returns and are assessed tax at their individual income tax rates. This allows S corporations to avoid double taxation on the corporate income. S corporations are responsible for tax on certain built-in gains and passive income at the entity level.
The big benefit of S-corp taxation is that S-corporation shareholders do not have to pay self-employment tax on their share of the business’s profits. For example, Larissa is the sole owner of her S-corporation, an advertising agency. Her revenues from the business are $50,000 per year, and her annual expenses (not counting salary) total $10,000. Therefore, her S-corp’s profit for the year (before subtracting her own salary) is $40,000.
Limited Liability Companies (LLCs)
A limited liability company (LLC) is a corporate structure whereby the members of the company cannot be held personally liable for the company's debts or liabilities. Limited liability companies are essentially hybrid entities that combine the characteristics of a corporation and a partnership or sole proprietorship
Although LLCs have some attractive features, they also have a number of disadvantages, especially in relation to the structure of a corporation. A LLC has to be dissolved upon the death or bankruptcy of a member, unlike a corporation, which can exist in perpetuity. Also, a LLC may not be a suitable option when the objective of the founder is to eventually become a publicly listed company.
LLC members are considered self-employed business owners rather than employees of the LLC so they are not subject to tax withholding. Instead, each LLC member is responsible for setting aside enough money to pay taxes on that member's share of the profits. The members must estimate the amount of tax they'll owe for the year and make quarterly payments to the IRS.
References:
IRS (2017). S Corporations. Retrieved from https://www.irs.gov/businesses/small-businesses-self-employed/s-cor ...
ESR for holding company business in UAE
Economic Substance Regulations in the UAE is a principle and law that requires a business license holder to adhere to Economic Substance Return on the gross income generated from their relevant activity. The ESR law for holding companies, along with other licensed companies, was adopted in 2019.
Entrepreneurship.docx
As a student of entrepreneurship, critically illustrate and explain the different types of business.
S corporation tax strategy
S corporations are legally structured in a way that allow them to go untaxed. This is because income that is recognized by owners is taxed at the personal level and not via the business. Moreover, an S corporation is a pass-through or flow-through entity, which means income passes through to the shareholders. This newsletter details tax management information and methods used by and relevant to S corporations.
Entity Selection for Startups
Entrepreneurs will face a huge number of decisions as they move from concept to commercialization. One of the
first major decisions is what type of legal entity to form in order to move their great ideas forward. Why does it
matter? Because different entities have very different rules regarding limited liability, management and control
flexibility, capital structure, tax efficiency and eligible investors.
Solution Manual for South-Western Federal Taxation 2024 Corporations, Partner...
Solution Manual for South-Western Federal Taxation 2024 Corporations, Partner...Test Bank And Solution Manual Marketplace
South-Western Federal Taxation 2024 Corporations, Partnerships, Estates and Trusts, 47th Edition Solution Manual ISBN-13 9780357900673, full product at https://coursecost.com/product/solution-manual-for-south-western-federal-taxation-2024-corporations-partnerships-estates-and-trusts-47th-edition/Budget 2022 - Budget wish list to augment M&A activity
While the financial sector is facing headwinds including increase in non-performing assets resulting in increased losses and shortage of liquidity, the real estate sector too has witnessed a tough time due to disruptions in labour supply, logistics and increasing finance cost on unsold inventory.
CSR Made Easy Issue II
"CSR Made Easy Issue II" includes some of the ambiguity and debatable issues in current CSR laws and our understanding of the same.
Private Limited Company vs Limited Liability Partnership (LLP) vs One Person ...
Private Limited Company vs Limited Liability Partnership (LLP) vs One Person ...vakilsearch_tutorial
It should take no longer than 5 minutes to choose between the available legal structures for your business. Your options are the Private Limited Company, Limited Liability Partnership (LLP), One-Person Company (OPC), General Partnership and Sole Proprietorship. But the general approach to this decision is so academic, entrepreneurs end up wasting their time. There’s no need to educate yourself on the minute differences between say, a Private Limited Company and an LLP. This is because, with only a few exceptions, every business will be suited to just one legal structure. So let's find out which one is right for you.Financial Accounting 2 asignment
Question 3
- 3. 1 Classes of Shares
- 3.2 Dividend Distribute
- 3.3 Investment of shares in Petaling Tin Berhad
- 3.4 Conclusion
FINANCIAL MARKET CONCLAVE – ROAD TO TURN AROUND - COMPANIES ACT, 2013 - Part -6
The Companies Act, 2013 has made several changes in the regulatory requirements of the companies. It has introduced several new concepts and has streamlined many of the requirements by introducing new definitions. The Act aims to raise the governance level of the Indian companies at par with the global companies.
Residential property tax planning (UK)
Residential property can be a lucrative business, but profits or gains will be subject to tax. In this post we discuss some of the property tax planning options, including using limited companies or LLPs, trading vs investment property, capital gains tax and entrepreneurs relief.
Do directors need to auto enrol?
Companies need to auto enrol most formally employed staff in the UK onto pension schemes. It is then up to the individual if they want to opt out.
However, directors are often exempt from auto-enrolment duties, even if they have an employment contract.
Wassim Zhani Chapter 1 Income Taxation of Corporations.pdf
Wassim Zhani Chapter 1 Income Taxation of Corporations.pdf
An S corporation is formed by filing an Articles of Incorporation wi.pdf
let be A=x1i+y1j
B=x2i+y2j
A+B=(x1+x2)i+(y1+y2)j
lA+Bl^2=(x1+x2)^2+(y1+y2)^2
now lAl^2=x1^2+y1^2
lBl^2=x2^2+y2^2
and AB=x1x2+y1y2
now
lAl^2+2AB+lBl^2=x1^2+x2^2+2x1x2+2y1y2+y1^2+y2^2=(x1+x2)^2+(y1+y2)^2=lA+Bl^2
there fore lA+Bl^2=lAl^2+2AB+lBl^2
or
lA+Bl^2=lAl^2+lBl^2+2lAllBl=lAl^2+2AB+lBl^2
Solution
let be A=x1i+y1j
B=x2i+y2j
A+B=(x1+x2)i+(y1+y2)j
lA+Bl^2=(x1+x2)^2+(y1+y2)^2
now lAl^2=x1^2+y1^2
lBl^2=x2^2+y2^2
and AB=x1x2+y1y2
now
lAl^2+2AB+lBl^2=x1^2+x2^2+2x1x2+2y1y2+y1^2+y2^2=(x1+x2)^2+(y1+y2)^2=lA+Bl^2
there fore lA+Bl^2=lAl^2+2AB+lBl^2
or
lA+Bl^2=lAl^2+lBl^2+2lAllBl=lAl^2+2AB+lBl^2.
Tax Essentials for North Carolina LLC Owners
Navigating the complexities of taxes is a crucial aspect of managing a Limited Liability Company (LLC). This presentation is specifically tailored for LLC owners in North Carolina, providing them with essential information and practical guidance to handle their tax obligations effectively.
The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx
The total electromagnetic power emitted by the sun is 3.8 x 1026 W. This energy is used to power a satellite orbiting Mercury through the use of solar panels. What force is exerted by solar radiation impinging normally on a 5.0 m2 totally absorbing solar panel attached to this satellite? The orbital radius of Mercury is 5.8 x 1010 m.
Solution
given
P = 3.8*10^26 W
r = 5.8*10^10 m
A = 5 m^2
Intensity of radiation at the surface of the Mercury, I = Power/Area
= P/(4*pi*r^2)
= 3.8*10^26/(4*pi*(5.8*10^10)^2)
= 8989 W/m^2
Radiation pressure on completely oborbing surface,
P = I/c
= 8989/(3*10^8)
= 2.996*10^-5 N
so, Force due to radiation, F = P*A
= 2.996*10^-5*5
= 1.50*10^-4 N <<<<<<<<-------Answer
.
The Tinsley Company exchanged land that it had been holding for future.docx
The Tinsley Company exchanged land that it had been holding for future plant expansion for a more suitable parcel located farther from residential areas. Tinsley carried the land at its original cost of $31,500. According to an independent appraisal, the land currently is worth $75,000. Tinsley gave $17,000 in cash to complete the transaction.
Prepare the journal entry to record the exchange assuming the exchange has commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.)
Prepare the journal entry to record the exchange assuming the exchange lacks commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.)
Solution
1) Land: fair value $75,000
cash:paid + $17,000
New parcel = $92,000
2) New parcel = $92,000
Gain on exchnage = $43,500
cash = $17,000
land = $31,500
3) New parcel = $48,500
cash = $17,000
land = $31,500
.
More Related Content
Similar to The SRLY rules for consolidated tax returns are designed to keep corpo.docx
Entity Selection for Startups
Entrepreneurs will face a huge number of decisions as they move from concept to commercialization. One of the
first major decisions is what type of legal entity to form in order to move their great ideas forward. Why does it
matter? Because different entities have very different rules regarding limited liability, management and control
flexibility, capital structure, tax efficiency and eligible investors.
Solution Manual for South-Western Federal Taxation 2024 Corporations, Partner...
Solution Manual for South-Western Federal Taxation 2024 Corporations, Partner...Test Bank And Solution Manual Marketplace
South-Western Federal Taxation 2024 Corporations, Partnerships, Estates and Trusts, 47th Edition Solution Manual ISBN-13 9780357900673, full product at https://coursecost.com/product/solution-manual-for-south-western-federal-taxation-2024-corporations-partnerships-estates-and-trusts-47th-edition/Budget 2022 - Budget wish list to augment M&A activity
While the financial sector is facing headwinds including increase in non-performing assets resulting in increased losses and shortage of liquidity, the real estate sector too has witnessed a tough time due to disruptions in labour supply, logistics and increasing finance cost on unsold inventory.
CSR Made Easy Issue II
"CSR Made Easy Issue II" includes some of the ambiguity and debatable issues in current CSR laws and our understanding of the same.
Private Limited Company vs Limited Liability Partnership (LLP) vs One Person ...
Private Limited Company vs Limited Liability Partnership (LLP) vs One Person ...vakilsearch_tutorial
It should take no longer than 5 minutes to choose between the available legal structures for your business. Your options are the Private Limited Company, Limited Liability Partnership (LLP), One-Person Company (OPC), General Partnership and Sole Proprietorship. But the general approach to this decision is so academic, entrepreneurs end up wasting their time. There’s no need to educate yourself on the minute differences between say, a Private Limited Company and an LLP. This is because, with only a few exceptions, every business will be suited to just one legal structure. So let's find out which one is right for you.Financial Accounting 2 asignment
Question 3
- 3. 1 Classes of Shares
- 3.2 Dividend Distribute
- 3.3 Investment of shares in Petaling Tin Berhad
- 3.4 Conclusion
FINANCIAL MARKET CONCLAVE – ROAD TO TURN AROUND - COMPANIES ACT, 2013 - Part -6
The Companies Act, 2013 has made several changes in the regulatory requirements of the companies. It has introduced several new concepts and has streamlined many of the requirements by introducing new definitions. The Act aims to raise the governance level of the Indian companies at par with the global companies.
Residential property tax planning (UK)
Residential property can be a lucrative business, but profits or gains will be subject to tax. In this post we discuss some of the property tax planning options, including using limited companies or LLPs, trading vs investment property, capital gains tax and entrepreneurs relief.
Do directors need to auto enrol?
Companies need to auto enrol most formally employed staff in the UK onto pension schemes. It is then up to the individual if they want to opt out.
However, directors are often exempt from auto-enrolment duties, even if they have an employment contract.
Wassim Zhani Chapter 1 Income Taxation of Corporations.pdf
Wassim Zhani Chapter 1 Income Taxation of Corporations.pdf
An S corporation is formed by filing an Articles of Incorporation wi.pdf
let be A=x1i+y1j
B=x2i+y2j
A+B=(x1+x2)i+(y1+y2)j
lA+Bl^2=(x1+x2)^2+(y1+y2)^2
now lAl^2=x1^2+y1^2
lBl^2=x2^2+y2^2
and AB=x1x2+y1y2
now
lAl^2+2AB+lBl^2=x1^2+x2^2+2x1x2+2y1y2+y1^2+y2^2=(x1+x2)^2+(y1+y2)^2=lA+Bl^2
there fore lA+Bl^2=lAl^2+2AB+lBl^2
or
lA+Bl^2=lAl^2+lBl^2+2lAllBl=lAl^2+2AB+lBl^2
Solution
let be A=x1i+y1j
B=x2i+y2j
A+B=(x1+x2)i+(y1+y2)j
lA+Bl^2=(x1+x2)^2+(y1+y2)^2
now lAl^2=x1^2+y1^2
lBl^2=x2^2+y2^2
and AB=x1x2+y1y2
now
lAl^2+2AB+lBl^2=x1^2+x2^2+2x1x2+2y1y2+y1^2+y2^2=(x1+x2)^2+(y1+y2)^2=lA+Bl^2
there fore lA+Bl^2=lAl^2+2AB+lBl^2
or
lA+Bl^2=lAl^2+lBl^2+2lAllBl=lAl^2+2AB+lBl^2.
Tax Essentials for North Carolina LLC Owners
Navigating the complexities of taxes is a crucial aspect of managing a Limited Liability Company (LLC). This presentation is specifically tailored for LLC owners in North Carolina, providing them with essential information and practical guidance to handle their tax obligations effectively.
Similar to The SRLY rules for consolidated tax returns are designed to keep corpo.docx (20)
Solution Manual for South-Western Federal Taxation 2024 Corporations, Partner...
Solution Manual for South-Western Federal Taxation 2024 Corporations, Partner...
Budget 2022 - Budget wish list to augment M&A activity
Budget 2022 - Budget wish list to augment M&A activity
Private Limited Company vs Limited Liability Partnership (LLP) vs One Person ...
Private Limited Company vs Limited Liability Partnership (LLP) vs One Person ...
FINANCIAL MARKET CONCLAVE – ROAD TO TURN AROUND - COMPANIES ACT, 2013 - Part -6
FINANCIAL MARKET CONCLAVE – ROAD TO TURN AROUND - COMPANIES ACT, 2013 - Part -6
Wassim Zhani Chapter 1 Income Taxation of Corporations.pdf
Wassim Zhani Chapter 1 Income Taxation of Corporations.pdf
An S corporation is formed by filing an Articles of Incorporation wi.pdf
An S corporation is formed by filing an Articles of Incorporation wi.pdf
More from helenc18
The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx
The total electromagnetic power emitted by the sun is 3.8 x 1026 W. This energy is used to power a satellite orbiting Mercury through the use of solar panels. What force is exerted by solar radiation impinging normally on a 5.0 m2 totally absorbing solar panel attached to this satellite? The orbital radius of Mercury is 5.8 x 1010 m.
Solution
given
P = 3.8*10^26 W
r = 5.8*10^10 m
A = 5 m^2
Intensity of radiation at the surface of the Mercury, I = Power/Area
= P/(4*pi*r^2)
= 3.8*10^26/(4*pi*(5.8*10^10)^2)
= 8989 W/m^2
Radiation pressure on completely oborbing surface,
P = I/c
= 8989/(3*10^8)
= 2.996*10^-5 N
so, Force due to radiation, F = P*A
= 2.996*10^-5*5
= 1.50*10^-4 N <<<<<<<<-------Answer
.
The Tinsley Company exchanged land that it had been holding for future.docx
The Tinsley Company exchanged land that it had been holding for future plant expansion for a more suitable parcel located farther from residential areas. Tinsley carried the land at its original cost of $31,500. According to an independent appraisal, the land currently is worth $75,000. Tinsley gave $17,000 in cash to complete the transaction.
Prepare the journal entry to record the exchange assuming the exchange has commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.)
Prepare the journal entry to record the exchange assuming the exchange lacks commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.)
Solution
1) Land: fair value $75,000
cash:paid + $17,000
New parcel = $92,000
2) New parcel = $92,000
Gain on exchnage = $43,500
cash = $17,000
land = $31,500
3) New parcel = $48,500
cash = $17,000
land = $31,500
.
The State of Rhode Island publishes its budget and the various support.docx
The State of Rhode Island publishes its budget and the various supporting information at www.budget.state.ri.us/index.htm which you should access and then answer the following:
A. What are the duties of the budget office? (Hint: Use the About Us link.)
B. What are the six governmental functions listed in the budget? For the most recent year, calculate the percentage of the total budget allocated to each function.
C. What are the major sources of Rhode Island\'s revenues? Calculate the percentage which each category represents of the total revenues.
D. What is the accounting basis used in the preparation of the budget? (Hint: Use the Primer link and scroll down until you see the Budget Basis section.)
E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.)
F. What did you learn from reviewing the most recent budget of the State of Rhode Island?
Solution
E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.)
.
The sound strikes the cantina walls and bounces off at the same angle.docx
The sound strikes the cantina walls and bounces off at the same angle as it struck in a process known as _____.
A. reflection
B. refraction
C. constructive interference
D. destructive interference
14. Sound Waves
Choose One • 5 points
Obi Wan hears the destruction of a planet and all of its people through \'the force\'. These sounds are only in his head and are not carried through space, since space has no _____ through which sound could transmit.
electromagnetic wave
electrons
magnetic field
medium
15. The Doppler Effect
Choose One • 5 points
However, had it been a real sound, the sound\'s pitch would have been increased by the Doppler Effect, since the Falcon was moving _____ the source of the sound.
perpendicular to
away from
towards
at the same speed as
bounced wave 2 Angle of Reflection Angle of Incidence Incident wave A single direction of the Sound Wave from Greedo\'s Blaster
Solution
1) Reflection .
Reflection is the change in direction of a wavefront at an interface between two different media so that the wave front returns into the medium from which it originated.
2) Medium
Sound waves require matter to transmit them, unlike light waves.
3) Towards
The Doppler Effect tells us that as an object moves toward the source of sound, the pitch the object feels will increase; when the object moves away, the pitch decreases. In order for the pitch to increase, the falcon must be moving towards the source of sound.
.
The six platforms below are initially at rest in deep space- The indic.docx
The six platforms below are initially at rest in deep space. The indicated forces act on the platforms at endpoints, quarter-points, or midpoints. All forces have the same magnitude. heir Rank these platforms on the basis of the torque that acts on them, measured about their CM. Let the counterclockwise direction be positive and rank positive torques as larger than negative torques. Largest 1. 2.3.4.5. 6. Smallest The ranking cannot be determined based on the information provided. Explain the reason for your ranking:
Solution
B > E > C = F > A > D
let F is the magnitude of force and L is the total length.
A) TA = -F*(L/4) - F*(L/4)
= -F*L/2
B) TB = F*(L/2) + F*(L/2)
= F*L
C) TC = F*(L/4) + F*(L/4)
= F*L/2
D) TD = F*(L/2) - F*(L/4) + F0
= F*L/4
E) TE = F*(L/2) + F*(L/2) - F*(L/4)
= (3/4)*F*L
F) TE = F*(L/2) + F*(L/2) - F*(L/4) - F*(L/4)
= F*L/2
.
The rise of various digital communication methods in the past decade h.docx
The rise of various digital communication methods in the past decade has greatly changed the field of public relations. What new and emerging technologies do you think will continue to change the PR field?
How do you anticipate the PR field changing in response to those technologies?
Explain your answer carefully, citing specific examples of technology or real-life examples from the news.
Solution
PR is basically a method to built and maintain relationsship with different stake holders of an organization. Stake holders are investors,employees,customers,suppliers, regulating agencies , government and society at large.This happens through constat interaction and communication with the concerned people . In the modern times , communication has become very easy with the availability of smart phones and internet.One can communicate/send mails to thousands of people at the click of a mouse.Unlike in traditional way of sending hard copy mailers which takes lot of time to be delivered, emails can reach the receipiant in fraction of a second. Further one doesn\'t have to physically go to a person to chat or talk. He can do that through video conferencing sitting at his home/office through skype or he can also do text based chate in sites like facebook,gmail,yahoo messenger etc
.
The reason that the increase in population growth in the 19th and 20th.docx
The reason that the increase in population growth in the 19th and 20th centuries did not lead to famine as Thomas Malthus predicted was because
wars kept the population in check
there was diminishing marginal product of labor
increases in technology and capital raised labor productivity
people learned to eat less
worldwide population didn\'t actually grow
Solution
3.
increases in technology and capital raised labor productivity
.
The sale of stock and the sale of bonds are reported as financing acti.docx
The sale of stock and the sale of bonds are reported as financing activities. Are payments of dividends to shareholders and payments of interest to bondholders also reported as financing activities? Explain.
Solution
The payment of cash dividends to shareholders is classified as a financing activity.
FINANCING ACTIVITIES include transactions between the company and its owners and creditors. That is, they include the sale or buyback of stocks or bonds issued by the company and dividend payments by the company to its shareholders.
In general, changes involving noncurrent liabilities and stockholders\' equity are reported in the financing activities section.
Note the difference between investing and financing activities in the context of the purchase and sale of stocks and bonds. When you buy or sell the stock or bond issued by someone else, it is considered an investing activity. When you issue (sell) or buy back stock or bonds that you had issued, it is considered part of a financing activity.
Cash inflows from financing activities arise when the company issues stock or borrows (by issuing a bond or by signing a note, or otherwise).
Cash outflows from financing activities arise when the company buys back its own stock or bonds, repays loans, or pays dividends to shareholders.
Note that dividends paid to shareholders are considered to be part of financing activities, but interest paid to bondholders is included only as an operating activity. Furthermore, as noted earlier, both dividend and interest revenues received by the company are included in cash flows from operating activities section.
NONCASH INVESTING AND FINANCING ACTIVITIES include noncash transactions that effect both noncurrent assets and noncurrent liabilities or owners\' equity.
.
Precipitation volumetric analysis involves formation reactions of solu.docx
Precipitation volumetric analysis involves formation reactions of soluble compounds. What are the main factors that influence conditions for a successful analysis? Explain how these factors may influence the profiles of the titration curves.
Solution
Following factors influence the precipitation volumetric analysis.
1. Nature of solvent- polarity is directly proportional to the precipitation formation. More polar the solvent more the precipitation.
2. Ph of solution is directly proportional to the precipitation formation. More acidic solutuons form precipitate readily than basic solutions.
3. Concentration of solution is directly proportional to the precipitation formation. Diltue solution form less stable precipitate.
4. Formation of low solubility product in precipitation titration decrease the end point in titration. This can be overcome by adjusting ph.
5. Temperature is directly proportional to the precipitation.
6. Foreign elements present decrease the stability of product as they can show coprecipitation.
4.
.
POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx
POST-LAB QUESTIONS 1. Based on your observations, what aimilarities did you observe in the appearances of the DNA Erom different sources (list two] ? 2. Based on your observations, what ditferences did you observe in the appearances of the DNA from different DNA sources (list two)? 3. Why was isopropanol added to the filtrated liquid and not the extraction buffer? 4. Write the complementary DNA sequence for the following segment of DNA (main strand) Main strand ATGATTGACATTGAGGATCCAT Complementary Strand
Solution
Answer -
Similarties -
Both contain 3 nitrogenous bases: Adenine, Cytosine and Guanine.
both have a phosphate groups in their nucleotides.
Difference -
DNA is a polymer with deoxyriboses and phosphate backbone while RNA is a polymer with a ribose and phosphate backbone.
DNA contain thymine, while RNA contain uracil.
complementary strand - PAIR
ATÂ Â ;GC........write pair
TACTAACTGTAACTCCTAGGTA
.
Portman Corporation has retained earnings of $675-000 at January 1- 20.docx
Portman Corporation has retained earnings of $675,000 at January 1, 2014. Net income during 2014 was $1,400,000, and cash dividends declared and paid during 2014 totaled $75,000. Prepare a retained earnings statement for the year ended December 31, 2014. (List items that increase retained earnings first.)
Solution
Computation of Retained Earning of Portman Corporation as on December 31, 2014.We have,
.
Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx
Please write it in Microsoft Word. Not in handwritten form. I\'ll give +A review.
Q2. Write a biography paragraph about the scientist: Ohm.
Solution
Name :
George Simon Ohm.
He is a German Physicist.
Total Life :
March 16 th 1789 to July 6 th 1854.
( 65 years 3 months and 20 days )
Studies :
he studied the subjects are Maths , Physics , Chemistry , Philosophy.
he is a doctorate from Erlangen University. ( October 25 th 1811 )
Teaching carrier :
He worked as a Teacher and Professor in various Posistions and in various places.
Invention :
Ohm\'s Law.
V = i R
V = voltage
i = current
R = resistance
Famous Law which will be useful in the total electricity concepts.
Awards :
Copley Medal in the year of 1841.
and Scintific career.
Area of interests :
Physics
Especially in Electric fields.
.
please write carefully and explain clearly- Thank you-SolutionKsp of C.docx
please write carefully and explain clearly. Thank you.
Solution
Ksp of CoCO3 = 1*10^-10
CoCO3 (s) -----------------> Co^2+ (aq) + CO3^2- (aq)
s s
Ksp = [Co^2+][CO3^2-]
Ksp = s*s
Ksp = s^2
1*10^-10 = s^2
s^2 = 1*10^-10
s = 1*10^-5 mole/L
molar mass of CoCO3 = 118.94g/mole
solubility of cobalt(II) carbonate = 1*10^-5 mole/L
= 1*10^-5 mole/L * 118.94g/mole
= 1.1894*10^-3g/L
= 1.1894mg/L
The solubility of CoCO3 = 1.1894mg/L
.
Prioritize the three themes of integrated solid waste management- 1^st.docx
Prioritize the three themes of integrated solid waste management. 1^st priority 2^nd priority 3^rd priority
Solution
1.Waste Prevention:Waste prevention also called “source reductionâ€seeks to prevent waste from being generated. Waste prevention strategies include using less packaging, designing products to last longer, and reusing products and materials. Waste prevention helps reduce handling, treatment, and disposal costs and ultimately reduces the generation of methane
2.Recycling and Composting: Recycling is a process that involves collecting, reprocessing, and recovering certain waste materials (e.g., glass, metal, plastics, paper) to make new materials or products. Some recycled organic materials are rich in nutrients and can be used to improve soils.
3.Disposal (landfilling and combustion). These activities are used to manage waste that cannot be prevented or recycled. One way to dispose of waste is to place it in properly designed, constructed, and managed landfills, where it is safely contained. Another way to handle this waste is through combustion.
.
present synchronized savage code while (1) { getServingFromPot ()- ea.docx
present synchronized savage code
while (1) {
getServingFromPot ();
eat ();
}
present synchronized cook code here
while (1) {
refillPot ();
}
Solution
servings = 0
mutex = Semaphore(1)
emptyPot = Semaphore(0)
fullPot = Semaphore(0)
<Cook>
while true:
emptyPot.wait()
putServingsInPot(M)
fullPot.signal()
<Savage>
while true:
mutex.wait()
if servings == 0:
emptyPot.signal()
fullPot.wait()
servings = M
servings -= 1
getServingFromPot()
mutex.signal()
eat()
.
Prepare general journal entries to record the following transactions f.docx
Prepare general journal entries to record the following transactions for the Harris
Company. (The company uses the balance sheet approach for recording bad
debts expense.)
2010
Dec. 31 Recorded Bad Debts Expense, $800
2011
Jan. 3 Wrote off Jal’s account as uncollectible, $60
Mar. 4 Wrote off Hall’s account as uncollectible, $75
Jul. 5 Recovered $45 from Hall
Aug. 19 Wrote off M. Wilson’s account as uncollectible, $100
Nov. 7 Recovered $25 from Jal
Solution
(1) Dec 31, 2010
DR Bad Debt Expense $800
Accounts Receivable $800
(To record bad debt expense)
(2)
Jan 3, 2011
DR Allowance for uncollectible receivable $60
Accounts receivable $60
(To record write-off of Jal\'s account as uncollectible)
(3)
Mar 4, 2011
DR Allowance for uncollectible receivable $75
Accounts receivable $75
(To record write-off of Hall\'s account as uncollectible)
(4)
Jul 5, 2011
DR Cash $45
Bad debt recovered (Income) $45
(To record partial recovery of bad debt from Hall)
(5)
Aug 19, 2011
DR Allowance for uncollectible receivable $100
Accounts receivable $100
(To record write-off of M. Wilson\'s account as uncollectible)
(6)
Nov 7, 2011
DR Cash $25
Bad debt recovered (Income) $25
(To record partial recovery of bad debt from Jal)
.
Prepare functional specifications for the company-'s use of the Web an.docx
Prepare functional specifications for the company\'s use of the Web and the Internet. Include links to and from other sites in your design. Prepare a list of technological specifications for implementation (e.g., what hardware and software are necessary to support your design)?
Solution
Functional specification is a document prepared by an organization to describe the capabilities of the product, and its interaction with users and appearance. The document is developed for software developers. Through this document software developers understand how website functions and behave. Different tools used to prepare functional specification include case scenario, affinity diagrams, storyboards etc.
Functional specifications are valuable for understanding behavior, structure, and functional specification. They help developers and designers to present the information in effective manner. This information helps users interact with the website effectively.
Different technological specifications important to be implemented in a website design are mentioned below:
Technological specification varies on the basis of website or system being designed.
.
Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx
Prepare a 3 to 5 paragraph briefing statement which explains the 3 most important reasons why a company should invest in cybersecurity tools and technologies. Your audience is a group of managers (technical and non-technical) who are participating in a conference on reducing risks associated with insider threats. Provide in-text citations and references for 3 or more authoritative sources. Put the reference list at the end of your posting.
Solution
Reason One
The increasing use of Internet of Thing
In business organization the Internet of thing means the addition of devices which can access the organization data and increase in number of threats of security flaws.
Since these devices weren’t originally registered on network, they may not have enough cybersecurity protections.
so it become easy for cyber criminals to use a device to gain unauthorized access to the hidden data of the organization.
Reason 2
The Breaches are a financial burden
Whenever a breach is discovered, systems are often taken offline to plug the security holes as a result of which the organization may not be able to take more customer order and to fullfil the last order placed, hence it become necessary to include cybersecurity to reduce such financial burden on organization.
Reason 3
the real threats are insider threats
The fraud employee sometimes inflict tremendous harm to take revange with organization or to have a personal profit. The risk associated with this type of threat is that it is very difficult to find such internal loop holes.
Reason 4
Without cybersecurity the reputation of the organization is at risk.
If the organization does\'nt opt the cybersecurity strategy then customer always think that there data is at risk and they will diverge from the organization which really harms the reputation of the organization
.
More from helenc18 (18)
The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx
The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx
The Tinsley Company exchanged land that it had been holding for future.docx
The Tinsley Company exchanged land that it had been holding for future.docx
The State of Rhode Island publishes its budget and the various support.docx
The State of Rhode Island publishes its budget and the various support.docx
The sound strikes the cantina walls and bounces off at the same angle.docx
The sound strikes the cantina walls and bounces off at the same angle.docx
The six platforms below are initially at rest in deep space- The indic.docx
The six platforms below are initially at rest in deep space- The indic.docx
The rise of various digital communication methods in the past decade h.docx
The rise of various digital communication methods in the past decade h.docx
The reason that the increase in population growth in the 19th and 20th.docx
The reason that the increase in population growth in the 19th and 20th.docx
The sale of stock and the sale of bonds are reported as financing acti.docx
The sale of stock and the sale of bonds are reported as financing acti.docx
Precipitation volumetric analysis involves formation reactions of solu.docx
Precipitation volumetric analysis involves formation reactions of solu.docx
POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx
POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx
Portman Corporation has retained earnings of $675-000 at January 1- 20.docx
Portman Corporation has retained earnings of $675-000 at January 1- 20.docx
Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx
Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx
please write carefully and explain clearly- Thank you-SolutionKsp of C.docx
please write carefully and explain clearly- Thank you-SolutionKsp of C.docx
Prioritize the three themes of integrated solid waste management- 1^st.docx
Prioritize the three themes of integrated solid waste management- 1^st.docx
present synchronized savage code while (1) { getServingFromPot ()- ea.docx
present synchronized savage code while (1) { getServingFromPot ()- ea.docx
Prepare general journal entries to record the following transactions f.docx
Prepare general journal entries to record the following transactions f.docx
Prepare functional specifications for the company-'s use of the Web an.docx
Prepare functional specifications for the company-'s use of the Web an.docx
Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx
Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx
Recently uploaded
Main Java[All of the Base Concepts}.docx
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
Biological Screening of Herbal Drugs in detailed.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
CACJapan - GROUP Presentation 1- Wk 4.pdf
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
DRUGS AND ITS classification slide share
Any substance (other than food) that is used to prevent, diagnose, treat, or relieve symptoms of a
disease or abnormal condition
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)Academy of Science of South Africa
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.MATATAG CURRICULUM: ASSESSING THE READINESS OF ELEM. PUBLIC SCHOOL TEACHERS I...
In this research, it concludes that while the readiness of teachers in Caloocan City to implement the MATATAG Curriculum is generally positive, targeted efforts in professional development, resource distribution, support networks, and comprehensive preparation can address the existing gaps and ensure successful curriculum implementation.
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
Top five deadliest dog breeds in America
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
RPMS Template 2023-2024 by: Irene S. Rueco
Chapter 4 - Islamic Financial Institutions in Malaysia.pptx
Chapter 4 - Islamic Financial Institutions in Malaysia.pptxMohd Adib Abd Muin, Senior Lecturer at Universiti Utara Malaysia
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
PCOS corelations and management through Ayurveda.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
clinical examination of hip joint (1).pdf
described clinical examination all orthopeadic conditions .
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance
Introduction to AI for Nonprofits with Tapp Network
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Recently uploaded (20)
Group Presentation 2 Economics.Ariana Buscigliopptx
Group Presentation 2 Economics.Ariana Buscigliopptx
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)
MATATAG CURRICULUM: ASSESSING THE READINESS OF ELEM. PUBLIC SCHOOL TEACHERS I...
MATATAG CURRICULUM: ASSESSING THE READINESS OF ELEM. PUBLIC SCHOOL TEACHERS I...
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Digital Artefact 1 - Tiny Home Environmental Design
Digital Artefact 1 - Tiny Home Environmental Design
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
Chapter 4 - Islamic Financial Institutions in Malaysia.pptx
Chapter 4 - Islamic Financial Institutions in Malaysia.pptx
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance.pptx
Introduction to AI for Nonprofits with Tapp Network
Introduction to AI for Nonprofits with Tapp Network
The SRLY rules for consolidated tax returns are designed to keep corpo.docx
- 1. The SRLY rules for consolidated tax returns are designed to keep corporations from trafficking their net operating losses. Explain. Solution The SRLY ( Seperate Return Limitation Year) is applicable in case of consolidation of financial statement of parent company with subsidary companies. According to this rules if a company take over by another company where the subsidary company having losses in that case its losses cannot be merge with the profit of parent company at the time of consolidation. the subsidary company have to file a seperate return till the losses turn into profit. This rule is mainly made to keep the track of losses of coperate sector & to show the actual picture of the corporate groups. By following this rules Coperates are not allowed to hide the losses by merging with another company. Secondly they can't take the benefit of tax by adjusting losses with profit. Thirdly the true picture of every entity is showed so that stakeholders can't be cheated.