The reason that the increase in population growth in the 19th and 20th.docx
•Download as DOCX, PDF•
0 likes•2 views
The reason that the increase in population growth in the 19th and 20th centuries did not lead to famine as Thomas Malthus predicted was because wars kept the population in check there was diminishing marginal product of labor increases in technology and capital raised labor productivity people learned to eat less worldwide population didn\'t actually grow Solution 3. increases in technology and capital raised labor productivity .
Report
Share
Report
Share
Recommended
The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx
The total electromagnetic power emitted by the sun is 3.8 x 1026 W. This energy is used to power a satellite orbiting Mercury through the use of solar panels. What force is exerted by solar radiation impinging normally on a 5.0 m2 totally absorbing solar panel attached to this satellite? The orbital radius of Mercury is 5.8 x 1010 m.
Solution
given
P = 3.8*10^26 W
r = 5.8*10^10 m
A = 5 m^2
Intensity of radiation at the surface of the Mercury, I = Power/Area
= P/(4*pi*r^2)
= 3.8*10^26/(4*pi*(5.8*10^10)^2)
= 8989 W/m^2
Radiation pressure on completely oborbing surface,
P = I/c
= 8989/(3*10^8)
= 2.996*10^-5 N
so, Force due to radiation, F = P*A
= 2.996*10^-5*5
= 1.50*10^-4 N <<<<<<<<-------Answer
.
The Tinsley Company exchanged land that it had been holding for future.docx
The Tinsley Company exchanged land that it had been holding for future plant expansion for a more suitable parcel located farther from residential areas. Tinsley carried the land at its original cost of $31,500. According to an independent appraisal, the land currently is worth $75,000. Tinsley gave $17,000 in cash to complete the transaction.
Prepare the journal entry to record the exchange assuming the exchange has commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.)
Prepare the journal entry to record the exchange assuming the exchange lacks commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.)
Solution
1) Land: fair value $75,000
cash:paid + $17,000
New parcel = $92,000
2) New parcel = $92,000
Gain on exchnage = $43,500
cash = $17,000
land = $31,500
3) New parcel = $48,500
cash = $17,000
land = $31,500
.
The State of Rhode Island publishes its budget and the various support.docx
The State of Rhode Island publishes its budget and the various supporting information at www.budget.state.ri.us/index.htm which you should access and then answer the following:
A. What are the duties of the budget office? (Hint: Use the About Us link.)
B. What are the six governmental functions listed in the budget? For the most recent year, calculate the percentage of the total budget allocated to each function.
C. What are the major sources of Rhode Island\'s revenues? Calculate the percentage which each category represents of the total revenues.
D. What is the accounting basis used in the preparation of the budget? (Hint: Use the Primer link and scroll down until you see the Budget Basis section.)
E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.)
F. What did you learn from reviewing the most recent budget of the State of Rhode Island?
Solution
E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.)
.
The SRLY rules for consolidated tax returns are designed to keep corpo.docx
The SRLY rules for consolidated tax returns are designed to keep corporations from trafficking their net operating losses. Explain.
Solution
The SRLY ( Seperate Return Limitation Year) is applicable in case of consolidation of financial statement of parent company with subsidary companies.
According to this rules if a company take over by another company where the subsidary company having losses in that case its losses cannot be merge with the profit of parent company at the time of consolidation. the subsidary company have to file a seperate return till the losses turn into profit.
This rule is mainly made to keep the track of losses of coperate sector & to show the actual picture of the corporate groups. By following this rules Coperates are not allowed to hide the losses by merging with another company. Secondly they can\'t take the benefit of tax by adjusting losses with profit. Thirdly the true picture of every entity is showed so that stakeholders can\'t be cheated.
.
The sound strikes the cantina walls and bounces off at the same angle.docx
The sound strikes the cantina walls and bounces off at the same angle as it struck in a process known as _____.
A. reflection
B. refraction
C. constructive interference
D. destructive interference
14. Sound Waves
Choose One • 5 points
Obi Wan hears the destruction of a planet and all of its people through \'the force\'. These sounds are only in his head and are not carried through space, since space has no _____ through which sound could transmit.
electromagnetic wave
electrons
magnetic field
medium
15. The Doppler Effect
Choose One • 5 points
However, had it been a real sound, the sound\'s pitch would have been increased by the Doppler Effect, since the Falcon was moving _____ the source of the sound.
perpendicular to
away from
towards
at the same speed as
bounced wave 2 Angle of Reflection Angle of Incidence Incident wave A single direction of the Sound Wave from Greedo\'s Blaster
Solution
1) Reflection .
Reflection is the change in direction of a wavefront at an interface between two different media so that the wave front returns into the medium from which it originated.
2) Medium
Sound waves require matter to transmit them, unlike light waves.
3) Towards
The Doppler Effect tells us that as an object moves toward the source of sound, the pitch the object feels will increase; when the object moves away, the pitch decreases. In order for the pitch to increase, the falcon must be moving towards the source of sound.
.
The six platforms below are initially at rest in deep space- The indic.docx
The six platforms below are initially at rest in deep space. The indicated forces act on the platforms at endpoints, quarter-points, or midpoints. All forces have the same magnitude. heir Rank these platforms on the basis of the torque that acts on them, measured about their CM. Let the counterclockwise direction be positive and rank positive torques as larger than negative torques. Largest 1. 2.3.4.5. 6. Smallest The ranking cannot be determined based on the information provided. Explain the reason for your ranking:
Solution
B > E > C = F > A > D
let F is the magnitude of force and L is the total length.
A) TA = -F*(L/4) - F*(L/4)
= -F*L/2
B) TB = F*(L/2) + F*(L/2)
= F*L
C) TC = F*(L/4) + F*(L/4)
= F*L/2
D) TD = F*(L/2) - F*(L/4) + F0
= F*L/4
E) TE = F*(L/2) + F*(L/2) - F*(L/4)
= (3/4)*F*L
F) TE = F*(L/2) + F*(L/2) - F*(L/4) - F*(L/4)
= F*L/2
.
The rise of various digital communication methods in the past decade h.docx
The rise of various digital communication methods in the past decade has greatly changed the field of public relations. What new and emerging technologies do you think will continue to change the PR field?
How do you anticipate the PR field changing in response to those technologies?
Explain your answer carefully, citing specific examples of technology or real-life examples from the news.
Solution
PR is basically a method to built and maintain relationsship with different stake holders of an organization. Stake holders are investors,employees,customers,suppliers, regulating agencies , government and society at large.This happens through constat interaction and communication with the concerned people . In the modern times , communication has become very easy with the availability of smart phones and internet.One can communicate/send mails to thousands of people at the click of a mouse.Unlike in traditional way of sending hard copy mailers which takes lot of time to be delivered, emails can reach the receipiant in fraction of a second. Further one doesn\'t have to physically go to a person to chat or talk. He can do that through video conferencing sitting at his home/office through skype or he can also do text based chate in sites like facebook,gmail,yahoo messenger etc
.
The sale of stock and the sale of bonds are reported as financing acti.docx
The sale of stock and the sale of bonds are reported as financing activities. Are payments of dividends to shareholders and payments of interest to bondholders also reported as financing activities? Explain.
Solution
The payment of cash dividends to shareholders is classified as a financing activity.
FINANCING ACTIVITIES include transactions between the company and its owners and creditors. That is, they include the sale or buyback of stocks or bonds issued by the company and dividend payments by the company to its shareholders.
In general, changes involving noncurrent liabilities and stockholders\' equity are reported in the financing activities section.
Note the difference between investing and financing activities in the context of the purchase and sale of stocks and bonds. When you buy or sell the stock or bond issued by someone else, it is considered an investing activity. When you issue (sell) or buy back stock or bonds that you had issued, it is considered part of a financing activity.
Cash inflows from financing activities arise when the company issues stock or borrows (by issuing a bond or by signing a note, or otherwise).
Cash outflows from financing activities arise when the company buys back its own stock or bonds, repays loans, or pays dividends to shareholders.
Note that dividends paid to shareholders are considered to be part of financing activities, but interest paid to bondholders is included only as an operating activity. Furthermore, as noted earlier, both dividend and interest revenues received by the company are included in cash flows from operating activities section.
NONCASH INVESTING AND FINANCING ACTIVITIES include noncash transactions that effect both noncurrent assets and noncurrent liabilities or owners\' equity.
.
Recommended
The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx
The total electromagnetic power emitted by the sun is 3.8 x 1026 W. This energy is used to power a satellite orbiting Mercury through the use of solar panels. What force is exerted by solar radiation impinging normally on a 5.0 m2 totally absorbing solar panel attached to this satellite? The orbital radius of Mercury is 5.8 x 1010 m.
Solution
given
P = 3.8*10^26 W
r = 5.8*10^10 m
A = 5 m^2
Intensity of radiation at the surface of the Mercury, I = Power/Area
= P/(4*pi*r^2)
= 3.8*10^26/(4*pi*(5.8*10^10)^2)
= 8989 W/m^2
Radiation pressure on completely oborbing surface,
P = I/c
= 8989/(3*10^8)
= 2.996*10^-5 N
so, Force due to radiation, F = P*A
= 2.996*10^-5*5
= 1.50*10^-4 N <<<<<<<<-------Answer
.
The Tinsley Company exchanged land that it had been holding for future.docx
The Tinsley Company exchanged land that it had been holding for future plant expansion for a more suitable parcel located farther from residential areas. Tinsley carried the land at its original cost of $31,500. According to an independent appraisal, the land currently is worth $75,000. Tinsley gave $17,000 in cash to complete the transaction.
Prepare the journal entry to record the exchange assuming the exchange has commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.)
Prepare the journal entry to record the exchange assuming the exchange lacks commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.)
Solution
1) Land: fair value $75,000
cash:paid + $17,000
New parcel = $92,000
2) New parcel = $92,000
Gain on exchnage = $43,500
cash = $17,000
land = $31,500
3) New parcel = $48,500
cash = $17,000
land = $31,500
.
The State of Rhode Island publishes its budget and the various support.docx
The State of Rhode Island publishes its budget and the various supporting information at www.budget.state.ri.us/index.htm which you should access and then answer the following:
A. What are the duties of the budget office? (Hint: Use the About Us link.)
B. What are the six governmental functions listed in the budget? For the most recent year, calculate the percentage of the total budget allocated to each function.
C. What are the major sources of Rhode Island\'s revenues? Calculate the percentage which each category represents of the total revenues.
D. What is the accounting basis used in the preparation of the budget? (Hint: Use the Primer link and scroll down until you see the Budget Basis section.)
E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.)
F. What did you learn from reviewing the most recent budget of the State of Rhode Island?
Solution
E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.)
.
The SRLY rules for consolidated tax returns are designed to keep corpo.docx
The SRLY rules for consolidated tax returns are designed to keep corporations from trafficking their net operating losses. Explain.
Solution
The SRLY ( Seperate Return Limitation Year) is applicable in case of consolidation of financial statement of parent company with subsidary companies.
According to this rules if a company take over by another company where the subsidary company having losses in that case its losses cannot be merge with the profit of parent company at the time of consolidation. the subsidary company have to file a seperate return till the losses turn into profit.
This rule is mainly made to keep the track of losses of coperate sector & to show the actual picture of the corporate groups. By following this rules Coperates are not allowed to hide the losses by merging with another company. Secondly they can\'t take the benefit of tax by adjusting losses with profit. Thirdly the true picture of every entity is showed so that stakeholders can\'t be cheated.
.
The sound strikes the cantina walls and bounces off at the same angle.docx
The sound strikes the cantina walls and bounces off at the same angle as it struck in a process known as _____.
A. reflection
B. refraction
C. constructive interference
D. destructive interference
14. Sound Waves
Choose One • 5 points
Obi Wan hears the destruction of a planet and all of its people through \'the force\'. These sounds are only in his head and are not carried through space, since space has no _____ through which sound could transmit.
electromagnetic wave
electrons
magnetic field
medium
15. The Doppler Effect
Choose One • 5 points
However, had it been a real sound, the sound\'s pitch would have been increased by the Doppler Effect, since the Falcon was moving _____ the source of the sound.
perpendicular to
away from
towards
at the same speed as
bounced wave 2 Angle of Reflection Angle of Incidence Incident wave A single direction of the Sound Wave from Greedo\'s Blaster
Solution
1) Reflection .
Reflection is the change in direction of a wavefront at an interface between two different media so that the wave front returns into the medium from which it originated.
2) Medium
Sound waves require matter to transmit them, unlike light waves.
3) Towards
The Doppler Effect tells us that as an object moves toward the source of sound, the pitch the object feels will increase; when the object moves away, the pitch decreases. In order for the pitch to increase, the falcon must be moving towards the source of sound.
.
The six platforms below are initially at rest in deep space- The indic.docx
The six platforms below are initially at rest in deep space. The indicated forces act on the platforms at endpoints, quarter-points, or midpoints. All forces have the same magnitude. heir Rank these platforms on the basis of the torque that acts on them, measured about their CM. Let the counterclockwise direction be positive and rank positive torques as larger than negative torques. Largest 1. 2.3.4.5. 6. Smallest The ranking cannot be determined based on the information provided. Explain the reason for your ranking:
Solution
B > E > C = F > A > D
let F is the magnitude of force and L is the total length.
A) TA = -F*(L/4) - F*(L/4)
= -F*L/2
B) TB = F*(L/2) + F*(L/2)
= F*L
C) TC = F*(L/4) + F*(L/4)
= F*L/2
D) TD = F*(L/2) - F*(L/4) + F0
= F*L/4
E) TE = F*(L/2) + F*(L/2) - F*(L/4)
= (3/4)*F*L
F) TE = F*(L/2) + F*(L/2) - F*(L/4) - F*(L/4)
= F*L/2
.
The rise of various digital communication methods in the past decade h.docx
The rise of various digital communication methods in the past decade has greatly changed the field of public relations. What new and emerging technologies do you think will continue to change the PR field?
How do you anticipate the PR field changing in response to those technologies?
Explain your answer carefully, citing specific examples of technology or real-life examples from the news.
Solution
PR is basically a method to built and maintain relationsship with different stake holders of an organization. Stake holders are investors,employees,customers,suppliers, regulating agencies , government and society at large.This happens through constat interaction and communication with the concerned people . In the modern times , communication has become very easy with the availability of smart phones and internet.One can communicate/send mails to thousands of people at the click of a mouse.Unlike in traditional way of sending hard copy mailers which takes lot of time to be delivered, emails can reach the receipiant in fraction of a second. Further one doesn\'t have to physically go to a person to chat or talk. He can do that through video conferencing sitting at his home/office through skype or he can also do text based chate in sites like facebook,gmail,yahoo messenger etc
.
The sale of stock and the sale of bonds are reported as financing acti.docx
The sale of stock and the sale of bonds are reported as financing activities. Are payments of dividends to shareholders and payments of interest to bondholders also reported as financing activities? Explain.
Solution
The payment of cash dividends to shareholders is classified as a financing activity.
FINANCING ACTIVITIES include transactions between the company and its owners and creditors. That is, they include the sale or buyback of stocks or bonds issued by the company and dividend payments by the company to its shareholders.
In general, changes involving noncurrent liabilities and stockholders\' equity are reported in the financing activities section.
Note the difference between investing and financing activities in the context of the purchase and sale of stocks and bonds. When you buy or sell the stock or bond issued by someone else, it is considered an investing activity. When you issue (sell) or buy back stock or bonds that you had issued, it is considered part of a financing activity.
Cash inflows from financing activities arise when the company issues stock or borrows (by issuing a bond or by signing a note, or otherwise).
Cash outflows from financing activities arise when the company buys back its own stock or bonds, repays loans, or pays dividends to shareholders.
Note that dividends paid to shareholders are considered to be part of financing activities, but interest paid to bondholders is included only as an operating activity. Furthermore, as noted earlier, both dividend and interest revenues received by the company are included in cash flows from operating activities section.
NONCASH INVESTING AND FINANCING ACTIVITIES include noncash transactions that effect both noncurrent assets and noncurrent liabilities or owners\' equity.
.
Precipitation volumetric analysis involves formation reactions of solu.docx
Precipitation volumetric analysis involves formation reactions of soluble compounds. What are the main factors that influence conditions for a successful analysis? Explain how these factors may influence the profiles of the titration curves.
Solution
Following factors influence the precipitation volumetric analysis.
1. Nature of solvent- polarity is directly proportional to the precipitation formation. More polar the solvent more the precipitation.
2. Ph of solution is directly proportional to the precipitation formation. More acidic solutuons form precipitate readily than basic solutions.
3. Concentration of solution is directly proportional to the precipitation formation. Diltue solution form less stable precipitate.
4. Formation of low solubility product in precipitation titration decrease the end point in titration. This can be overcome by adjusting ph.
5. Temperature is directly proportional to the precipitation.
6. Foreign elements present decrease the stability of product as they can show coprecipitation.
4.
.
POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx
POST-LAB QUESTIONS 1. Based on your observations, what aimilarities did you observe in the appearances of the DNA Erom different sources (list two] ? 2. Based on your observations, what ditferences did you observe in the appearances of the DNA from different DNA sources (list two)? 3. Why was isopropanol added to the filtrated liquid and not the extraction buffer? 4. Write the complementary DNA sequence for the following segment of DNA (main strand) Main strand ATGATTGACATTGAGGATCCAT Complementary Strand
Solution
Answer -
Similarties -
Both contain 3 nitrogenous bases: Adenine, Cytosine and Guanine.
both have a phosphate groups in their nucleotides.
Difference -
DNA is a polymer with deoxyriboses and phosphate backbone while RNA is a polymer with a ribose and phosphate backbone.
DNA contain thymine, while RNA contain uracil.
complementary strand - PAIR
ATÂ Â ;GC........write pair
TACTAACTGTAACTCCTAGGTA
.
Portman Corporation has retained earnings of $675-000 at January 1- 20.docx
Portman Corporation has retained earnings of $675,000 at January 1, 2014. Net income during 2014 was $1,400,000, and cash dividends declared and paid during 2014 totaled $75,000. Prepare a retained earnings statement for the year ended December 31, 2014. (List items that increase retained earnings first.)
Solution
Computation of Retained Earning of Portman Corporation as on December 31, 2014.We have,
.
Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx
Please write it in Microsoft Word. Not in handwritten form. I\'ll give +A review.
Q2. Write a biography paragraph about the scientist: Ohm.
Solution
Name :
George Simon Ohm.
He is a German Physicist.
Total Life :
March 16 th 1789 to July 6 th 1854.
( 65 years 3 months and 20 days )
Studies :
he studied the subjects are Maths , Physics , Chemistry , Philosophy.
he is a doctorate from Erlangen University. ( October 25 th 1811 )
Teaching carrier :
He worked as a Teacher and Professor in various Posistions and in various places.
Invention :
Ohm\'s Law.
V = i R
V = voltage
i = current
R = resistance
Famous Law which will be useful in the total electricity concepts.
Awards :
Copley Medal in the year of 1841.
and Scintific career.
Area of interests :
Physics
Especially in Electric fields.
.
please write carefully and explain clearly- Thank you-SolutionKsp of C.docx
please write carefully and explain clearly. Thank you.
Solution
Ksp of CoCO3 = 1*10^-10
CoCO3 (s) -----------------> Co^2+ (aq) + CO3^2- (aq)
s s
Ksp = [Co^2+][CO3^2-]
Ksp = s*s
Ksp = s^2
1*10^-10 = s^2
s^2 = 1*10^-10
s = 1*10^-5 mole/L
molar mass of CoCO3 = 118.94g/mole
solubility of cobalt(II) carbonate = 1*10^-5 mole/L
= 1*10^-5 mole/L * 118.94g/mole
= 1.1894*10^-3g/L
= 1.1894mg/L
The solubility of CoCO3 = 1.1894mg/L
.
Prioritize the three themes of integrated solid waste management- 1^st.docx
Prioritize the three themes of integrated solid waste management. 1^st priority 2^nd priority 3^rd priority
Solution
1.Waste Prevention:Waste prevention also called “source reductionâ€seeks to prevent waste from being generated. Waste prevention strategies include using less packaging, designing products to last longer, and reusing products and materials. Waste prevention helps reduce handling, treatment, and disposal costs and ultimately reduces the generation of methane
2.Recycling and Composting: Recycling is a process that involves collecting, reprocessing, and recovering certain waste materials (e.g., glass, metal, plastics, paper) to make new materials or products. Some recycled organic materials are rich in nutrients and can be used to improve soils.
3.Disposal (landfilling and combustion). These activities are used to manage waste that cannot be prevented or recycled. One way to dispose of waste is to place it in properly designed, constructed, and managed landfills, where it is safely contained. Another way to handle this waste is through combustion.
.
present synchronized savage code while (1) { getServingFromPot ()- ea.docx
present synchronized savage code
while (1) {
getServingFromPot ();
eat ();
}
present synchronized cook code here
while (1) {
refillPot ();
}
Solution
servings = 0
mutex = Semaphore(1)
emptyPot = Semaphore(0)
fullPot = Semaphore(0)
<Cook>
while true:
emptyPot.wait()
putServingsInPot(M)
fullPot.signal()
<Savage>
while true:
mutex.wait()
if servings == 0:
emptyPot.signal()
fullPot.wait()
servings = M
servings -= 1
getServingFromPot()
mutex.signal()
eat()
.
Prepare general journal entries to record the following transactions f.docx
Prepare general journal entries to record the following transactions for the Harris
Company. (The company uses the balance sheet approach for recording bad
debts expense.)
2010
Dec. 31 Recorded Bad Debts Expense, $800
2011
Jan. 3 Wrote off Jal’s account as uncollectible, $60
Mar. 4 Wrote off Hall’s account as uncollectible, $75
Jul. 5 Recovered $45 from Hall
Aug. 19 Wrote off M. Wilson’s account as uncollectible, $100
Nov. 7 Recovered $25 from Jal
Solution
(1) Dec 31, 2010
DR Bad Debt Expense $800
Accounts Receivable $800
(To record bad debt expense)
(2)
Jan 3, 2011
DR Allowance for uncollectible receivable $60
Accounts receivable $60
(To record write-off of Jal\'s account as uncollectible)
(3)
Mar 4, 2011
DR Allowance for uncollectible receivable $75
Accounts receivable $75
(To record write-off of Hall\'s account as uncollectible)
(4)
Jul 5, 2011
DR Cash $45
Bad debt recovered (Income) $45
(To record partial recovery of bad debt from Hall)
(5)
Aug 19, 2011
DR Allowance for uncollectible receivable $100
Accounts receivable $100
(To record write-off of M. Wilson\'s account as uncollectible)
(6)
Nov 7, 2011
DR Cash $25
Bad debt recovered (Income) $25
(To record partial recovery of bad debt from Jal)
.
Prepare functional specifications for the company-'s use of the Web an.docx
Prepare functional specifications for the company\'s use of the Web and the Internet. Include links to and from other sites in your design. Prepare a list of technological specifications for implementation (e.g., what hardware and software are necessary to support your design)?
Solution
Functional specification is a document prepared by an organization to describe the capabilities of the product, and its interaction with users and appearance. The document is developed for software developers. Through this document software developers understand how website functions and behave. Different tools used to prepare functional specification include case scenario, affinity diagrams, storyboards etc.
Functional specifications are valuable for understanding behavior, structure, and functional specification. They help developers and designers to present the information in effective manner. This information helps users interact with the website effectively.
Different technological specifications important to be implemented in a website design are mentioned below:
Technological specification varies on the basis of website or system being designed.
.
Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx
Prepare a 3 to 5 paragraph briefing statement which explains the 3 most important reasons why a company should invest in cybersecurity tools and technologies. Your audience is a group of managers (technical and non-technical) who are participating in a conference on reducing risks associated with insider threats. Provide in-text citations and references for 3 or more authoritative sources. Put the reference list at the end of your posting.
Solution
Reason One
The increasing use of Internet of Thing
In business organization the Internet of thing means the addition of devices which can access the organization data and increase in number of threats of security flaws.
Since these devices weren’t originally registered on network, they may not have enough cybersecurity protections.
so it become easy for cyber criminals to use a device to gain unauthorized access to the hidden data of the organization.
Reason 2
The Breaches are a financial burden
Whenever a breach is discovered, systems are often taken offline to plug the security holes as a result of which the organization may not be able to take more customer order and to fullfil the last order placed, hence it become necessary to include cybersecurity to reduce such financial burden on organization.
Reason 3
the real threats are insider threats
The fraud employee sometimes inflict tremendous harm to take revange with organization or to have a personal profit. The risk associated with this type of threat is that it is very difficult to find such internal loop holes.
Reason 4
Without cybersecurity the reputation of the organization is at risk.
If the organization does\'nt opt the cybersecurity strategy then customer always think that there data is at risk and they will diverge from the organization which really harms the reputation of the organization
.
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
RPMS Template 2023-2024 by: Irene S. Rueco
How to Build a Module in Odoo 17 Using the Scaffold Method
Odoo provides an option for creating a module by using a single line command. By using this command the user can make a whole structure of a module. It is very easy for a beginner to make a module. There is no need to make each file manually. This slide will show how to create a module using the scaffold method.
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
Normal Labour/ Stages of Labour/ Mechanism of Labour
Normal labor is also termed spontaneous labor, defined as the natural physiological process through which the fetus, placenta, and membranes are expelled from the uterus through the birth canal at term (37 to 42 weeks
clinical examination of hip joint (1).pdf
described clinical examination all orthopeadic conditions .
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
Delivering Micro-Credentials in Technical and Vocational Education and Training
Explore how micro-credentials are transforming Technical and Vocational Education and Training (TVET) with this comprehensive slide deck. Discover what micro-credentials are, their importance in TVET, the advantages they offer, and the insights from industry experts. Additionally, learn about the top software applications available for creating and managing micro-credentials. This presentation also includes valuable resources and a discussion on the future of these specialised certifications.
For more detailed information on delivering micro-credentials in TVET, visit this https://tvettrainer.com/delivering-micro-credentials-in-tvet/
More Related Content
More from helenc18
Precipitation volumetric analysis involves formation reactions of solu.docx
Precipitation volumetric analysis involves formation reactions of soluble compounds. What are the main factors that influence conditions for a successful analysis? Explain how these factors may influence the profiles of the titration curves.
Solution
Following factors influence the precipitation volumetric analysis.
1. Nature of solvent- polarity is directly proportional to the precipitation formation. More polar the solvent more the precipitation.
2. Ph of solution is directly proportional to the precipitation formation. More acidic solutuons form precipitate readily than basic solutions.
3. Concentration of solution is directly proportional to the precipitation formation. Diltue solution form less stable precipitate.
4. Formation of low solubility product in precipitation titration decrease the end point in titration. This can be overcome by adjusting ph.
5. Temperature is directly proportional to the precipitation.
6. Foreign elements present decrease the stability of product as they can show coprecipitation.
4.
.
POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx
POST-LAB QUESTIONS 1. Based on your observations, what aimilarities did you observe in the appearances of the DNA Erom different sources (list two] ? 2. Based on your observations, what ditferences did you observe in the appearances of the DNA from different DNA sources (list two)? 3. Why was isopropanol added to the filtrated liquid and not the extraction buffer? 4. Write the complementary DNA sequence for the following segment of DNA (main strand) Main strand ATGATTGACATTGAGGATCCAT Complementary Strand
Solution
Answer -
Similarties -
Both contain 3 nitrogenous bases: Adenine, Cytosine and Guanine.
both have a phosphate groups in their nucleotides.
Difference -
DNA is a polymer with deoxyriboses and phosphate backbone while RNA is a polymer with a ribose and phosphate backbone.
DNA contain thymine, while RNA contain uracil.
complementary strand - PAIR
ATÂ Â ;GC........write pair
TACTAACTGTAACTCCTAGGTA
.
Portman Corporation has retained earnings of $675-000 at January 1- 20.docx
Portman Corporation has retained earnings of $675,000 at January 1, 2014. Net income during 2014 was $1,400,000, and cash dividends declared and paid during 2014 totaled $75,000. Prepare a retained earnings statement for the year ended December 31, 2014. (List items that increase retained earnings first.)
Solution
Computation of Retained Earning of Portman Corporation as on December 31, 2014.We have,
.
Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx
Please write it in Microsoft Word. Not in handwritten form. I\'ll give +A review.
Q2. Write a biography paragraph about the scientist: Ohm.
Solution
Name :
George Simon Ohm.
He is a German Physicist.
Total Life :
March 16 th 1789 to July 6 th 1854.
( 65 years 3 months and 20 days )
Studies :
he studied the subjects are Maths , Physics , Chemistry , Philosophy.
he is a doctorate from Erlangen University. ( October 25 th 1811 )
Teaching carrier :
He worked as a Teacher and Professor in various Posistions and in various places.
Invention :
Ohm\'s Law.
V = i R
V = voltage
i = current
R = resistance
Famous Law which will be useful in the total electricity concepts.
Awards :
Copley Medal in the year of 1841.
and Scintific career.
Area of interests :
Physics
Especially in Electric fields.
.
please write carefully and explain clearly- Thank you-SolutionKsp of C.docx
please write carefully and explain clearly. Thank you.
Solution
Ksp of CoCO3 = 1*10^-10
CoCO3 (s) -----------------> Co^2+ (aq) + CO3^2- (aq)
s s
Ksp = [Co^2+][CO3^2-]
Ksp = s*s
Ksp = s^2
1*10^-10 = s^2
s^2 = 1*10^-10
s = 1*10^-5 mole/L
molar mass of CoCO3 = 118.94g/mole
solubility of cobalt(II) carbonate = 1*10^-5 mole/L
= 1*10^-5 mole/L * 118.94g/mole
= 1.1894*10^-3g/L
= 1.1894mg/L
The solubility of CoCO3 = 1.1894mg/L
.
Prioritize the three themes of integrated solid waste management- 1^st.docx
Prioritize the three themes of integrated solid waste management. 1^st priority 2^nd priority 3^rd priority
Solution
1.Waste Prevention:Waste prevention also called “source reductionâ€seeks to prevent waste from being generated. Waste prevention strategies include using less packaging, designing products to last longer, and reusing products and materials. Waste prevention helps reduce handling, treatment, and disposal costs and ultimately reduces the generation of methane
2.Recycling and Composting: Recycling is a process that involves collecting, reprocessing, and recovering certain waste materials (e.g., glass, metal, plastics, paper) to make new materials or products. Some recycled organic materials are rich in nutrients and can be used to improve soils.
3.Disposal (landfilling and combustion). These activities are used to manage waste that cannot be prevented or recycled. One way to dispose of waste is to place it in properly designed, constructed, and managed landfills, where it is safely contained. Another way to handle this waste is through combustion.
.
present synchronized savage code while (1) { getServingFromPot ()- ea.docx
present synchronized savage code
while (1) {
getServingFromPot ();
eat ();
}
present synchronized cook code here
while (1) {
refillPot ();
}
Solution
servings = 0
mutex = Semaphore(1)
emptyPot = Semaphore(0)
fullPot = Semaphore(0)
<Cook>
while true:
emptyPot.wait()
putServingsInPot(M)
fullPot.signal()
<Savage>
while true:
mutex.wait()
if servings == 0:
emptyPot.signal()
fullPot.wait()
servings = M
servings -= 1
getServingFromPot()
mutex.signal()
eat()
.
Prepare general journal entries to record the following transactions f.docx
Prepare general journal entries to record the following transactions for the Harris
Company. (The company uses the balance sheet approach for recording bad
debts expense.)
2010
Dec. 31 Recorded Bad Debts Expense, $800
2011
Jan. 3 Wrote off Jal’s account as uncollectible, $60
Mar. 4 Wrote off Hall’s account as uncollectible, $75
Jul. 5 Recovered $45 from Hall
Aug. 19 Wrote off M. Wilson’s account as uncollectible, $100
Nov. 7 Recovered $25 from Jal
Solution
(1) Dec 31, 2010
DR Bad Debt Expense $800
Accounts Receivable $800
(To record bad debt expense)
(2)
Jan 3, 2011
DR Allowance for uncollectible receivable $60
Accounts receivable $60
(To record write-off of Jal\'s account as uncollectible)
(3)
Mar 4, 2011
DR Allowance for uncollectible receivable $75
Accounts receivable $75
(To record write-off of Hall\'s account as uncollectible)
(4)
Jul 5, 2011
DR Cash $45
Bad debt recovered (Income) $45
(To record partial recovery of bad debt from Hall)
(5)
Aug 19, 2011
DR Allowance for uncollectible receivable $100
Accounts receivable $100
(To record write-off of M. Wilson\'s account as uncollectible)
(6)
Nov 7, 2011
DR Cash $25
Bad debt recovered (Income) $25
(To record partial recovery of bad debt from Jal)
.
Prepare functional specifications for the company-'s use of the Web an.docx
Prepare functional specifications for the company\'s use of the Web and the Internet. Include links to and from other sites in your design. Prepare a list of technological specifications for implementation (e.g., what hardware and software are necessary to support your design)?
Solution
Functional specification is a document prepared by an organization to describe the capabilities of the product, and its interaction with users and appearance. The document is developed for software developers. Through this document software developers understand how website functions and behave. Different tools used to prepare functional specification include case scenario, affinity diagrams, storyboards etc.
Functional specifications are valuable for understanding behavior, structure, and functional specification. They help developers and designers to present the information in effective manner. This information helps users interact with the website effectively.
Different technological specifications important to be implemented in a website design are mentioned below:
Technological specification varies on the basis of website or system being designed.
.
Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx
Prepare a 3 to 5 paragraph briefing statement which explains the 3 most important reasons why a company should invest in cybersecurity tools and technologies. Your audience is a group of managers (technical and non-technical) who are participating in a conference on reducing risks associated with insider threats. Provide in-text citations and references for 3 or more authoritative sources. Put the reference list at the end of your posting.
Solution
Reason One
The increasing use of Internet of Thing
In business organization the Internet of thing means the addition of devices which can access the organization data and increase in number of threats of security flaws.
Since these devices weren’t originally registered on network, they may not have enough cybersecurity protections.
so it become easy for cyber criminals to use a device to gain unauthorized access to the hidden data of the organization.
Reason 2
The Breaches are a financial burden
Whenever a breach is discovered, systems are often taken offline to plug the security holes as a result of which the organization may not be able to take more customer order and to fullfil the last order placed, hence it become necessary to include cybersecurity to reduce such financial burden on organization.
Reason 3
the real threats are insider threats
The fraud employee sometimes inflict tremendous harm to take revange with organization or to have a personal profit. The risk associated with this type of threat is that it is very difficult to find such internal loop holes.
Reason 4
Without cybersecurity the reputation of the organization is at risk.
If the organization does\'nt opt the cybersecurity strategy then customer always think that there data is at risk and they will diverge from the organization which really harms the reputation of the organization
.
More from helenc18 (10)
Precipitation volumetric analysis involves formation reactions of solu.docx
Precipitation volumetric analysis involves formation reactions of solu.docx
POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx
POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx
Portman Corporation has retained earnings of $675-000 at January 1- 20.docx
Portman Corporation has retained earnings of $675-000 at January 1- 20.docx
Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx
Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx
please write carefully and explain clearly- Thank you-SolutionKsp of C.docx
please write carefully and explain clearly- Thank you-SolutionKsp of C.docx
Prioritize the three themes of integrated solid waste management- 1^st.docx
Prioritize the three themes of integrated solid waste management- 1^st.docx
present synchronized savage code while (1) { getServingFromPot ()- ea.docx
present synchronized savage code while (1) { getServingFromPot ()- ea.docx
Prepare general journal entries to record the following transactions f.docx
Prepare general journal entries to record the following transactions f.docx
Prepare functional specifications for the company-'s use of the Web an.docx
Prepare functional specifications for the company-'s use of the Web an.docx
Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx
Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx
Recently uploaded
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
RPMS Template 2023-2024 by: Irene S. Rueco
How to Build a Module in Odoo 17 Using the Scaffold Method
Odoo provides an option for creating a module by using a single line command. By using this command the user can make a whole structure of a module. It is very easy for a beginner to make a module. There is no need to make each file manually. This slide will show how to create a module using the scaffold method.
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
Normal Labour/ Stages of Labour/ Mechanism of Labour
Normal labor is also termed spontaneous labor, defined as the natural physiological process through which the fetus, placenta, and membranes are expelled from the uterus through the birth canal at term (37 to 42 weeks
clinical examination of hip joint (1).pdf
described clinical examination all orthopeadic conditions .
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
Delivering Micro-Credentials in Technical and Vocational Education and Training
Explore how micro-credentials are transforming Technical and Vocational Education and Training (TVET) with this comprehensive slide deck. Discover what micro-credentials are, their importance in TVET, the advantages they offer, and the insights from industry experts. Additionally, learn about the top software applications available for creating and managing micro-credentials. This presentation also includes valuable resources and a discussion on the future of these specialised certifications.
For more detailed information on delivering micro-credentials in TVET, visit this https://tvettrainer.com/delivering-micro-credentials-in-tvet/
The Diamonds of 2023-2024 in the IGRA collection
A review of the growth of the Israel Genealogy Research Association Database Collection for the last 12 months. Our collection is now passed the 3 million mark and still growing. See which archives have contributed the most. See the different types of records we have, and which years have had records added. You can also see what we have for the future.
A Strategic Approach: GenAI in Education
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
DRUGS AND ITS classification slide share
Any substance (other than food) that is used to prevent, diagnose, treat, or relieve symptoms of a
disease or abnormal condition
Advantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO Perspective
CACJapan - GROUP Presentation 1- Wk 4.pdf
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Top five deadliest dog breeds in America
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
Recently uploaded (20)
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
How to Build a Module in Odoo 17 Using the Scaffold Method
How to Build a Module in Odoo 17 Using the Scaffold Method
Digital Artefact 1 - Tiny Home Environmental Design
Digital Artefact 1 - Tiny Home Environmental Design
Group Presentation 2 Economics.Ariana Buscigliopptx
Group Presentation 2 Economics.Ariana Buscigliopptx
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
Normal Labour/ Stages of Labour/ Mechanism of Labour
Normal Labour/ Stages of Labour/ Mechanism of Labour
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
Delivering Micro-Credentials in Technical and Vocational Education and Training
Delivering Micro-Credentials in Technical and Vocational Education and Training
Advantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO Perspective
The reason that the increase in population growth in the 19th and 20th.docx
- 1. The reason that the increase in population growth in the 19th and 20th centuries did not lead to famine as Thomas Malthus predicted was because wars kept the population in check there was diminishing marginal product of labor increases in technology and capital raised labor productivity people learned to eat less worldwide population didn't actually grow 1. wars kept the population in check 2. there was diminishing marginal product of labor 3. increases in technology and capital raised labor productivity 4. people learned to eat less 5. worldwide population didn't actually grow Solution 3. increases in technology and capital raised labor productivity