1. Detection of
Mycoplasma Synoviae in
chicken flocks in 4
governorates during 2013 by
PCR
Abd El-Hamid H.S.1; Ellakany, H.F. 1; El-
Bestawy, A.R. 1 and Abd El-Halim, B.A2.

2. Introduction
Mycoplasma synoviae is considered the second most
important mycoplasma affecting chickens (Stipkovits &
Kempf, 1996; Kleven, 2003).
In broilers:
It causes respiratory disease and subsequent condemnations
due to airsacculitis, although it seem to be subclinical
infection until the concomitant infection or vaccination with
one of the respiratory viral diseases like IB or ND and also the
presence of IBD infection which causes immunosuppression
or concurrent bacterial diseases infection like ORT may lead
MS to causes airsacculitis (Roussan etal., 2011).

3. In layers and breeders:
Mycoplasma Synoviae infection may causes peritonitis and mortality in
laying chickens and also, since the year 2000 a novel eggshell apex
abnormality (EAA) has been increasingly found in table egg producing
chicken flocks in the Netherlands. It was first described in white layers
housed in cages, but were later also seen in brown layers housed in cages,
and in both types of birds kept in other housing systems.
It has an economical impact as the infection is characterized egg production
losses and also, egg abnormalities through a roughened shell surface, shell
thinning, increased translucency, cracks and breaks and also, the
abnormalities are confined to the top cone of the egg, up to approximately 2
cm from the apex, and almost always have a very clear demarcation zone.
The proportion of affected eggs varies between flocks, from a few percent up
to 25% (Feberwee et al., 2009).

4. The aim of this work:
PCR testing of respiratory tract swabs for the
detection of MS infected chicken flocks
including (layer, breeder and broiler flocks)
suffering from drop of egg production (in layers
& breeders) with respiratory manifestations and
sometimes mortalities (in broiler flocks) in 8
Egyptian governorates (El-Behera, Kafr El-
Sheikh, Alexandria, El-Gharbia, El-Dakahlia,
Matrouh, El-Menofia and Cairo) during the
winter of 2012 and spring of 2013

5. Material and methods:
Samples:
Swabs from respiratory tracts of infected birds from 45 chicken flocks (16 layer, 3 broiler
breeder and 26 broiler flocks) in 7 governorates were collected during the winter of 2012 and
spring of 2013.
Media for isolation:
Modified Frey's media was used for the isolation of MS from collected samples (Naola and
Noormohammadi, 2013):
Mycoplasma broth base (BBL) 22.5 g
Glucose 3 g
Swine serum 120 ml
Nicotinamide adenine dinucleotide (NAD) 0.1 g
Cysteine hydrochloride 0.1 g
Phenol red (1%) 2.5 ml
Thallium acetate (10%) 5 ml
Benzyle penicillin G 1,000,000 units
Distilled H2O 1000 ml
Adjust pH to 7.8 with 20% NaOH and filter sterilize.

6. The broth cultures were incubated at 37 C for
5-7 days under microaerophilic condition
using gas generating kits (Oxoid LTD
Laboratories) for production of 7-10% Co2 in
the jar of the culture and when the broth
cultures color changed from red to yellow
color the samples were submitted for PCR
testing for MS (Kleven, 2003).

7. PCR and sequencing of MS
isolates:
Requirements for PCR of MS:
PCR Primers for partial sequencing of MS vlhA gene.
VlhAF Forward
5′ ATTAGCAGCTAGTGCAGTGGCC 3′ Benčina et al.,
(2001)
VlhAR2 Reverse
5' AGTAACCGATCCGCTTAATGC 3' Hammond et al.,
(2009)

8. Protocol of PCR & Sequencing
A- DNA extraction
B- Primer preparation
C- Amplification process through
thermal cycling
D- Agarose gel electrophoresis
E- Purification
F- Cycle sequencing termination
G- Purification
H- Injection in gene sequencer

9. Extraction of DNA and PCR
conditions
The DNA of MS cultures was extracted using commercial extraction kits (Thermo Scientific
GeneJET Genomic DNA Purification Kit #K0721, #K0722) using digestion solution,
proteinase K, lysis solution, wash buffer I & II and elution buffer and the method was done
according to manufacturer.
The reaction was carried out in PCR tubes and set up with final concentrations as follow:
25 ul reaction was prepared through addition of 12.5 ul PCR master mix (PCR Master Mix
(2X)#K0171 for 200 rxns), 2 ul of prepared forward primer, 2 ul of prepared reverse primer, 5
ul DNA sample & 3.5ul nuclease free water.
An automated thermal cycler (Applied Biosystems) was used to carry out the thermal cycling
through:
Denaturation at 94 °C for 4 min
PCR was run for 36 cycles at 94 °C denaturation for 1 min,
52 °C annealing for 1 min
72 °C extension for 1 min.
The final extension was at 72 °C extension for 2 min.
The PCR products were analysed on a 1.5% agarose gel and stained with ethidium bromide.
Also, a 100 bp DNA ladder (GeneRulerTM Thermoscientific) was used and the agarose gel was
visualized through UV transilluminator.

10. Sequencing of MS isolates:
PCR purification using QIA quick PCR purification kit which contained:
QIAquick Spin Columns 50
Buffer PBI* 30 ml
Buffer PE (concentrate) 2 x 6 ml
Buffer EB 15 ml
Collection Tubes 2 ml
Loading Dye (Big dye terminator) 110 μl
CENTRI-SEP Spin Columns
The method was done acc. to manufacturer then the eluted DNA was used in Cycle sequencing reaction using
Big dye terminator v 3.1 cycle sequencing kit as follows:
Samples: Add Big dye terminator 8ul
Primer (3.2 Pmol) 1ul
Template 20ng
Water nuclease free up to 20 ul
Control: Add Big dye terminator 8ul
Primer (3-2 Pmol) 4ul
Template 0.5ng
Water nuclease free up to 7 ul
Thermal cycling:
Stage Description Temperature Time
1 Denaturation 96 C 1 minute
Amplification 96 C 10 seconds
2 (25 cycles) 55 C 5 seconds
60 C 4 minutes
3 Hold 4 C pause

11. Results

12. Culturing and PCR examination of 45 chicken
flocks during the winter of 2012 and spring of
2013 revealed that MS infected 3 layer flocks
out of 16 (18.75%) tested suffering from drop
of egg production with or without respiratory
manifestations. Also, 4 broiler flocks out of 26
(15.38%) with complains of respiratory signs
and 5-10% mortality were infected by MS. In
addition, 3 broiler breeder flocks were tested
but proved negative for MS.

13. A summary for MS in Egypt during 2012-
2013
localityProblems found
Age of
flock
Case No.
% PCR
Positivity
Positive PCR
For MS
Total
Examined
Type of
chickens
AlexandriaCRD, IBD27 days29
15.38%426Broilers
AlexandriaIBD, CRD32 days31
AlexandriaCRD, swollen kidneys
31 days
32
El-Behera
Airsaccultis, exudative
bursae
32 days25
El-GharbiaEgg production 79.8%36 wks2
18.75%316Layers
El-Behera
Caseated plug in larynex
(ILT, CRD)
90 days18
Kafr-
El-Sheikh
Egg peritonitis, egg prod.
83%
58 wks44
16.66 %742Total
El-Dakahlia-40 wks48
003Breeders
Cairo
Egg prod. 69%, CCRD,
inflammation of oviduct
38 wks49
El-Dakahlia
Inactive ovaries, Necrosis
of trachea
43 wks50

14. PCR results
Amplification of 421 bp bands which is
specific for MS took place from PCR test in
all tested samples using specific PCR
primer (vlhAF– vlhAR2) of MS.

15. Positive lanes of MS are facing ladder with mol. wt of 421 bp

16. Sequencing results
Alignment of genetic material complementary
to the assigned primers of 3 local strains of
MS was done in relation to the foreign isolates
and results showed that the 3 tested strains
were not related genetically to the strains
from middle east countries: Israel, Iran, but
they were related to Japanese, Armenian
and Brazilian ones.

17. Alignment of the Egyptian strains of MS in
relation to the foreign isolates

19. Phylogenetic tree of the recently isolated Egyptian MS:
Fig.11

22. 1. PCR based detection of MS infection was useful as
it was sensitive, specific, rapid and effort and time
saving.
2. Also, this survey illustrates the role of MS in the
CCRD problem among broiler flocks which may
play a great role in the incidence of such problem.
3. The effect of MS on egg production in layers and
breeders in Egypt need more and more work for
controlling the infection.