Sunder single file thesis

VP2VP2 BASED GENOTYPING OF FIELD ISOLATES OF
Lala Lajpat Rai University of Veterinary and Animal Sciences
in partial fulfillment of requirement for the degree of
MMAASSTT
A
DEPARTMENT OF
LALA LAJPAT RAI UNIVERSITY OF VETERINARY
BASED GENOTYPING OF FIELD ISOLATES OF
TTEERR OOFF
AANNIIMMAA
DEPARTMENT OF
COLLEGE OF VETERINARY SCIENCES
AND ANIMAL SCIENCES, HISAR
CANINE PARVO VIRUS
SUNDIRESAN
(2011V08M)
Dissertation submitted to
FF VVEETT
AALL BBIIOO
DEPARTMENT OF ANIMAL BIOTECHNOLOGY
CANINE PARVO VIRUS
BY
SUNDIRESAN
(2011V08M)
TTEERRIINNAA
IINN
OOTTEECCHH
ANIMAL BIOTECHNOLOGY
2013
CANINE PARVO VIRUS
SUNDIRESAN.K
(2011V08M)
NNAARRYY SS
HHNNOOLLOO
AND ANIMAL SCIENCES, HISAR-125 004
CANINE PARVO VIRUS
SSCCIIEENNCC
OOGGYY
125 004
NNCCEESS

CERTIFICATE – I
This is to certify that the dissertation entitled “VP2 based genotyping of canine parvo
virus” submitted for the degree of Master of Veterinary Sciences in the subject of Animal
Biotechnology to the Lala Lajpat Rai University of Veterinary & Animal Sciences, Hisar, is a
bonafide research work carried out by Dr. SUNDIRESAN.K, Admn No: 2011V08M under my
supervision and that no part of this dissertation has been submitted for any other degree.
The assistance and help received during the course of investigation have been fully
acknowledged.
(Dr. Minakshi)
Major Advisor
Department of Animal Biotechnology
LLRUVAS
Hisar-125 004

CERTIFICATE – II
This is to certify that the dissertation entitled “VP2 based genotyping of canine parvo
virus” submitted by Dr. SUNDIRESAN.K, Admn No: 2011V08M to the Lala Lajpat Rai
University of Veterinary & Animal Sciences, Hisar, in partial fulfillment of the requirement for
the degree of Master of Veterinary sciences in the subject of Animal Biotechnology has been
approved by the Student’s Advisory Committee after an oral examination of the same in
collaboration with an external examiner.
MAJOR ADVISOR
HEAD OF THE DEPARTMENT
DEAN, POSTGRADUATE STUDIES EXTERNAL EXAMINER

ACKNOWLEDGEMENT
First and foremost I offer my sincerest gratitude to my supervisor, Dr. Minakshi Gaya Prasad,
who has supported me throughout my research with her patience and knowledge whilst
allowing me the room to work in my own way. I attribute the level of my Masters degree to her
encouragement and effort and without her this thesis, too, would not have been completed or
written. One simply could not wish for a better or friendlier supervisor.
I am also extremely thankful to other members of my advisory committee, Dr.Trilok
nanda, Dr.Y.P.Grover, Dr.Y.Singh and Dr.sandeep Gera for their helpful suggestions
and timely help during the period of my research work. My sincere thanks are due to
for their intellectual input and help during the execution of this research work.
I express my whole hearted thanks to Dr.pawan Bagri, Dr.Koushlesh ranjan,
Dr.Basanti for their guidance and continuous support during the course of lab work.
I am also thankful to the laboratory and office staffs of department of animal
biotechnology for their kind help during the research work.
I like to include a warm hearted thanks for all the laboratory mates who provided me
the moral support.
Place: Hisar
Dated: June, 2013 (Dr. SUNDIRESAN.K)

CONTENTS
Chapter No. Description Page(s)
I Introduction 1-3
II Review of Literature 4-13
III Materials and Methods 14-28
IV Results 29-44
V Discussion 45-50
VI Summary and Conclusion 51-52
Literature cited
Appendix

LIST OF TABLES
Table No. Description Page(s)
3.1 standard reaction mixture for partial VP2 sequencing 15
3.2 Primers used for amplification of partial 747 bp VP2 gene 16
3.3 Standard reaction mixture for genotype specific PCR 17
3.4 Genotype specific primers 17
3.5 reaction mixture for restriction enzyme digestion 18
3.6 Primers for complete genome sequencing 19
3.7 Standard reaction mixture for whole genome amplification 20
3.8
Primer annealing temperature used for amplification of whole
length coding sequences:
21
3.9
reaction mix for RsaI enzyme plasmid digestion:
26
3.10
reaction mix for PstI enzymes plasmid digestion:
27
4.1a
Source of canine parvo virus positive field isolates
30
4.1b Details of canine parvo virus positive field isolates 31
4.2 Nanodrop quantification DNA templates 35

LIST OF FIGURES
Figure
No.
Description Page(s)
3.1 Optimized thermocyclic conditions for partial amplification of 747 bp
VP2 gene
15
3.2 Optimized PCR condition for genotyping of field samples of CPV 17
3.3 Optimized cyclic conditions for whole genome amplification: 20
3.4 Cloning strategy of PCR products in pJET1.2/blunt cloning vector 24
4.1 747bp Product amplified by partial VP2 gene specific primers 33
4.2 genotyping of CPV isolate 2a/2b 33
4.3 genotyping of CPV isolate 2b 34
4.4 Insilco RE of 747bp amplified product 34
4.5 wet lab RE of 747bp amplified product 36
4.6 whole genome amplification by primer walk technique 36
4.7 Screening of positive recombinant clones of partial VP2 gene on LB agar 38
4.8 Agarose gel electrophoresis (1%) showing amplified product of 427 bp
gene in colony touch PCR
38
4.9 Agarose gel electrophoresis (1%) showing amplified product of 411bp
and 618 bp gene in colony touch PCR
39
4.10 Agarose gel electrophoresis (0.7%) showing recombinants plasmid DNA
of canine parvo virus
39
4.11 RsaI enzyme Insilco digestion of plasmid 40
4.12 RsaI enzyme RE digestion by wet lab confirmation 40
4.13 PstI enzyme Insilco digestion of plasmid to make linear 41
4.14 PstI enzyme RE digestion by wet lab confirmation 41
4.15 Multiple alignment of Hisar isolate with strains of other geographical
location based on partial VP2 gene
43
4.16 Phylogenetic tree construction based on partial VP2 gene with other
geographical isolates.
44
4.17 Microphotograph of Madine Darby Canine Kidney cells 48 hrs of growth. 44

ABBREVIATIONS
aa Aminoacid
A Adenine
AGE Agarose gel electrophoresis
bp Base pair
CPV Canine parvovirus
C Cytosine
Cm Centimeter
CRFK Crandell Rees Feline Kidney
DNA Deoxyribose nucleic acid
D Diarrhoea
dNTPs Deoxynucleotide triphosphates
EDTA Ethylene diamine tetra acetic acid
ELISA Enzyme linked immunosorbent assay
FPV Feline panleukopenia virus
g Gram
G Guanine
HA Haemagglutination
hr Hour
M Molar
MAb Monoclonal antibody
MDCK Madin Darby canine kidney
mg Milligram
MgCl2 Magnesium chloride
min Minute
ml Milliliter
mm Millimeter
mM Millimolar
Mw Molecular weight
ND Non diarrhoea
NFW Nuclease free water
ng Nano gram
ORF open reading frame
PCR Polymerase chain reaction
pmol Picomoles
RE Restriction endonuclease
RFLP Restriction fragment length polymorphism
rpm Revolutions per minute
ss Single stranded
T Thymine
TAE Tris acetate EDTA
Taq Thermophilus aquaticus
µg Microgram
µl Microlitre
µM Micromolar
U Units
UV Ultra-violet
V Volts

1
CHAPTER-I
INTRODUCTION
Dogs are the first animals to be domesticated in different places almost at the
same time. Dogs are considered for their loyalty and best companions with humans (Amalendu,
2006). Since the dogs were more prone for gastrointestinal infections, chances of getting infected
by viral, bacterial, and parasitic pathogens are at high. Canine parvovirus leads to the most
diarrhoeic infections in canines and accounts to 27% of all the diarrhoeic infections (Sakulwira et
al., 2001)
Parvo viruses are the smallest known viruses. Canine parvovirus type 2 (CPV2)
belongs to the family Parvoviridae, sub family Parvovirinae and genus Parvo virus. It is one of
the smallest DNA viruses. The virions have the capsid of icosahedral symmetry with diameter
ranging from 18-26nm. The viral genome is linear, single stranded DNA, with the size of 5.2 Kbp
(Carter and Saunder, 2007). The genome has terminal palindromic sequences enabling each end
to form hairpin structure. The virus genome encodes three structural (VP1, VP2 and VP3) and
two non structural (NS1, NS2) proteins. The entire VP1 and VP2 genome is 2.2Kbp in size
(MacLachlan et al., 2011).
The outer capsid protein of 60 amino acid molecules contributed by VP2.The
central structural motif of VP2 is eight stranded antiparallel beta barrel. The geometrical
possession of the structure holds a 22 angstrom (A°) long protrusion on three fold axes, a 15 A°
deep canyon circulation about each of the five cylindrical structures at the fivefold axes and a 15
A° deep depression at the two fold axes (Tsao et al., 1991). This cylindrical loop like structures
stabilizes the virus against environmental variation. The N- terminus of VP2 is identical in all
CPV isolates and the variety of host ranges from cats, mink and raccoons (Mizak et al., 2001).
The coding regions are found in the single frame. The homology of CPV and FPV shares 98%
with nucleotide and 99% with that of FPV respectively. Hence the antigenic differentiation and
the allied host range specificity depend on the nucleotide or amino acid variation.
The virus is highly contagious and route of transmission is usually via direct
contact or fomites; fleas and humans can also act as mechanical vectors. The virus is infective
when ingested through oral or intranasal route (Fields et al., 1990). Infective canine parvovirus
binds to the transferrin receptor found on the plasma membrane and endocytosed by clathrin

2
mediated uptake pathway. Viral replication is closely associated with the cellular replication,
which occurs at mitotic S-phase and replication of virus takes place only in such cells. They
travel through the cytoplasm to reach the nucleus by endocytic pathway mediated clathrion
coated vesicles by hacking host cells nuclear import machinery and finally enter the nucleus
through nuclear pore complex (Kasamatsu et al., 1998). The cellular DNA polymerase enzyme
was utilized for the synthesis of double stranded DNA from single stranded viral DNA
(MacLachlan et al., 2011).
The entry of infectious viral particles mostly by contact with infected fomites.
The virus shedding in the faeces was found to be abundant and the viral particles were noticed all
over the places. The potential clinical signs include the acute form of canine parvovirus infection
characterized by myocarditis and sudden death of pups. The recovered pups show lesion in the
myocardium impairs the performance of the dogs and livability. The presence of bloody diarrhoea
and a low white blood cell count in unvaccinated dogs are strong indications of infection (Lobetti
et al., 2003)
Due to mutations, the CPV2 has undergone antigenic variation resulting in
emergence of various mutants such as CPV2a, 2b and 2c. The CPV2a was first reported in 1979,
whereas CPV2b in 1984. The first report of CPV-2c was from Italy in the year 2000 (Martella et
al., 2004) and reported from other countries like western European countries, Asia and South
America. Few outbreaks of CPV-2c also been reported from Vietnam and Spain (Charles et al.,
2007). From north americaCPV-2c was reported in the year 2006 (Kapil et al., 2006). In the year
2010, the reports from china revealed the presence of predominant strain 2a and its close
resemblance with North Korean genotype. (Zhang et al., 2010b).
Since the virus undergoes frequent mutations, the currently available vaccine
which usually incorporates CPV2 strain may fail to control the infection (Nandi et al. 2010). The
first report of CPV from India was recorded from madras in 1981(Balu et al., 1981). Also, the
available information about epidemiology of this virus in India is negligible. The only report from
Haryana has been submitted from this laboratory suggesting high prevalence of CPV infection
and vaccine failure (Savi et al. 2007).
Various laboratory techniques were adopted for differentiation including virus
isolation, immune-chromatography test, enzyme linked immuno-sorbent assay (Teramoto et al.,
1984).The direct fluorescent antibody test, viral nucleic acid detection by nucleic acid

3
hybridization assay, serological tests including haemagglutination inhibition assay, conventional
and real -time PCR etc. were used for CPV diagnosis.
Polymerase chain reaction (PCR) was one of the sensitive molecular diagnostic
tool and have the ability to detect canine parvovirus in the clinical sample (Steven and Hodinka,
2000). Specific primer based DNA sequencing helps in distinguishing the antigenic variants.
Keeping the above perspective in mind, the present study will be carried out with
following objectives,
Objectives
1.Screening of diarrheic fecal samples of dogs by PCR for presence of canine parvovirus
(CPV).
2. Isolation of CPV from PCR positive field isolates in suitable cell cultures.
3. VP2 based genotyping of PCR positive samples of CPV

4
CHAPTER-II
REVIEW OF LITERATURE
Canine parvovirus found to be emerged in the late 1970’s, was highly contagious and mostly
affects the pups of new born to 6months of age. The virus cause high rate of morbidity and
mortality, with greenish diarrhea being clinical evident. The pathological finding includes
myocarditis and gastroenteritis, which were of typical for canine parvovirus infection. The
simultaneous infection with endoparasites of gastrointestinal origin, microbial loads such as
virus/bacteria also intensifies the disease condition. The ancestor for canine parvovirus was found
to be Feline panleukopenia virus (FPV). The new variant was named as canine parvo virus-2
(Truyen, 1996).
Later the first variant CPV-2 was slowly replaced by its new variant CPV 2a, the infective
agent for canines as well as felines. The amino acid variation between CPV 2a from its progenitor
CPV-2 includes 5, mostly occurs in the VP2 protein of capsid and these amino acids holds the
epitopes responsible for antigenicity, thus changes the host affinity of virus. CPV-2b, the other
variant was found in the year 1984. The new variant CPV-2b being the predominant strain along
with its former variant CPV-2a. One amino acid substitution at the major epitope A converting
Asn426Asp makes the new variant CPV-2b from its ancestor CPV-2 (Parrish et al., 1991). In the
recent of year 2001, one more new variant CPV-2c emerged with a single amino acid substitution
at the position of 426, replacing asparagines with glutamate from its ancestor CPV-2
(Buonavoglia et al., 2001). Typing of canine parvovirus isolates using mini-sequencing based
single nucleotide polymorphism analysis was performed to differentiate the genotypes (Naidu et
al., 2012).
2.1 Geographical spread of canine parvovirus variants
The epidemic nature of canine parvovirus found all over the globe. Highly responsible for
gastroenteritis infection in young pups ranges from newborn to 6 months of age. The evidence of
canine parvovirus infection was traced back to October 1976 in the country of Belgium, from
infected dog’s serum and the strain was named CPV-2. Later it also been noticed in other
countries including Belgium-1977, Denmark-1978, Australia-1978, USA-1978 and in Japan-
1979. The geographical spread of canine parvovirus was observed, when the virus isolate was

5
carried out in many parts of the globe. The CPV-2 was later replaced by its new variant CPV-2a
around 1980’s in USA (Parrish et al., 1985). The study of amino acid sequence comparison
revealed that CPV-2a differs from its ancestor CPV-2 by six amino acid variation.
In the recent years CPV-2a and CPV-2b were found in CPV isolates from the countries of
Switzerland, Austria, Germany and Italy. (Truyen et al., 2000). The amino acid variation of ser-
Val mutation was observed at amino acid 297. From a study conducted in the year of 2004 at
brazil, revealed 73.3% of strain were CPV 2a, 6 were CPV 2b- 8.95% and the result 12 were
found to be mutant at Glu-426 (Martella et al., 2004). In the year of 2010, from the country of
Thailand canine parvovirus epidemiological studies showed presence of CPV 2a (19 samples) and
CPV 2b (7 samples) from total of 26 samples by polymerase chain reaction (phromnoi et al.,
2010). The first report of CPV-2c was from Italy in the year 2000 (Martella et al., 2004) and
reported from other countries like western European countries, Asia and South America. Few
outbreaks of CPV-2c also been reported from Vietnam and Spain (Charles et al., 2007). From
north americaCPV-2c was reported in the year 2006 (Kapil et al., 2006). In the year 2010, the
reports from china revealed the presence of predominant strain 2a and its close resemblance with
North Korean genotype. (Zhang et al., 2010a).
2.1.1 Geographical spread of CPV in India
The first report of CPV from India was recorded from madras in 1981(Balu et al., 1981).
Epidemiological surveillance study using haemagglutination inhibition test (HI) was conducted
for 209 serum samples from the healthy dogs of Punjab districts. The results denoted the presence
of CPV infection32.1% from jalandhar, 47.1% from phagwara, 26.7% from hoshiarpur, 36.0%
from Chandigarh and 32.4% from Ludhiana respectively were positive and the average of 33%
from whole Punjab (Mohan et al., 1991).
2.2 Characteristic features of canine parvovirus
I. Classification
The first emergence of CPV-2 was first noticed in the year 1978 as an outbreak of world-wide.
Later it was found to be enzootic among the canine population world-wide. The canine parvo
virus-1/minute canine parvovirus which cause mild diarrhea was rule-out from suspecting canine
parvovirus infection, as the severity of infection was mild. Also its variation of antigenic and
genetic with canine parvovirus 2. The canine parvovirus belongs to the family parvoviridae

6
subfamily parvovirinae and the genus parvovirus. The bioinformatics study based on
Phylogenetic tree construction using full length genome and the study of open reading frames
revealed the presence of three evolutionary variant of parvoviruses infecting vertebrates includes
(1).human helper dependent adeno associated virus (AAV) 1 to 6 serotypes& autonomous avian
parvoviruses
(2).The bovine, chipmunk and autonomous primate parvo viruses, includes human parvo viruses
B 19 and V9.
(3).The rodent parvo viruses (chipmunks), carnivorous and pigs.
II. Structure of virus
The smallest DNA viruses with its outer capsid structure possess icosahedral symmetry with
diameter ranges between 18 and 26 nm. The virus was naked without envelope and the property
of viral DNA was linear, negative sense, single stranded and the whole size of 5.2Kbp. The outer
viral capsid holds 60 amino acid molecules of VP2 and the embedded VP1 amino acid molecules.
The pattern of division into two proteins was obtained by alternate splicing of single messenger
RNA. A minor protein of VP3 was formed by post translational modification and found in
completely developed virions (Parrish, 1999).
The outer capsid protein of 60 amino acid molecules contributed by VP2.The central structural
motif of VP2 is eight stranded antiparallel beta barrel. The geometrical possession of the
structure holds a 22 angstrom (A°) long protrusion on three fold axes, a 15 A° deep canyon
circulation about each of the five cylindrical structures at the fivefold axes and a 15 A° deep
depression at the two fold axes (Tsao et al., 1991). This cylindrical loop like structures stabilizes
the virus against environmental variation. The N- terminus of VP2 is identical in all CPV isolates
and the variety of host ranges from cats, mink and raccoons (Mizak et al., 2001).
III. Viral genome
The first study of viral genome was carried out using cloning and restriction enzyme analysis
(miller et al., 1986). The study revealed the 3’end of the genome shared similar structural
characteristics with limited homology of rodent parvo viruses. The whole genome organization
was similar with that of feline parvo virus (FPV), by which the two major open reading frames
(668 and 722 amino acids) are found in positive strand end of mRNA. The coding regions are

7
found in the single frame. The homology of CPV and FPV shares 98% with nucleotide and 99%
with that of FPV respectively. Hence the antigenic differentiation and the allied host range
specificity depend on the nucleotide or amino acid variation.
IV. Virus replication
The replication of canine parvovirus occurs in the nucleus of dividing cells. The cells which are
found in the late S or early G2 phase of the cell cycle are the target for canine parvo virus. The
virus invades the cell by binding to specific sialic acid containing oligosaccharides as receptor on
the surface of the cell. They travel through the cytoplasm to reach the nucleus by endocytic
pathway mediated clathrion coated vesicles by hacking host cells nuclear import machinery and
finally enter the nucleus through nuclear pore complex (Kasamatsu et al., 1998). The cellular
DNA polymerase enzyme was utilized for the synthesis of double stranded DNA from single
stranded viral DNA. The terminal 3’end of the genome which found as hair-pin like structure
serves the primer function for DNA synthesis and further elongation to replicative intermediate,
cross-linked at ends by terminal hair pin structure.
The synthesized DNA is then transcribed inside the nucleus by host cell DNA dependent
RNA polymerase II. The individual transcripts are then spliced to produce mRNA, which are
capped by polyadenylation and the final monocistronic viral mRNAs bind to ribosome and
proteins were translated eventually. Mature virions are released after post-translational
modification.
2.3 Clinical significance
The potential clinical signs include the acute form of canine parvovirus infection characterized by
myocarditis and sudden death of pups. The recovered pups show lesion in the myocardium
impairs the performance of the dogs and livability.
2.4 Pathogenesis
Canine parvovirus enters into the host by contact with contaminated inanimate objects,
fomites, food particles. The initial multiplication of virus occurs in the oro pharynx and later
spread haematogenously to lymph nodes, bone marrows and intestines. The viral particles found
in faecal matters from three days of infection and the clinical signs were noticed from 4 to 10
days of infection. The virus was noticed up to three weeks of infection followed by gradual

8
decline. Studies of pathogenesis of CPV-2 infected dogs were carried out using histopathological
studies and peroxidase anti-peroxidase staining techniques. Necrosis of lymphatic tissues and the
reduction in number of lymphocytes were noticed on 5th
and 6th
day of the i8nfection. The
intestinal epithelial cells show pathological changes on 6th
to 9th
day of infection. The intestinal
pathological changes were noticed mainly in peyer’s patches and tissues of upper segments of
small intestine. Lymphocytes being the primary target. The infected epithelial cells of crypts
found adjacent with peyer’s patches on the upper surface of small intestine.
2.5 Epidemiology
The nature of the canine parvovirus is highly contagious. The entry of infectious viral particles
mostly by contact with infected fomites. The virus shedding in the faeces was found to be
abundant and the viral particles were noticed all over the places. Among 128 dogs studied by
haemagglutination (HA) and haemagglutination inhibition (HI) studies the 78% of canine
parvovirus infection was found in less than 6 months of age. Mostly the non descript dogs were
more prone (Shukla et al., 2010).
2.6 Canine parvovirus seroprevalance
The seroprevalance of canine parvovirus infection among dogs from the samples collected in
Ontario were studied earlier between 1976 and 1980 by (Carman et al., 1984). Micro-titre
Haemagglutination inhibition assay was carried-out and the positive serum was found in January
1978 and high reports of antibody titre were reported later on. In North Korea (Yang et al., 2010)
performed seroprevalance studies among CPV2a infected dogs by haemagglutination inhibition
assay. From the total of 405 canine sera samples collected 93.8% were found to be positive, infers
high infectious rate of CPV-2a among stray dogs. Another study which conducted using
haemagglutination- inhibition test among 128 dogs, revealed 45.30% sero-positive cases and the
prevalence of was more among pups less than 6 months of age (78%). The breed wise prevalence
was noticed majority among Non-descript dogs (Shukla et al., 2010).
2.7 Diagnosis of parvo viral infection
The differential diagnosis to omit other causes of the bloody-diarrhoea by endo-parasites,
obstruction, entero-colitis, and other etiological factors had to be ruled out from primary cause.
Various laboratory techniques were adopted for differentiation including virus isolation, immune-
chromatography test, enzyme linked immuno-sorbent assay (Teramoto et al., 1984).The direct

9
fluorescent antibody test, viral nucleic acid detection by nucleic acid hybridization assay,
serological tests including haemagglutination inhibition assay, conventional and real -time PCR
etc. were used for CPV diagnosis. The degree of sensitivity, specificity and reproducibility
determines the appropriate method for CPV detection. To find the correlation, tests such as virus
isolation study (VI), immuno-chromatography study (IC), haemagglutination study (HA),
conventional and real-time PCR assay for diagnosis of CPV- infection in 89 dog faecal samples
with diarrhea were conducted (Decaro et al, 2007). The degree of detection found to be
41,50,54,68 and 73 for the sample by IC, HA, VI and conventional or real time PCR respectively.
Conventional and real time PCR was found to be having higher correlation of 94.38%.
2.8 Diagnosis based on conventional methods
2.8.1 Virus isolation
Virus isolation using cell culture was followed traditionally for CPV diagnosis. Some of the cell
lines used for virus isolation includes crandell rees feline kidney cell line (CRFK), Madin Darby
canine kidney cell line (MDCK),Walter reed canine cell line (WRCC) etc. primary cell lines from
canine kidney and lungs are also used. Medias like minimum essential medium (MEM), hanks
balanced salt solution (HBSS) are used for maintenance of cell lines along with various
concentrations of cell culture serum for growth medium (10%) or maintenance medium (2%).
The indication of presence of virus was observed by cytopathic effect (CPE) showing cells
rounding and with intra-nuclear inclusion bodies, also with detached cell population. The staining
of cell lines to observe granules also done. The drawbacks of cell lines were long time period to
culture the cell lines, expertise and absence or inactivated samples.
2.8.2 DETECTION OF VIRAL ANTIGEN
The viral antigens can be detected by immuno-fluorescence studies using immune beads (IB).
Enzyme conjugated antibodies were used as indicators of reaction for the detection of presence of
virus (Rivera & Karlsson, 1987). Immunochromatography studies were developed for the
detection of CPV in faeces by utilizing the virus property of haemagglutination. An experimental
study performed using Immunochromatography and haemagglutination test for 12 faecal samples
and confirmed for the virus presence in all samples (Branka et al., 2006). Demonstration of
antibodies against 18 amino acid peptide residue of NS1 protein raised in rabbit showed the
presence of viral antigen by immunofluorescence and western blotting (Ranta et al., 1996). In

10
North Korea, (Yang et al., 2010) conducted seroprevalance studies of CPV-2a. From the total of
405 canine sera samples collected 93.8% were found to be positive, infers high infectious rate of
CPV-2a among stray dogs. The drawback of parvo viral ELISA test is that it may give false
positive results for dogs vaccinated with live virus. Dot ELISA and sandwitch ELISA kits are
also available in the market for the detection of CPV.
2.8.3 VIRAL ANTIBODY DETECTION
Conventional serological studies can detect the presence of viral antibodies. Paired sera sample
collection implies the significant detection of viral antibody titre from infected dogs. Assay
developed based on the haemagglutination property of virus i.e. haemagglutination- inhibition
assay was best used for antibody detection in serum. The RBC’s of various species such as horse,
mouse, hamster, cat, sheep and dog agglutinated by CPV was demonstrated by (Senda et al.,
1986).
Dot-ELISA found to be more sensitive and specific in the detection of viral antibody in
comparison with other serological tests (Banja et al., 2002). Rimmelzwaan et al., 1991 developed
double antibody sandwich ELISA tests to detect CPV antibodies in faecal samples. ELISA was
found to be having 87% sensitivity and 100% specificity comparison with 87% and 63% of
haemagglutination test (HA) (Drane et al., 1994). The wider comparison studies between ELISA,
DNA hybridization, haemagglutination and electron microscopy was done and the higher
correlation (94.4%) was found with ELISA followed by haemagglutination studies (HA). Other
correlation between ELISA and DNA hybridization study (73.3%), ELISA and electron
microscopy (73.3%) implies ELISA can be used as sensitive and specific diagnostic assay for
canine parvovirus infections. The only drawback noticed with ELISA is limitation in vaccinated
pups, where the assay may yields false positive results at time.
2.8.4 NUCLEIC ACID BASED DETECTION METHODS
Some of the nucleic acid based detection methods including restriction fragment length
polymorphism (RFLP), nucleic acid hybridization studies, conventional and real time PCR are
used for CPV diagnosis. The tests were rapid and sensitive with high specificity.

11
I. POLYMERASE CHAIN REACTION
Karry mullis in the year 1985 discovered polymerase chain reaction (Lehninger et al., 2004). To
amplify a specific sequence of DNA with pair of oligonucleotide primers each about 18-30nt in
length and with optimized G+C content with the property of complimentarity to the DNA
sequence to be amplified. A standardized thermocyclic conditions for denaturation, primer
annealing and polymerization was used along with thermostable DNA polymerase enzyme. Mg2+,
dNTP’s, templates, primers, PCR buffers are used along with the enzyme. A standardized
annealing temperature had to be set according with the primer melting temperature. PCR enable
rapid detection of canine parvovirus with high sensitivity and specificity.
To detect CPV infection, nested PCR with double nested primer pair was used by (Hirasawa et
al., 1994) to intensify the sensitivity and specificity of the reaction.
(Nandi and Kumar., 2010) cell cultured the canine parvovirus in MDCK cell lines for isolation
and molecular characterization using polymerase chain reaction and restriction endo-nuclease
mapping. The inference of the study shows the rapidness and sensitivity of PCR techniques.
The first detection of CPV-2c was done using polymerase chain reaction (PCR) and RFLP.
Amplification of specific region of VP2 gene, restriction fragment length polymorphism (RFLP)
and nucleotide sequencing was carried out. The inference of the study revealed the
characterization of CPV-2c from 24 isolates and a single strain of CPV-2a (Perez et al., 2007).
Canine parvovirus was isolated using fibroma cell line A-72 and PCR was done for partial VP2
gene amplification. Restriction fragment length polymorphism was also carried out and the pre-
dominant strain isolated was CPV-2c from Uruguay (Pintos et al., 2011).
In India canine parvo viral vaccine strains were characterized based on DNA sequencing. The
major capsid protein coding genes VP1/VP2 was amplified and nucleotide sequencing was done
which then compared with amino acid sequences of field strain. The vaccine strain showed CPV-
2, whereas the field strain showed CPV-2b genotype. Hence the inference being difference in the
strain inculcated in vaccine from that of field isolates (Nandi et al., 2010a)
(Castro et al., 2010) collected samples between the years 1995 to 2009 and studied using PCR by
amplifying partial VP2 gene. The samples between the years 1995 to 2003 were identified as

12
CPV-2a, the samples from 2006 to 2009 characterized as 2b and the rest one found as CPV-2c in
the year 2008.
(Zhang et al., 2010a) done canine parvovirus characterization of field strains from china. He used
PCR and RFLP. The results inferred the predominant strain circulating was CPV-2b followed by
CPV-2a.
II. RESTRICTION FRAGMENT LENGTH POLYMORPHISM
In order to differentiate the other variants of CPV-2, the ancestors of CPV-2a, 2b and 2c,
Restriction fragment length polymorphism method was followed. CPV2a differs from its ancestor
by 5 to 6 amino acid, whereas the CPV-2b differs from its ancestor in a single epitope. The new
variant CPV-2c differs from CPV-2b by one nucleotide substitution at position 4064. Hence the
presence of polymorphism used for restriction site digestion by enzymes and profiling.
(Perez et al., 2007) detected the CPV-2c from South America based on PCR and RFLP. The
fragment holding the polymorphic region was targeted by PCR and amplified. Further Restriction
was done by enzymes and confirmed by DNA sequence analysis. In his studies out of 25 isolates
one was CPV-2a and rest 24 samples were CPV-2c, showed the current strain circulation.
Restriction fragment length polymorphism using RsaI I and HphI enzyme was done to find
variation between wild and vaccine strain. The result showed the vaccine strain was incorporated
with CPV-2 whereas the field strains were either CPV-2a/CPV-2b (Sakulwira et al., 2001).
The PCR and RFLP based canine parvovirus characterization of field strains from china was done
(Zhang et al., 2010a). The amplified product holds the site for MboII enzyme, thus differentiating
the CPV-2c from the rest. The results inferred the predominant strain circulating was CPV-2b
followed by CPV-2a.
III. NUCLEIC ACID HYBRIDIZATION ASSAY
A digoxigenin labeled probe has been developed complimentary to the DNA sequences of the
interest namely the capsid protein VP1 and partially the VP2 protein. The probes hybridize with

13
the formalin fixed virus from paraffin embedded tissue sections. The accurate result was observed
during inset hybridization. (Nho et al., 1997).
(Decaro et al., 2005) designed two minor groove binder (MGB) probe assays for the rapid
detection and quantification of CPV-2 mutants. The MGB probes labeled with different
fluorophores (FAM and VIC) identifies the single nucleotide polymorphism noticed between
CPV2b from CPV 2a and also between CPV 2c from CPV 2b.The results inferred high degree
reproducibility, sensitivity and specificity of the assay.
IV. PHYLOGENETIC ANALYSIS
(Doki et al., 2006) from Japan performed Phylogenetic construction of CPV type 2a and 2b
based on VP2 gene. The results were inferred that the newly isolated strains from Japan were
close resemblance with that of Taiwanese and of differ from that of Vietnamese isolates, united
state isolates, or classical CPV type 2.
(Nandi et al., 2010b) performed molecular characterization and nucleotide sequencing of canine
parvovirus strains of vaccines. Multiple sequencing against other reference strains of field isolates
from NCBI and the final Phylogenetic tree revealed that the vaccine strain and field strain were
formed separate Claude, thus differentiating the strain variation.

14
CHAPTER-III
MATERIAL AND METHODS
3.1 Sample collection:
Faecal samples were collected from various places nearby Hisar, Haryana including veterinary
college small animal clinics, New Delhi and Chandigarh. Total of 140 faecal samples were
collected from CPV suspected dogs along with their records of age, sex, clinical and vaccination
history. Faecal samples were collected in sterilized screw-capped cotton swab tubes contained
10% PBS and preserved in Ice pack.
3.2 Sample processing:
The suspended faecal samples were made 10% suspension with lysis buffer and centrifuged for
10,000×g for 15mins (REMI Cooling Centrifuge CPR 24) to remove cellular debris & solid
particles. The resultant suspension devoid of aforesaid was stored at -20ºc for further use.
3.3 Viral genome extraction:
Viral DNA was extracted using DNAZol kit method as per manufacturer’s instruction with slight
modifications. To the 10µl of clarified faecal sample, added 100µl of DNAZol reagent contained
in 1.5ml eppendorf tube. Followed by vortex and short spun, the mixture was incubated at RT for
10 mins. Further it has been incubated at 80ºc in water bath for 40 mins. After the given period
the supernatant containing lysate was discarded following vortex and short spun. The final
resultant was stored at -20ºc for further use.
3.4 Screening of the samples based on partial VP2 gene specific primers:
The partial VP2 gene specific PCR assay was standardized with corresponding consensus primers
to amplify the desired length (747bp) of product.

15
The PCR assay was carried out using the published partial VP2 gene specific primers (Sakulwira
et al., 2001). The following PCR reaction mixture (12.5µl) was prepared as per standardized
protocol.
Table 3.1 standard reaction mixture for partialVP2 sequencing
The reaction content was mixed by vortex/short spun for 10 secs and kept in the thermocycler
(Eppendorf Master Cycler Gradient TM, Germany) for approximately 30 cycles.
Fig 3.1: Optimized thermocyclic conditions for partial amplification of 747 bp VP2 gene
10× PCR buffer 1.25µl
10 mM dNTP’s 0.25µl
Forward primer 0.15µl (15 pmol)
Reverse primer 0.15µl (15 pmol)
Taq DNA polymerase 0.2µl
NFW 8.5 µl
DNA template 2.0 µl
TOTAL 12.5 µl
50sec
10min1min5min
52°
94° 94°
72°
72°
4°30sec

16
Table 3.2: Primers used for amplification of partial 747 bp VP2 gene
PRIMER SEQUENCE POSITION EXPECTED
SIZE
Primers
P1F
R
TCCAGCAGCTATGAGATC
GATCTGTTGGTAGCAATAC
3342-3360
4070-4088 747bp
I. Agarose gel electrophoresis
The amplified products were visualized and confirmed by agarose gel electrophoresis. 1%
agarose gel was prepared by weighing 0.5gms of agarose & dissolved in 49ml of water along
with 1ml of 50× TAE. Followed by boiling in microwave Owen, ethidium bromide at the volume
of 2.5µl/50ml was added, when the content reached Luke warm. It was then cast into the gel tray
along with combs for solidification.
The gel tray after the removal of combs was kept inside the electrophoresis
apparatus (Biometra USA). The apparatus was filled with 1× TAE running buffer sufficient
enough to submerge the gel tray. About 10% of the PCR product (3µl) along with 1µl of 6×
loading dye was mixed and loaded into the wells along with a 100bp Marker. Electrophoresis was
carried out at the voltage of 12V/cm with the help of voltmeter (Biometra, USA) till the dye
reached 1/3 rd of the gel. The resolved bands were visualized under UV Transilluminator (Biovis
Gel Documentation system) and stored digitally.
3.5 Genotyping of canine parvo virus
For the classification of two different genotypes of CPV, genotype specific published primers
were used (Costa et al., 2005).The PCR reaction mixture for 12.5µl was made as per the
table below, optimized by various standardization protocols.

17
Table 3.3: Standard reaction mixture for genotype specific PCR
Fig 3.2: Optimized PCR condition for genotyping of field samples of CPV
Table 3.4: List of genotype specific primers
PRIMER SEQUENCE POSITION PRODUCT
SIZE
P2abS GAAGAGTGGTTGTAAATAATT 3025-3045 681
P2abAS CCTATATAACCAAAGTTAGTAC 3685-3706
P2bS CTTTAACCTTCCTGTAACAG 4043-4062 427
P2abs CATAGTTAAATTGGTTATCTAC 4449-4470
10× PCR buffer 1.25µl
10 mM dNTP’s 0.25µl
Forward primer 0.15µl (15 pmol)
Reverse primer 0.15µl (15 pmol)
Taq DNA polymerase 0.2µl
NFW 8.5 µl
DNA template 2.0 µl
TOTAL 12.5 µl
50sec
10min1min5min
55°
94° 94° 72° 72°
4°
30sec

18
The amplified products of 681bp & 427 bp were confirmed under UV Transilluminator after
electrophoresis in 1% agarose gel.
3.6 Differentiation between vaccine strain and field strain:
The strain variation between vaccine and field strain was carried out by Restriction Fragment
Length polymorphism (RFLP). Before proceed into the wet lab experiment, an In-silco restriction
enzyme profiling was done.
3.6.1 Insilco restriction enzyme profiling:
The 747 bp amplified product was used for Insilco study. Reference sequences for vaccine and
field strains were retrieved from the NCBI and loaded into the Insilco Restriction enzyme
profiling simulators (snap gene software) & the resultant profiles were recorded
3.6.2 Wet-lab restriction enzyme profiling:
The template DNA concentration of amplified 747 bp was measured using Nano drop method to
determine the required quantity of template for restriction digestion. RsaI (New England Biolabs)
was used for template digestion. The standardized reaction mixture of 20µl was made after
various level of standardization.
3.6.3 RsaI enzyme cut sites
5'...GT↓AC...3'
3'...C A↑T G...5'
Table 3.5: Reaction mixture for restriction enzyme digestion
DNA template 15µl
Restriction enzyme buffer 10×
(Tango buffer)
1µl
RsaI restriction enzyme 1µl
Nuclease free water 3 µl
TOTAL 20 µl

19
The reaction mixture was made in a PCR tube and mixed by vortex/short spun. Incubation was
carried out at 37ºc for 2hrs. At the end of given time, the reaction was stopped by heat killing at
90ºc for 10mins. The resultant digested products were resolved in 4% agarose gel electrophoresis.
3.7 Whole genome amplification and sequencing
The amplification of complete coding sequence of canine parvovirus genome was attempted and
results were obtained. Primers were designed based on the pick-primer software available in the
NCBI BLAST. Primers were made overlap with their forward and reverse sequence to attain the
maximal coding sequences.
Table 3.6: List of primers for complete genome sequencing
Primer Sequence (5’-3’) Length Start Stop Tm GC%
P1 F ACGGCAGTCACACGTTCATAC 20 67 86 52.20 50.00
R TGGTCCATTGCTGTTTGTGC 20 477 458 51.69 52.63
P2 F GACTAACCAACCATGTCTGGC 21 260 280 53.12 52.38
R CACCCATTCACTATCTTCTGC 21 826 806 51.69 52.63
P3 F ATGGGGAAAAGATCAAGGCTGGC 23 634 656 57.31 52.17
R TCACCTCCTGGTTGTGCCATCA 22 1233 1212 57.82 54.55
P4 F TGGCAGCACACTTTACACTGAACA 24 1015 1037 55.30 48.00
R TTGTTGACCAAAGTTACCAGCTTC 24 1627 1602 54.08 43.00
P5 F TGA TGG CAC AAC CAG GAG GT 20 1212 1231 53.8 55.00
R AAC CAA AGT CTC CTG GAA GC 23 1828 1847 51.8 50.00
P6 F CCA TAG CAC AAG CTG TGG GT 20 1506 1525 53.8 55.00
R GCA GTT TCT GCA ATA GGC GT 20 2120 2139 51.8 50.00
P7 F GAAGACTTTCGAGACGACTTGGAT 24 2252 2275 54.76 45.83
R CCTCCAGACCCGTTCCCA 18 2871 2854 54.72 66.67
P8 F GCCGGTGCAGGACAAGTAAA 20 2747 2766 55.10 55.00
R TGCCACTAGTTCCAGTATGAGATGG 25 3467 3443 55.88 48.00
P9
R
AGTCTGCTACTCAGCCACCAACA 23 3249 3271 57.69 52.17
CTTGGATCACCATCTGCTGCTTGA 24 3915 3892 57.23 50.00

The reaction mixture was made as per the standardized protocol (table 3.7)
Table 3.7:
Fig 3.3
F
P10 F
R
P11 F
R
P12 F
R
Table 3.7: Standard
Fig 3.3: Optimized cyclic conditions for whole genome amplification:
P10 F CGTGGTGTAACTCAAATGGGA
R TGGATTCCAAGTATGAGAGGCT
P11 F CCACCAGTTTATCCAAATGGTC
R CAACCAACCACCCACACC
P12 F AGCTTCCAGGAGACTTTGGTTTGGT
R TTGCAGCGGCGTCAGAAGGG
10× PCR buffer
10 mM dNTP’s
Forward primer
Reverse primer
Taq DNA polymerase
NFW
DNA template
TOTAL
tandard PCR reaction mixture for whole genome amplification
Optimized cyclic conditions for whole genome amplification:
CGTGGTGTAACTCAAATGGGA
TGGATTCCAAGTATGAGAGGCT
CCACCAGTTTATCCAAATGGTC
CAACCAACCACCCACACC
AGCTTCCAGGAGACTTTGGTTTGGT
TTGCAGCGGCGTCAGAAGGG
10× PCR buffer
10 mM dNTP’s
Forward primer
Reverse primer
Taq DNA polymerase
DNA template
reaction mixture for whole genome amplification
CAACCAACCACCCACACC
TTGCAGCGGCGTCAGAAGGG
1.25µl
0.25µl
0.15µl (15 pmol)
0.15µl (15 pmol)
0.2µl
8.5 µl
2.0 µl
12.5 µl
20
0.15µl (15 pmol)
0.15µl (15 pmol)
21 3725
22 4426
22 4166
18 4949
25 1827
20 2474
3725 3745 52.41
4426 4405 52.59
4166 4187 53.00
4949 4932 52.60
1827 1851 58.26
2474 2455 59.97
52.41 47.62
52.59 45.45
53.00 43.00
52.60 61.00
58.26 48.00
59.97 65.00
47.62
45.45
43.00
61.00
48.00
65.00

21
PCR was performed with above said optimized reaction mixture and thermocyclic conditions for
40 cycles. The annealing temperature was standardized for each primer and set for 50 secs (table
3.8). The amplified products were resolved in 1% agarose gel.
Table 3.8: Primer annealing temperature used for amplification of whole length coding
sequences:
PRIMER ANNEALING TEMPERATURE
P1 47.4
P2 47.1
P3 54.5
P4 48.4
P5 47.1
P6 47.1
P7 54.7
P8 49.4
P9 54.7
P10 46.8
P11 46.8
P12 54.4
3.8 cloning of the PCR products
Cloning of the Partial length VP2 genome and terminal genes of the whole genome was
performed to put for sequencing. The cloning kits used were CloneJETTM
PCR cloning kit
(Fermentas) and as per the product usage instruction, cloning was performed to achieve maximal
positive clones.
a. Vector
The pJET1.2/blunt cloning vector (2961 bp) supplied with CloneJETTM
PCR cloning kit
(Fermentas) was used for the cloning.

22
b. Host system
The DH5α strain of Escherichia coli maintained in the department was used as a host system for
transformation with recombinant plasmid vector
c. Cloning strategy
The cloning strategy was followed as per the product manufactures protocol (fig 3.4)
I. Gel purification of PCR product
Amplified product was purified using gel purification kit (QIAGEN). Instructions were
followed as per the manufactures protocol briefed below.
The amplified product was electrophoresed at high quantity to achieve maximal
concentration. Followed by the electrophoresis, the desired DNA fragment was excised from the
agarose gel with a clean, sharp scalpel and transferred to a pre-weighed 1.5ml eppendorf tube.
The eppendorf tube contained gel fragment was weighed and deducted from its original
weight. 3 volumes of buffer QG from the kit was added to the 1 volume of gel
(100mg~100µl).The tube were incubated at 50ºC for 10mins till the gel has completely dissolved.
To that 1 gel volume of isopropanol was added and mixed. To bind DNA to the column, the
sample was applied to the QIAquick spin column along with 2ml collection tube (supplied with
the kit)followed by centrifugation at 13,000rpm for 2min.The flow- through was discarded, then
applied 500µl of buffer QG and centrifuged at 13,000rpm for 2mins. To wash, 750µl of buffer PE
was added and allowed to stand for 5min, followed by centrifugation at 13,000rpm for 2mins.
Residues were completely discarded and the column was placed inside a fresh 1.5ml eppendorf
tube for elution. To elude the DNA, 30µl of buffer EB was added to the centre of the column and
allowed to stand for 10mins, followed by centrifugation at 13,000rpm for 2mins. The final eluded
DNA was confirmed for its presence by agarose gel electrophoresis.
II. Setting of blunting reaction
Sticky end cloning protocol was followed for two of the amplified products since the
PCR products to be cloned were amplified using enzyme Taq DNA polymerase which creates 3’
overhangs. Blunting enzyme supplied along with the kit was used to set up the blunting reaction
to generate blunt ends of the PCR products. Blunting reaction contained the following:
Blunting reaction for 411bp amplified product
2 X reaction buffer : 10 µl
PCR product : 3 µl

23
Nuclease free water : 4 µl
DNA blunting enzyme : 1 µl
Total volume : 18 µl
Blunting reaction for 618bp product
PCR product : 3 µl
DNA blunting enzyme : 1 µl
The blunting reaction mixture was vortexed and short spun for 5 secs. The mixture was
incubated at 70°C for 5 minutes in thermocycler followed by chilling on ice.
III. Ligation of the blunt end PCR product with cloning vector
T4 DNA ligase was used to ligate the blunted PCR product with the pJET1.2 vector.
Ligation reaction was done as follows for both the products (411bp and 618bp)
PJET1.2/blunt cloning vector : 1 µl
T4 DNA ligase : 1 µl
Blunting reaction mixture : 18 µl
IV. Blunt end cloning protocol
Ligation reaction for a PCR product of 427bp amplified using phusion taq (Thermo scientific)
was done. As the enzyme holds the property of proof reading, the product was directly put for
ligation reaction. Ligation reaction was carried out as follows,
PCR product : 1 µl
PJET1.2/blunt cloning vector : 1µl
T4 DNA ligase : 1µl
Total volume : 20µl

24
The mixture was mixed carefully with the pipette tip and kept for incubation at 22ºC for 30mins
in thermocycler.
V. Transformation of the recombinant vector
The refrigerated stock of 100µl DH5α strain was cultured in10ml of Luria bertani broth for
5hs. After the given time 100 µl cells from the 5hrs incubation was transferred to 10ml of the LB
medium, to synchronise the bacterium at log phase of growth. At the end of given period 1ml of
the culture was taken in a 1.5ml eppendorf tube & short-incubated for 10mins in the ice. After
incubation the Culture was centrifuged at 2700rpm for 5mins at 4°C.The supernatant was
discarded and the pellet was air-dried under sterile conditions. The pellet was then resuspended in
0.6 vol (600µlof ice-cold 0.1M CaCl2 and 0.1M MgCl2 at the ratio of 1:4, followed by gentle
vortex and finger flick. Incubate on the ice for 20mins. Centrifugation at 1800rpm for 8min at
4°C was done after the incubation. The supernatant was discarded and the pellet was resuspended
in 0.5vol (500µl) of ice cold 0.1M CaCl2, mixed by finger flick. Centrifugation was carried out at
1800 rpm for 8min at 4C. The supernatant was discarded completely and the pellet was
resuspended in 1/10th
vol (100 µl) of ice cold 0.1M CaCl2, thus making the cells competent. The
ligated mixture at the volume of 1 µl was added to the competent cell& distributed to 8 eppendorf
tubes& incubated in ice for 10mins. For the uptake of cloned product into the cells, heat shock
method was followed; thereby the mixture of competent cells with ligated cloned product was
Fig 3.4: Cloning strategy of PCR products in pJET1.2/blunt cloning vector
411 bp & 618bp of CPV
PCR amplification
Purification
polishingOpen circular plasmid
Blunt end ligation

25
treated for 42°C temperature in waterbath for 40 secs. Again the cells were incubated in the ice
for 20mins. At the end of incubation, the cells were brought to the RT and added 80 µl of LB
broth, followed by incubation for 1hr. after the given time, the whole content was poured inside
the LB plates containing ampicillin as markers and spread uniformly. The plates were kept
inverted in the incubator at 37°C for overnight and observed for the presence of recombinant
colonies.
VI. Selection of recombinant clone
(i) Positive selection
Recircularized pJET1.2 cloning vector expresses a lethal restriction enzyme if
transformation is not propagated. As a result, only the recombinant clones containing the insert
appear on the culture plates.
(ii) Touch PCR
The primer pairs corresponding to the PCR product of interest were used for touch PCR.
The bacterial cells from the colonies were suspended in 30µl of LB medium with the help of
sterilized pipette tip and boiled at 99°C for 5mins in the thermocycler, followed by vortex and
spun for 2mins. 2μl of supernatant was taken as DNA source for PCR. PCR was performed using
the cycling conditions standardized for VP2 gene. The PCR products were analyzed by AGE in
1% gel.
VI. Isolation of plasmid by alkaline lyses method
The colonies found in the LB plates were picked using pipette tips and transferred to the
LB broth contained ampicillin for incubation overnight in the orbital shaker at 150rpm at 37°C.
Turbidity implies the presence of bacteria and was taken for the plasmid isolation.
Minipreparation method described by Sambrook and Russell (2001) was followed for plasmid
isolation with fewer modifications. 6ml of overnight grown bacterial culture was pelleted by
centrifugation at 14000rpm forAfter discarding the supernatant; the pellet was resuspended in
0.25 volumes of sodium chloride-tris-EDTA (STE) and centrifuged again at 14000 rpm for 3
minutes. The supernatant was discarded completely. The pellet was resuspended in 100µl,
followed by vigorous vortex to mix. To this, 200 l of ice cold freshly prepared ALS-II was
added and mixed by gently inverting the tube for five times and kept for incubation on ice for 5
minutes. After adding 150 l of ice cold ALS-III to the mixture, the tube was gently inverted
several times, kept on ice for 5 minutes and centrifuged at 10000 rpm for 5 minutes at 4ºC. The

26
supernatant was aspirated without disturbing the white precipitate and transferred to fresh
eppendorf tube. The plasmid was precipitated by adding equal volumes of isopropanol and
incubated for overnight at -20°C.Following the incubation; centrifugation was done at 14000 rpm
for 15mins to isolate the plasmid. After air drying, the plasmid was suspended in the NFW of
30µl to attain higher concentration of genome. The presence of plasmid was confirmed by
electrophoresis of plasmid (3µl) along with 1µl of 6X loading dye in 0.7% agarose gel.
vii. Restriction Enzyme digestion of plasmids
The presences of inserts were confirmed by RE digestion of plasmids. In-silico cloning was done
by insertion of reference sequence from NCBI at the clone insert position of vector sequence (371
to 372). The ligated sequence was then RE profiled using RsaI and PstI enzymes.
I. RsaI re profiling
RsaI enzyme cuts each one site from vector and insert was simulated In-silico, confirmed by wet
lab experiment
RsaI enzyme cut sites
5'...GT↓AC...3'
3'...C A↑T G...5
Table 3.9 reaction mix for RsaI enzyme plasmid digestion:
II. PstI RE PROFILING:
PstI enzyme got a single site at vector and absence of any site at insert, generated a linear
fragment after restriction digestion.
Plasmid DNA 5µl
RsaI enzyme 1 µl
Tango buffer with BSA 1µl
NFW 3 µl
TOTAL 10 µl

27
PstI CUT SITES
5'...CTGCA↓G...3'
3'...G↑A C G T C...5'
Table 3.10: reaction mix for PstI enzymes plasmid digestion:
VII. PCR of plasmid DNA with insert specific primers:
The plasmid DNA of positive clones was subjected to PCR amplification using corresponding
gene specific primers. PCR was performed and the products were analyzed using 1.0% gel
3.11 Isolation of parvovirus in Madine Darby Canine Kidney Cells
About 100 l of fecal sample is taken and diluted to 1.5 ml using phosphate buffer
solution. Then it is filtered through 0.45 mm Millipore filter. About 1 ml of the filtrate is used for
infecting 60% confluent cell line in 25 cm2
flask The tissue culture flasks were incubated at 37 °C
for 1 hour with intermittent shaking at every 10 minutes. After incubation, maintenance medium
containing 2 % serum was added. The flasks were then placed back in BOD at 37°C temperature
and examined for cytopathic effect (CPE) of the virus in 24 hrs, 48 hrs and 72 hrs, respectively.
3.12 Harvesting of virus
When almost 70 to 80 per cent of the monolayer got detached after infection, the flasks were
shaken to detach cells from surface and the cultures were subjected to three cycles of freezing and
thawing. Then the contents were transferred from the tissue culture flask to a 15 ml centrifuge
Plasmid DNA 5 µl
PstI enzyme 1 µl
Tango buffer with BSA 1 µl
NFW 3 µl
TOTAL 10 µl

28
tube and centrifuged at 2000 rpm for 10 minutes to remove the cellular debris. The supernatant
containing the virus was removed to a fresh tube and stored at -20°C and used as inoculums for
subsequent passages.
3.13 Automated nucleotide sequencing
The clones which were found positive by touch PCR for the specific insert and some
purified PCR products were given for sequencing. The vector specific primer (pJET1.2 forward/
pGET1.2 Reverse) was used for sequencing using automated DNA sequencer, Applied Biosystem
3130 XL Genetic Analyzer at Department of Animal Biotechnology, College of Veterinary and
Animal Sciences, LLRUVAS, Hisar (Haryana).
3.14 Nucleotide sequence analysis
The obtained nucleotide sequences were assembled using DNA baser software for the
contigs preparation and analyzed for their percentage identity by BLASTn.
3.15 Multiple sequence alignment
Multiple sequence alignment was performed using CLUSTALX software with the other
strains from various geographical origins nearby India and few strains from western origin.
3.16 Phylogenetic analysis
Phylogenetic tree was constructed using MEGA 4.0 software.

29
CHAPTER-IV
RESULTS
4.1 Sample collection
Total of 140 samples were collected from CPV suspected dogs. Out of the 140 total samples, 72
(51%) samples were found to be positive based on partial VP2 screening. Positive samples along
with their history were shown in the table 4.1
Table 4.1a: Source of canine parvovirus positive field isolates
Source of
samples
Number of
samples
+ve
Genotypes
(no.)
Total
+ve (%)
LLRUVAS
clinics
24 CPV2a (3) 33
CPV2b
(21)
Delhi 22 CPV2a (4) 30.55
CPV2b
(18)
Chandigarh 26 CPV2a (3) 36.11
CPV2b
(23)

30
4.2 Screening of the samples based on partial VP2 gene specific primers
The partial VP2 gene specific PCR assay was standardized with corresponding consensus primers
to amplify the desired length (747bp) of product. Out of 140 samples collected 72 (51%) samples
were found to be positive based on partial VP2 gene screening fig 4.1.
4.3 Genotyping of canine parvovirus
For the classification of two different genotypes of CPV 2a and CPV 2b, genotype specific
primers (published) by Costa et al. (2005) were used. A total of 72 positive samples
screened by partial VP2 gene specific primers, 62 were (82%) found to be 2b and the
rest of 10 (18%) falls under 2a (fig 4.2 and fig 4.3).
4.4 Differentiation between vaccine strain and field strain
The strain variation between vaccine and field strain was carried out by Restriction Fragment
Length Polymorphism (RFLP). Before proceed into the wet lab experiment, an In silico
restriction enzyme profiling was also done.
4.4.1 In silico restriction enzyme profiling: The 747 bp amplified product was used for Insilco
restriction enzyme profiling. Reference sequences for vaccine and field strains were retrieved
from the NCBI and loaded into the Insilco restriction enzyme profiling software (SNAP GENE
SOFTWARE) & the resultant profiles were observed and images were obtained (fig 4.4).

31
Table 4.1: DETAILS OF CANINE PARVO VIRUS POSITIVE FIELD ISOLATES
S.NO AGE SEX BREED GENERAL & VACCINATION HISTORY GENOTYPE
1 M mix Haemorrhagic gastro enteritis (HGE) NV 2b
2 32 days M Golden retriever NV 2b
3 2 months M Labrador Haemorrhagic gastro enteritis NV 2b
4 6 months M spitz Haemorrhagic gastro enteritis NV 2b
5 M mix Haemorrhagic gastro enteritis NV 2b
6 3 months M mix Haemorrhagic gastro enteritis NV 2b
7 50 days M mix Gastro enteritis NV 2b
8 6 months F spitz Haemorrhagic gastro enteritis NV 2b
10 8 months F Field spaniel Haemorrhagic gastro enteritis NV 2b
11 M Labrador Haemorrhagic gastro enteritis NV 2b
12 M Rottweiler Haemorrhagic gastro enteritis NV 2a
14 50 days M labrador Suspected for CPV and CD NV 2b
15 7 yrs M Lhasa apso Haemorrhagic gastro enteritis NV 2b
16 3 months spitz suspected for CPV and HGE NV 2b
17 3 months M Labrador Canine parvovirus infection NV 2b
18 M Lab mix breed Haemorrhagic gastro enteritis NV 2b
19 30 days M German shepard Suspected for CPV and enteritis NV 2b
20 M labrador Haemorrhagic gastro enteritis NV 2a
21 4 months mix Haemorrhagic gastro enteritis NV 2b
22 3 months Haemorrhagic gastro enteritis NV 2b
23 5 months M mix NV 2b
24 5 months F labrador Haemorrhagic gastro enteritis NV 2b
25 2 yrs M mix NV 2b
26 2 months M labrador NV 2b
28 3 months M Haemorrhagic gastro enteritis NV 2b
30 4 months mix Haemorrhagic gastro enteritis NV 2b
31 40 days M mix Haemorrhagic gastro enteritis NV 2b
32 50 days M St. Bernard Haemorrhagic gastro enteritis NV 2b
33 2 months M Labrador Suspected for CPV and enteritis NV 2b
34 2 months F Lab mix breed Haemorrhagic gastro enteritis NV 2b
35 3 months M German shepard Haemorrhagic gastro enteritis NV 2b
36 M labrador Haemorrhagic gastro enteritis NV 2b
37 mix Haemorrhagic gastro enteritis NV 2b

32
S.NO AGE SEX BREED GENERAL & VACCINATION HISTORY GENOTYPE
38 4.5 yrs F mix Diarrhoea and vomition NV 2a
39 1.5 yrs M German shepherd Diarrhoea and vomition 2b
40 3 months F Rottweiler vaccinated 2a
41 4 months F mix anorexia NV 2b
42 F 2b
43 3 months F German shepherd NV 2b
44 11 yrs F St. Bernard Diarrhoea since 2days NV 2b
45 6months F NV 2b
46 2.5 months F Haemorrhagic gastro enteritis NV 2b
47 1yr M Haemorrhagic gastro enteritis NV 2b
48 M Haemorrhagic gastro enteritis NV 2a
49 M Field spaniel Haemorrhagic gastro enteritis NV 2b
50 4 months M Labrador NV 2b
51 M Rottweiler NV 2b
52 M mix Diarrhoea and vomition NV 2b
53 3months M labrador NV 2b
54 M Lhasa apso NV 2a
55 6months M spitz Diarrhoea and vomition NV 2b
56 M Labrador Haemorrhagic gastro enteritis NV 2b
57 6 yrs M Lab mix breed Diarrhoea and vomition NV 2a
58 M Diarrhoea and vomition NV 2b
59 M Field spaniel Haemorrhagic gastro enteritis NV 2b
60 4months M mix Haemorrhagic gastro enteritis NV 2b
61 M mix Haemorrhagic gastro enteritis NV 2a
62 F mix Haemorrhagic gastro enteritis NV 2b
63 3yrs F mix Haemorrhagic gastro enteritis NV 2b
65 M mix Haemorrhagic gastro enteritis NV 2a
66 M Labrador Diarrhoea and vomition NV 2b
67 8 months F Rottweiler Diarrhoea and vomition NV 2a
68 2 yrs F mix Haemorrhagic gastro enteritis NV 2b
69 1.5 months M labrador Diarrhoea and vomition NV 2b
71 1 month F Lab mix breed Diarrhoea and vomition NV 2b
72 4months F Haemorrhagic gastro enteritis NV 2b

Fig 4.2: genotyping of CPV isolate
vaccine lane 1: field samples
500b
1kb
681bp
M 1 2 3 4
500b
1kb
681bp
Fig 4.1: 747bp Product amplified by partial
M-100bp Marker, lane 1: control, lane 2: vaccine lane 3 to 5: field samples
1 2 3 M
M 1 2 3 4
100bp Marker, lane 1: control, lane 2: vaccine lane 3 to 5: field samples
1 2 3 M
Fig 4.2: genotyping of CPV isolate 2a/2b;
M 1 2 3 4
1 2 3 M
; Lanes: M-100bp Marker, lane 3: control, lane 2:
M 1 2 3 4
Fig 4.1: 747bp Product amplified by partial VP2 gene specific primers
1 2 3 M
100bp Marker, lane 3: control, lane 2:
M 1 2 3 4 5
gene specific primers
1 2 3 M
747bp
gene specific primers of CPV isolates
500
of CPV isolates

M 1 2 3 4 5
500 bp
427 bp
Fig 4.4: Insilco RE of 747bp amplified product, M-100bp Marker, lane 1: undigested 747bp
product, lane 2: vaccine digested to give548, 149 and 50bp products: lane 3& 4: field isolates
digested to give 402bp, 148 and 145bp 50 bp products.
Fig 4.3: genotyping of CPV isolate 2b, lanes: M-100bp Marker, lane 1: control, lane 2: vaccine lane 3 to 5: field
samples

33
4.4.2 Wet-lab restriction enzyme profiling
The template DNA concentration of amplified 747 bp was measured using Nano drop method
(Table 4.2) to determine the required quantity of template for restriction digestion. Restriction
enzyme RsaI (New England Biolabs) was used for template digestion. The resultant digested
products were resolved in 4% agarose gel electrophoresis.
The RsaI enzyme digested the 747bp product, gave four different products of sizes: 50bp, 146bp,
149bp and 402bp, respectively, whereas the 747bp PCR product obtained from vaccine strain
gave only three products of 50bp, 149bp and 548bp, respectively (fig.
4.5).
4.5 Whole genome amplification and sequencing
The amplification of complete coding sequence of canine parvovirus genome was attempted and
results were obtained. Twelve sets of primers were designed based on the pick-primer software
available in the NCBI BLAST. Primers were made overlap with their forward and reverse
sequence to attain the maximal coding sequences.
PCR was performed with optimized reaction mixture and thermocyclic conditions for 40
cycles. The annealing temperature was standardized for each primer and set for 50 secs. The
amplified products were resolved in 1% agarose gel (fig. 4.6).
Table 4.2: Nanodrop quantification DNA templates
Sample ID ng/µl µg/µl
vaccine 21.9 0.0219
3 68.6 0.0686
15 45.0 0.045
18 42.9 0.0429
22 30.8 0.0308

500b
Fig 4.5
to give548, 149 and 50bp products: lane 3& 4: field isolates digested to give 402bp, 148 and
145bp 50 bp products.
50 bp
148 bp
548 bp
500 bp
500b
Fig 4.5: wet lab RE, M
Fig 4.6: whole genome amplification
technique. M
10: primer 12
50 bp
148 bp
548 bp
500 bp
M 1 2 3 4
: wet lab RE, M-100bp Marker, lane 1: undigested 747bp product, lane 2: vaccine digested
: whole genome amplification
technique. M-100bp Marker, lane 1to 9: Amplified primer products by primers 2 to 10, lane
10: primer 12th
amplified product.
M 1
M 1 2 3 4
100bp Marker, lane 1: undigested 747bp product, lane 2: vaccine digested
: whole genome amplification
00bp Marker, lane 1to 9: Amplified primer products by primers 2 to 10, lane
amplified product.
1
M 1 2 3 4 5 6
: whole genome amplification of CPV field isolate (sample no; 915/H)
2
6 7 8 9
of CPV field isolate (sample no; 915/H)
2 3 4
7 8 9 10 M
of CPV field isolate (sample no; 915/H)
4
148 &145 bp
403 bp
10 M
500b
of CPV field isolate (sample no; 915/H) by primer walk
148 &145 bp
403 bp
500bp
by primer walk

34
4.6 Cloning of PCR product
The PCR products were cloned using pJET1.2/blunt end cloning vector and are used to transform
competent E. coli cells. The transformed cells along with ligated inserts were inoculated into the
LB plates containing ampicillin as selectable markers. The plates incubated at inverted position in
the BOD incubator at 37°C for overnight. The colonies formed after the given period was
considered as recombinant clones, as the un inserted plasmids were unable to detect in the plates.
(Fig 4.7)
4.7 Touch PCR
Touch PCR was performed for 40 to 50 picked colonies from each plate using the
corresponding primers and the products viewed in UV transillumination (Fig. 4.8 and 4.9). This
confirmed the presence of insert in the colonies.
4.8 Isolation of plasmids from recombinant clones by alkaline lysis method
The clones with insert yielded various forms of plasmids viz. coiled, super coiled open
and circular that migrated at different speeds in 0.7 per cent agarose gel (Fig. 4.10).
4.9 Isolation and propagation of canine parvovirus in Madine Darby Canine Kidney Cell
Line (MDCK)
Out of 72 samples which were screened positive for parvovirus, 5 were selected for isolation and
propagation in MDCK cell line (Fig. 4.17). The filtrate obtained after filtering through Millipore
filter acted as inoculum for infecting 60% confluent cell line inoculum containing only PBS
served as negative control.
4.9.1 Cytopathic effect:
Cytopathic lesions were not found inferred the virus inactivation.

Fig. 4.8
Lanes M: 100bp DNA ladder (Biogene);
Fig 4.7: Screening of positive recombinant clones of partial
plates with ampicillin as selective marker
500 bp
Fig. 4.8: Agarose gel electrophoresis (1%) showing
M
Agarose gel electrophoresis (1%) showing
M 1
Agarose gel electrophoresis (1%) showing
Lanes M: 100bp DNA ladder (Biogene); 1 to 4: Positive clones.
1 2
Agarose gel electrophoresis (1%) showing amplified product of 427 bp gene in colony touch PCR
1 to 4: Positive clones.
2 3
amplified product of 427 bp gene in colony touch PCR
1 to 4: Positive clones.
Fig 4.7: Screening of positive recombinant clones of partial VP2 gene on LB agar
3 4
gene on LB agar
4
427 bp
gene on LB agar

Fig 4.10: Agarose gel electrophoresis (0.7%) showing recombinants plasmid DNA of canine
parvovirus VP2 gene cloned in pJET1.2/blunt cloning vector (2974) bp (Fermentas) obtained by
alkaline lysis method. Lanes: M: 1kb DNA ladder (Biogene); 1-5: Positive clones
411 bp
500 bp 681 bp
500 bp
M 1 2 3 M M 6 7 8 9 10 11 M
Fig 4.9: Agarose gel electrophoresis (1%) showing amplified product of 411bp and 618 bp gene –
terminal parts of whole genome by colony touch PCR. Lanes: M: 100bp. DNA ladder
(Biogene); 1 to 3: Positive clones.: 6 to 11: positive clones
3kbp
M 1 2 3 4

Fig 4.11: RE
Lane 1: 2408bp AND 993bp
Fig 4.12: RE digestion by
fragments.
fragments. M- 1kbp
3kbp
digestion by Rsa
Fig 4.12: RE digestion by RsaI
1kbp ladder; L
M L
RsaI enzyme
Lane 1: 2408bp AND 993bp RE digested
RsaI enzyme
ladder; L-RE digested products
M L
I enzyme in silico digestion of plasmid to make two fragments.
RE digested cloned plasmid.
enzyme in wet lab confirming 2408bp and 993bp
RE digested products
M L
2408bp
993bp
digestion of plasmid to make two fragments.
cloned plasmid.
wet lab confirming 2408bp and 993bp
2408bp
993bp
2408bp
993bp
2408bp

Fig 4.13: RE digestion by Pst I enzyme in silico digestion of plasmid to make linear along with insert, Lane
1: 3401 bp linearised plasmid
Fig 4.14: RE digestion by Pst I enzyme in wet lab confirmation of 3401bp linear plasmid, M: 1kbp marker,
lanes 1 to 3: RE digested cloned plasmid to yield 3401bp product
3401bp3kbp
3401 bp
M 1 2 3

35
4.9 Nucleotide sequencing and data analysis
The amplified PCR products and some plasmid clones were subjected to sequencing in
the automated DNA sequencer ABI 3130 Genetic Analyzer (Applied Biosystems), in the
Department Of Animal Biotechnology, College of Veterinary and Animal Sciences, LLRUVAS,
Hisar. Contigs were prepared from both forward and backward nucleotide sequences obtained
from each twelve set of primer by using the software DNA BASER. The sequence data generated
were compared with the sequences available in NCBI database and the maximum homology
search was done using online software BLASTN version 2.2.17 available with NCBI.
4.10 Multiple sequence alignment of the sequence obtained from the field isolate of
Haryana
Multiple sequence alignment was performed using sequences obtained from Haryana isolate to
that of five global isolate, using Clustal W software was created fig 4.15.
4.11 Phylogenetic tree based on the VP2 gene obtained from Haryana isolate to that of
global isolate
The VP2 gene sequences obtained from the Haryana isolate and gene sequences of various global
isolates were selected for Phylogenetic analysis. Evolutionary relationship between different
isolates was obtained using BIOEDIT software and Phylogenetic tree was constructed using
MEGA 4 software fig 4.16. The results showed that the CPV Hisar isolate was closely related to
that of CPV isolates from eastern Asian countries like china, Taiwan and thereby forms a separate
Claude.

Fig 4.15: Multiple Sequence alignment of Hisar isolate with strains of other geographical location based on partial
VP2 gene; the Clustal consensus shows gaps with variations. Green, red, black and blue colours indicate
nucleotides: consensus presence of stars indicate similarity, whereas absence indicates dissimilarity.

Fig 4.16: Phylogenetic tree construction based on partial VP2 gene with other geographical isolates.
Showing three claudes-CPV Hisar isolate clustered with eastern Asian CPV isolates.
Fig 4.17: Microphotograph of Madine Darby Canine Kidney cells after 48 hrs of growth.

36
CHAPTER –V
DISCUSSION
Canine parvo viruses, the causative agent for severe mortality rate in case of pups. The virus is
highly contagious, hence the morbidity rate among canine population shows increased rate. The
prior diagnoses of the disease based on clinical signs are the preventive measures. The differential
diagnosis to rule out the other factors causing the same clinical signs needs to be considered at
critical. Since the virus inhabits the kennel for longer period as they are more resistance to
conventional disinfectants, the risk of infection increases. The typical symptom includes greenish
diarrhoea with foul smelling along with vomition, anorexia, dehydration. The shedding of viral
particles, mostly through the faecal route, hence the faecal samples are best collected for the
detection of virus (Hirasawa et al., 1994). The sensitive applications like PCR, Real time PCR,
RFLP the detection of canine parvovirus becomes more accurate, specific and rapid. Using
genotype specific primers, the strains can be differentiated into various genotypes (Firoozjaii et
al., 2011).
Isolation of viral genome:
DNAZol kit method was followed for extraction of viral genome from faecal samples. The
instructions were followed according to the manufacturers’ protocol. Few modifications from the
original protocol have been done to improve the quantity and quality of the DNA obtained. Only
with few microlitres (10µl-min) of the faecal sample, the final concentration of DNA obtained
was enormous. An additional incubation at 80°C was carried out to improve the efficiency of the
protocol. The main advantage of DNAZol kit method was the rapidity. The whole procedure can
be finished within an hour. With the comparison of other traditional DNA extraction protocols, it
is less laborious, lesser time consuming and with efficient results (Chomczynski et al., 1997)
Polymerase chain reaction for partial VP2 amplification, the basis for screening:
Karry mullis in the year 1985 discovered polymerase chain reaction (Lehninger et al., 2004). To
amplify a specific sequence of DNA with pair of oligonucleotide primers each about 18-30nt in
length and with optimized G+C content with the property of complimentarity to the DNA
sequence to be amplified. A standardized thermocyclic conditions for denaturation, primer

37
annealing and polymerization was used along with thermostable DNA polymerase enzyme. Mg2+,
dNTP’s, templates, primers, PCR buffer was used along with the enzyme. A standardized
annealing temperature had to be set according with the primer melting temperature. PCR enable
rapid detection of canine parvovirus with high sensitivity and specificity.
To detect CPV infection, nested PCR with double nested primer pair was used by (Hirasawa
et al., 1994) to intensify the sensitivity and specificity of the reaction.
(Nandi and kumar.,2010) cell cultured the canine parvovirus in MDCK cell lines for isolation
and molecular characterization using polymerase chain reaction and restriction endo-nuclease
mapping. The inference of the study shows the rapidness and sensitivity of PCR techniques.
The first detection of CPV-2c was done using polymerase chain reaction (PCR) and RFLP.
Amplification of specific region of VP2 gene, restriction fragment length polymorphism (RFLP)
and nucleotide sequencing was carried out. The inference of the study revealed the
characterization of CPV-2c from 24 isolates and a single strain of CPV-2a (Perez et al., 2007).
Canine parvovirus was isolated using fibroma cell line A-72 and PCR was done for partial VP2
gene amplification. Restriction fragment length polymorphism was also carried out and the pre-
dominant strain isolated was CPV-2c from Uruguay (Pintos et al., 2011).
In India canine parvo viral vaccine strains were characterized and DNA sequencing was done.
The major capsid protein coding genes VP1/VP2 was amplified and nucleotide sequencing was
done which then compared with amino acid sequences of field strain. The vaccine strain showed
CPV-2, whereas the field strain showed CPV-2b genotype. Hence the inference being difference
in the strain inculcated in vaccine from that of field isolates (Nandi et al., 2010)
(Castro et al., 2010) collected samples between 1995 to 2009 and studied using PCR by
ampli9fying partial VP2 gene. The samples between the years 1995 to 2003 were identified as
CPV-2a, the samples from 2006 to 2009 characterized as 2b and the rest one found as CPV-2c in
the year 2008.
(Zhang et al., 2010b) had done canine parvovirus characterization of field strains from china. He
used PCR and RFLP. The results inferred the predominant strain circulating was CPV-2b
followed by CPV-2a.

38
The present study using the partial VP2 gene (747bp) amplification, the results obtained by PCR
were reproducible and sensitive. With this conventional PCR technique 72 samples out of 140
samples were found to be positive. Further pursuable of amplified product for other molecular
techniques like cloning and RFLP also yielded good results.
Genotyping of field strain with genotype specific primers:
The first variant CPV-2 was slowly replaced by its new variant CPV 2a, the infective agent for
canines as well as felines. The amino acid variation between CPV 2a from its progenitor CPV-2
includes 5, mostly occurs in the VP2 protein of capsid and these amino acids holds the epitopes
responsible for antigenicity, thus changes the host affinity of virus. CPV-2b, the other variant was
found in the year 1984. The new variant CPV-2b being the predominant strain along with its
former variant CPV-2a. One amino acid substitution at the major epitope A converting
Asn426Asp makes the new variant CPV-2b from its ancestor CPV-2 (Parrish et al, 1991). In the
recent of year 2001, one more new variant CPV-2c emerged with a single amino acid substitution
at the position of 426, replacing asparagines with glutamate from its ancestor CPV-2
(Buonavoglia et al., 2001).
In the current study, the predominant strain found to circulate in Haryana and nearby places was
CPV 2b. Around 86% of the samples were genotyped as CPV 2b. 14% (10 samples) of the rest
samples were genotyped as CPV 2a. No CPV 2c strain was found. Genotyping was done using
genotype specific primers to yield 681bp product for both CPV 2a/2b and 427bp product for CPV
2b.
Restriction fragment length polymorphism to differentiate vaccine from field strain:
In order to differentiate the other variants of CPV-2, the ancestors of CPV-2a, 2b and 2c,
Restriction fragment length polymorphism method was followed. CPV2a differs from its ancestor
by 5 to 6 amino acid, whereas the CPV-2b differs from its ancestor in a single epitope. The new
variant CPV-2c differs from CPV-2b by one nucleotide substitution at position 4064. Hence the
presence of polymorphism used for restriction site digestion by enzymes and profiling.
(Perez et al., 2007) detected the CPV-2c from South America based on PCR and RFLP. The
fragment holding the polymorphic region was targeted by PCR and amplified. Further Restriction
was done by enzymes and confirmed by DNA sequence analysis. In his studies out of 25 isolates
one was CPV-2a and rest 24 samples were CPV-2c, showed the current strain circulation.

39
Restriction fragment length polymorphism using RsaI I and HphI enzyme was done to find
variation between wild and vaccine strain. The result showed the vaccine strain was incorporated
with CPV-2 whereas the field strains were either CPV-2a/CPV-2b. (Sakulwira et al., 2001)
(Zhang et al., 2010a) had done canine parvovirus characterization of field strains from china. He
used PCR and RFLP. The amplified product holds the site for MboII enzyme, thus differentiating
the CPV-2c from the rest. The results inferred the predominant strain circulating was CPV-2b
followed by CPV-2a.
Insilco restriction enzyme profiling:
The 747 bp amplified product was used. Reference sequences for vaccine and field strains were
retrieved from the NCBI and loaded into the Insilco Restriction enzyme profiling simulators
(SNAP GENE SOFTWARE) & the resultant profiles were observed.
Wet-lab restriction enzyme profiling
The RsaI enzyme digested the 747bp product to give four different products of sizes:
50bp, 146bp, 149bp and 402bp, respectively for field strain, where as the 747bp PCR product
obtained from vaccine gave 50bp, 149bp and 548bp, respectively. Hence the strain variation
between vaccine and circulating field strain was recorded.
(Sakulwira et al., 2001) performed PCR and RFLP analysis of vaccine and field strain. RFLP was
conducted using RsaI and HphI. The results were confirmed the existence of polymorphism
between vaccine and field strain.
Cloning of the PCR products:
Cloning of the Partial length VP2 genome and terminal genes of the whole genome was
performed to put for sequencing. The cloning kits used were CloneJETTM
PCR (pJet 1.2 blunt
vectors) cloning kit (Fermentas). The recombinant clones were observed in ampicillin contained
LB medium. The positive recombinant clones were further confirmed by touch PCR and RE
digestion studies.

40
(Gupta et al., 2005) performed cloning of VP2 gene into pTargetT mammalian
expression vector system and confirmed the recombinant clones by sequencing and RE digestion.
(Saxena et al., 2011) performed cloning of NS1 gene into eukaryotic expression vector system
pcDNA 3.1. The functional activities of recombinant clones were confirmed by RT-PCR.
Nucleotide sequencing and data analysis
The amplified PCR products, whole genome sequences and some plasmid clones were subjected
for sequencing. Contigs were prepared from both forward and backward nucleotide sequences
obtained from each twelve set of primer by using the software DNA BASER. The final assembled
contigs were aligned with other isolates from various geographical locations like china, Taiwan,
western countries like USA. The results inferred that CPV hisar isolate was closely related to that
of china, Taiwan and Uruguay, whereas isolates from western country like USA was distantly
placed.
(Doki et al., 2006) analyzed CPV isolates from suspected dogs in Japan between 1999 and 2000.
The results based on sequencing and Phylogenetic tree construction showed the isolates were of
CPV 2a (3) and four of CPV type 2b. The results also confirmed the transmission between Japan
and Taiwan.
A prospective study includes the suggestion for continuous surveillance and monitoring of
canine parvovirus strains circulating in various geographical locations. This will contribute
insights for developing newer vaccines or preventive measures for the disease.

41
CHAPTER-VI
SUMMARY AND CONCLUSION
Canine parvo virus infection considered to be highly dreadful disease among the pups of
canine. The outcome of least concerned infected pups ends up with severe mortality. Hence the
developing of preventive and diagnostic strategy for CPV infection considered inevitable. Since
the virus is highly evolving, the CPV has undergone various mutant forms like CPV2, CPV2a,
CPV2b and CPV 2c from their ancestor feline panleukopenia virus (FPV). Continuous
surveillance and monitoring are required to keep track on the change in variation of the strain.
With the above said perspective of the disease, the present study was done. The study undertaken
has clearly revealed that the predominant strain circulating in Hisar, Haryana and nearby areas
was found to be CPV-2b (86%). Around 50% of the samples collected given positive results
based on molecular studies, inferred that the awareness among pet owners for vaccination needs
to be bestowed.
The molecular tools adopted like conventional PCR, RFLP
and sequencing were rapid, highly sensitive, reproducible and specific. The screening performed
with VP2 gene based PCR and the results obtained were consistent. On the course of research, all
the aforesaid techniques yielded the best results without any spurious bands. Genotyping was
done based on the genotype specific primers and the results obtained were free of spurious bands
or smears, when electrophoresed in agarose gel electrophoresis.
Few of the amplified VP2 and terminal sequences of whole length
genome was cloned in blunt vector and transformed into bacteria for generation of recombinant
clones and also to achieve whole sequence without any loss during sequencing.
Out of 140 samples processed, 72 samples were found to be positive. Most of
the cases were from below 6 months of age and a single case of vaccinated dog has given positive
result. This needs to be confirmed with other immunological studies and vaccine challenge
studies to confirm the efficiency of vaccine.
The generated sequence results were free of any gaps when BLAST in NCBI and
bioinformatics study revealed that Hisar strain was closely related to that of strains from East

42
Asian counties like china and Taiwan. Also the Phylogenetic tree constructed formed a separate
Claude with Hisar isolate and isolates from eastern Asian countries, inferred that the CPV Hisar
isolate might have evolved from Chinese strain.
From the above results, it has been concluded for reconsideration of vaccine
formulation with the incorporation of currently circulating predominant strain, so that better
protection can be achieved. Moreover creating awareness among the pet owners about CPV
vaccination leads the overall preventive measure of the infection. Hence suggested for frequent
surveillance and monitoring studies to keep track on the evolution pattern of canine parvo virus.

I
BIBLIOGRAPHY
Amalendu, C. 2006. Dogs their care and treatment 3rd
Edn. Kalyani publishers. Ludhiana. 5-6
Amelia, G., Andrew, L.L 2010. Canine parvo virus. J Vet Clin Small Anim prac. 40:1042-1049.
Anbazhagan and Nandi, S 2009. Molecular characterization of canine parvo virus strains in vaccines by PCR
and Restriction enzyme analysis. Indian J Virol. 20:12-14.
Baatz, G. 1992. Ten years of clinical experiences with canine parvovirus infection CPV-2 infection.J Tieraztl Prax
.20: 69-78.
Balu, P. A and Thangaraj, T. M. 1981. Canine viral gastroenteritis-A clinical report. Ind J Vet Med.1:73
Banja, B. K., Sahoo, N., Das, P. K., Swain, P. and Panda, H. K. 2002. Comparison of different laboratory
tests for diagnosis of parvo and corona viral infections in dogs. Indian Vet. J. 79: 425-428.
Bastianello, S. S. 1981. Canine parvovirus myocarditis: clinical signs and pathological lesions encountered
in natural cases. J. S. Afr. Vet. Assoc. 52: 105-108.
Branka, V., Jovanovic, M., Trailovic, D and Sara, S. J. 2006. Diagnostic methods of canine parvovirus. Acta
Veterinaria.56:515-527
Buonavoglia, C., Martella, V., Pratelli, A., Tempesta, M., Cavalli, A., Buonavoglia, D., Bozzo, G., Elia, G.,
Decaro, N. and Carmichael, L. 2001. Evidence for evolution of canine parvovirus type 2 in Italy. J. Gen.
Virol. 82: 3021-3025.
Calderon, M.G., Mattion, N., Bucafusco, D., Fogel, F., Remorini, P., Torre, J.L (2009). Molecular
characterization of canine parvovirus strains in Argentina: Detection of the pathogenic variant CPV2c in
vaccinated dogs. J Virol Methods. 59:141-145.
Calderon, M.G., Romanutti, C., D’Antuono, A., Keller, L., Mattion, N., Torre, J.L (2011). Evolution of
Canine Parvovirus in Argentina between years 2003 and 2010: CPV2c has become the predominant variant
affecting the domestic dog population. J Virus Res. 157:106-110.
Carman, P.S and Povey, R.C. 1984. The Seroprevalance of Canine Parvovirus-2 in a Selected Sample of the
Canine Population in Ontario. The Can Vet J., 25(6): 259-262.
Carter J and Saunder V. 2007. Virology principles and applications. John Wiley and sons press, West
Sussex.pp.137-139.
Castro, T.X., Costa, E.M., Leite, J.P.G., Cubel, R.C.W 2010. Partial VP2 sequencing of canine parvo virus
strains circulating in the state of Rio De Janero, Brazil; Detection of the new variant CPV2c. Brazilian J
Microbiol.4:1093-1098.
Charles, H., Nicola, D., Costantina, D., Patrick, T., Camila, P.M., Susan, S., Canio, B. and Jeremiah, T. S.
2007. Occurrence of canine parvovirus type 2c in the United States. J. Vet. Diag. Invest. 19: 535-539.
Chomczynski P., Mackey K., Drews R., Wilfinger W., DNAzol: a reagent for the rapid isolation of genomic
DNA.J Biotechniques. 1997 Mar; 22(3):550-3.
Costa, A. P., Leite, J.P., Labarthe, N.V. and Garcia, R.C. 2005. Genomic typing of canine parvovirus
circulating in the State of Rio de Janeiro, Brazil from 1995 to 2001 using polymerase chain reaction assay.
Vet. Res. Commun. 29: 735-743.

II
Dahiya, S.S., Saini, M., Kumar, P., Gupta, P.K .2012. Immunogenicity of a DNA-launched replicon-based
canine parvovirus DNA vaccine expressing VP2 antigen in dogs. J Res Vet Sci,
doi:10.1016/j.rvsc.2012.01.017.
Decaro, N., Buonavoglia, C .2012. Canine parvovirus-A review of epidemiological and diagnostic aspects,
with emphasis on type 2c. J Vet Microbiol .155:1-12.
Decaro, N., Desario, C., Addie, D.D., Martella, V., Vieira, M.J., Elia, G., Zicola, A., Davis, C.,
Thompson, G., Iry, G., Truyen,U. and Buonavoglia, C. 2007. The study molecular epidemiology of canine
parvovirus, Europe. Emerg. Infect. Dis. 13:1222-1224.
Decaro, N., Elia, G., Martella, V., Campolo, M., Desario, C., Camero, M., Cirone, F., Lorusso, E., Lucente,
M.S., Narcisi, D., Scalia, P. and Buonavoglia, C. 2005. Characterization of the canine parvovirus type 2
variants using minor groove binder probe technology. J. Virol. Meth. 133: 92-99.
Decaro, N., Martella, V., Elia, G., Desario, C., Campolo, M., Buonavoglia, D., Bellacicco, A.L., Tempesta,
M. and Buonavoglia, C. 2006. Diagnostic tools based on minor groove binder probe technology for rapid
identification of vaccinal and field strains of canine parvovirus type 2b. J. Virol. Meth. 138: 10-16.
Doki M, Fujita K, Miura R, Yoneda M, Ishikawa Y, Taneno A, Kai C. Sequence analysis of VP2 gene of
canine parvovirus isolated from domestic dogs in Japan in 1999 and 2000. Comp Immunol Microbiol Infect
Dis. 2006; 29:199–206
Drane, D.P., Hamilton, R.C. and Cox, J.C. 1994. Evaluation of a novel diagnostic test for canine parvovirus.
Vet. Microbiol. 41: 293-302.
Fields B.N., Knipe, D.M. 1990.Virology. Raven press.Ltd, Newyork.pp.1776-1777.
Firoozjaii, H.A., Shoorijeh, S.J, Mohammadi, A and Amino, T. 2011.Characterisation of Iranian isolates of
canine parvovirus in fecal samples using polymerase chain reaction assay. Iranian J Biotechnol. 9:63-67
Florent, G. 1986. Enzyme-linked immunosorbent assay for single serum diagnosis of canine parvovirus
disease. Vet. Rec. 119: 479.
Gadsall S. A and Clegg S R..2010 Epidemiology of canine parvovirus and coronavirus in dogs presented wit
severe diarrhea to PDSA PetAid hospitals.Veterinary record. 167:196-201
Garg, E. G. 2006. Infectious diseases of dog and cat.3rd
Edn. Saunders and Elsevier.Canada.63-72
Gupta P. K., Rai A., Rai N., Raut A. A. and Chauhan S.(2005) Cloning of canine parvovirus VP2 gene and
its use as DNA vaccine in dog . Current Science.88 (5):778-782
Hirasawa, T., Yono, K. and Mikazuki, K. 1994. Differentiation of wild- and vaccine-type canine
parvoviruses by PCR and restriction-enzyme analysis. Zentralbl Veterinarmed B. 42: 601-610.
Horiuchi, M., Yamaguchi, Y., Gojobori, T., Mochizuki, M., Nagasawa, H., Toyoda, Y., Ishiguro, N. and
Shinagawa, M. 1998. Differences in the evolutionary pattern of feline panleukopenia virus and canine
parvovirus. Virology. 249: 440-452.
Houston, D. M., Ribble, C. S and Head, L. L.1996. Risk factors associated with parvoviral enteritis in dogs:
283 cases (1982-1991).J. Am. Vet. Med. Assoc., 208:542-546.
John, B. C and Venetia, A. S. 2007. Virology principles and applications. John Wiley and Sons press, West
Sussex, 137-139.
Kapil, S., Cooper, E and Lamm, C. 2007. Canine parvovirus types 2c and 2b circulating in North American
dogs in 2006 and 2007. J Clin Microbiol. 45: 4044-4047

III
Kasamatsu H., Nakanishi A.1998.How do animal DNA viruses get to the nucleus. Annu. Rev. J Microbiol.
52:627–286.
Lehninger, A.L., Nelson, D.L and Cox, M.M.2004.Lehninger principles of biochemistry 4th
Edn.
W.H. Freeman.New York.pp-319.
Lobetti and Remo, 2003. Canine parvovirus and Distemper. Proceedings of the 28thWorld Congress of the
World Small Animal Vet. Association.
MacLachlan, M.J., Dubovi E.J.2011. Fenner’s Veterinary Virology 4th
Edn. Academic Press,
Elsevier. pp.226-228
Martella, V., Cavalli, A., ratelli, A., Bozzo, G., Camero, M., Buonavoglia, D., Tempesta, M.,
Buonavoglia, C. (2004). A Canine Parvovirus Mutant Is Spreading in Italy. J clin microbiol. 42.
1333-1336
Martyn, J.C., Davidson, B. E., Studdert, M. and Martyn, J. C. 1990. Nucleotide sequence of feline
leucopenia virus: comparision with canine parvovirus identifies host specific differences.J. Gen
Virol. 71: 2747-2753.
Meerarani, S., Ramadass, P., Sophy, A.J.R. and Nachimuthu, K. 1998. Slot blot hybridization for
diagnosis of canine parvovirus infection. Indian J.Virol. 14: 43-45.
Meunier, P.C., Clickman, L.T., Appel, M.J.G and S, J Shin.1981.Canine parvovirus in a
commercial kennel: epidemiologic and pathologic findings. Cornell Vet. 76: 96-110
Miller T J., Reed A P., Jones E V., Nucleotide sequence and genome organization of canine
parvovirus.J Virol. 1988 January; 62(1): 266–276.
Minakshi 2006. Annual report. Dept. of Animal Biotechnology, LLRUVAS, Hisar.
Mizak, B., Rzezutka, A., Krol, J. and Kazula, A. 2001. Construction and immunogenic properties
of DNA vaccine against canine parvovirus infection. Bull Vet. Inst. Pulway. 45: 125-139.
Mohan, R., Nauriyal, D.C., Singh, K.B., Mangat, A.P.S. and Singh, G.K. 1991. Seroprevalance of
canine parvo viral infection in Punjab State. Indian J. Comp. Microbiol., Immuno. Infect. Dis. 12:
122-125.
Mohanraj, J., Mukhopadhyay, H.K., Thanislass, J., Antony, P.X., Pillai, R.M. 2010. Isolation,
molecular characterization and Phylogenetic analysis of canine parvovirus. J Infection, Genetics
and Evolution .10:1237-1241.
Naidu H., Subramanian BM., Chinchkar SR., Sriraman R., Rana SK., and Srinivasan VA: Typing of canine
parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis. J Virol Methods;
2012 May; 181(2):197-201
Nakamura, M., Tohya, Y., Miyazawa, T., Mochizuki, M., Phung, H.T., Huynh, L.M., Nguyen,
L.T., Nguyen, N.P. and Akashi, H.2004. A novel antigenic variant of canine parvovirus from a
Vietnamese dog. Arch Virol, 149: 2261-2269
Nandi, S and Kumar, M. 2010d. Molecular typing of canine parvovirus strain by polymerase chain
reaction and restriction enzyme analysis. J Pub Med .57: 458-463.
Nandi, S. Anbazhagan and Mano.j Kumar.2010a. Strain differentiation and characterization of
canine parvovirus by PCR and RE mapping, Indian J Biotechnol. 9:38-42

Sunder single file thesis

Recommended

Recommended

More Related Content

What's hot

What's hot (19)

Similar to Sunder single file thesis

Similar to Sunder single file thesis (20)

Recently uploaded

Recently uploaded (20)

Sunder single file thesis