Pyrosequencing slide presentation rev3.Robert Bruce
Pyrosequencing was evaluated as an alternative to Sanger sequencing for HIV drug resistance genotyping. Three assays were designed to detect mutations in the protease gene using a 356 bp amplicon and three sequencing primers. The assays demonstrated good linearity and sensitivity below 5% in quantifying mixed bases. However, read lengths were limited due to signal degradation, making it difficult to sequence large amplicons. Overall, pyrosequencing showed promise as a method for HIV genotyping but further optimization was needed to improve read lengths and mixed variant detection.
The document describes a seminar on Random Amplified Polymorphic DNA (RAPD) markers. It defines RAPD as a type of PCR reaction that amplifies random segments of DNA using short arbitrary nucleotide primers. The document outlines the history, principle, procedure, applications, advantages, and limitations of RAPD analysis. It compares RAPD to other molecular marker techniques and concludes that RAPD is a lab technique used to amplify unknown DNA segments for analysis.
This document provides an overview of molecular detection techniques used in food quality control. It discusses how chemistry alone cannot solve all detection problems and that molecular biology methods like PCR, RFLP, and sequencing are better alternatives as they are more accurate, rapid and cost-effective. It describes several common molecular detection methods and their applications in detecting food pathogens, adulterants, allergens and GM ingredients. The document emphasizes that molecular methods can identify microbes at the strain level and detect viable cells, but may not be able to find non-authorized GMOs due to lack of molecular information.
This document provides information about polymerase chain reaction (PCR) and gel electrophoresis. It begins with an introduction to PCR, covering its history, basic procedure, requirements, applications and limitations. PCR is described as a technique for amplifying specific DNA sequences. The document then provides details on gel electrophoresis, including its use for analyzing amplified DNA from PCR. Gel electrophoresis separates DNA fragments by size when an electric current is applied through an agarose gel. Specific applications of both PCR and gel electrophoresis are given.
Streamlined next generation sequencing assay development using a highly multi...Thermo Fisher Scientific
Next generation sequencing (NGS) assay development for solid tumor sequencing requires characterization of variant calling directly from formalin-fixed paraffin embedded (FFPE) tissue samples. However, cell line based FFPE and human FFPE samples only contain 2 to 20 variants, which require laboratories to invest significant resources in sample sourcing and preparation when developing assays to detect 100+ variants
The document summarizes research on expressing HIV-1 antigens in plants as a potential vaccine. The researchers found that transient expression in plants is a viable alternative to transgenic plants. They determined that targeting the HIV-1 Gag protein Pr55Gag and its derivative p17/24 to chloroplasts yielded the highest levels of these proteins. Mice vaccinated with p17/24 produced from chloroplasts developed strong CD4+ and CD8+ T cell responses and HIV-specific antibodies, showing it is a promising vaccine candidate.
Pyrosequencing slide presentation rev3.Robert Bruce
Pyrosequencing was evaluated as an alternative to Sanger sequencing for HIV drug resistance genotyping. Three assays were designed to detect mutations in the protease gene using a 356 bp amplicon and three sequencing primers. The assays demonstrated good linearity and sensitivity below 5% in quantifying mixed bases. However, read lengths were limited due to signal degradation, making it difficult to sequence large amplicons. Overall, pyrosequencing showed promise as a method for HIV genotyping but further optimization was needed to improve read lengths and mixed variant detection.
The document describes a seminar on Random Amplified Polymorphic DNA (RAPD) markers. It defines RAPD as a type of PCR reaction that amplifies random segments of DNA using short arbitrary nucleotide primers. The document outlines the history, principle, procedure, applications, advantages, and limitations of RAPD analysis. It compares RAPD to other molecular marker techniques and concludes that RAPD is a lab technique used to amplify unknown DNA segments for analysis.
This document provides an overview of molecular detection techniques used in food quality control. It discusses how chemistry alone cannot solve all detection problems and that molecular biology methods like PCR, RFLP, and sequencing are better alternatives as they are more accurate, rapid and cost-effective. It describes several common molecular detection methods and their applications in detecting food pathogens, adulterants, allergens and GM ingredients. The document emphasizes that molecular methods can identify microbes at the strain level and detect viable cells, but may not be able to find non-authorized GMOs due to lack of molecular information.
This document provides information about polymerase chain reaction (PCR) and gel electrophoresis. It begins with an introduction to PCR, covering its history, basic procedure, requirements, applications and limitations. PCR is described as a technique for amplifying specific DNA sequences. The document then provides details on gel electrophoresis, including its use for analyzing amplified DNA from PCR. Gel electrophoresis separates DNA fragments by size when an electric current is applied through an agarose gel. Specific applications of both PCR and gel electrophoresis are given.
Streamlined next generation sequencing assay development using a highly multi...Thermo Fisher Scientific
Next generation sequencing (NGS) assay development for solid tumor sequencing requires characterization of variant calling directly from formalin-fixed paraffin embedded (FFPE) tissue samples. However, cell line based FFPE and human FFPE samples only contain 2 to 20 variants, which require laboratories to invest significant resources in sample sourcing and preparation when developing assays to detect 100+ variants
The document summarizes research on expressing HIV-1 antigens in plants as a potential vaccine. The researchers found that transient expression in plants is a viable alternative to transgenic plants. They determined that targeting the HIV-1 Gag protein Pr55Gag and its derivative p17/24 to chloroplasts yielded the highest levels of these proteins. Mice vaccinated with p17/24 produced from chloroplasts developed strong CD4+ and CD8+ T cell responses and HIV-specific antibodies, showing it is a promising vaccine candidate.
The document summarizes research on expressing HIV-1 antigens in plants as a potential vaccine. The researchers found that transient expression in plants is a viable alternative to transgenic plants. They determined that targeting the HIV-1 Gag protein Pr55Gag and its derivative p17/24 to chloroplasts yielded the highest levels of these proteins. Mice vaccinated with p17/24 produced from chloroplasts developed strong CD4+ and CD8+ T cell responses and HIV-specific antibodies, showing it is a promising vaccine candidate.
Los días 20 y 21 de octubre de 2016, la Fundacion Ramón Areces organizó un simposio internacional para analizar las 'Enfermedades raras de la piel: de la clínica al gen y viceversa'. El doctor Fernando Larcher Laguzzi, del CIEMAT-Universidad Carlos III de Madrid-IIS Fundación Jiménez Díaz, ejerció de coordinador.
This study compared microscopy and PCR techniques for diagnosing malaria in suspected patients in Nepal. Of 824 suspected malaria cases tested, 19.2% were confirmed by microscopy, with most being P. vivax (10.9%) or P. falciparum (7.7%) infections. PCR testing of 132 blood samples detected more cases than microscopy, including some microscopy-negative samples. PCR was better able to detect mixed infections and identified some samples to the species level that microscopy identified only as Plasmodium. While PCR is more sensitive for detection and useful for research, microscopy remains the standard for routine diagnosis due to its lower cost and feasibility.
This document describes experiments aimed at isolating bacteriophage mutants with altered tolerance for plating when the gpD capsid protein is fused to foreign proteins. The author isolated "IPDF" mutants of phage i434Dam123 that could not plate when gpD-fusions were expressed from a plasmid. These IPDF mutants were then used to select "supIPDF" mutants that regained the ability to plate equally in the presence or absence of gpD-fusions. Sequencing showed the mutations responsible for the IPDF and supIPDF phenotypes were located outside of the D and E genes. This suggests there are extragenic mutations that can enhance or suppress the toxicity of gpD-fusions towards viable phage
Real-time PCR allows for both detection and quantification of specific DNA or RNA sequences. It works by measuring the accumulation of fluorescent signals produced during each amplification cycle in real time. Key advantages include its high sensitivity, ability to detect small amounts of nucleic acids from few cells, and use of fluorescent probes and primers for sequence-specific detection. The document provides details on using real-time PCR to quantify the 2b gene of Cucumber mosaic virus, a plant virus, including reaction components, cycling parameters, and quantification methods using standard curves or comparative threshold analysis.
Antibodies directed to rna dna hybrids-an electrochemical immunosensor for mi...hbrothers
This document describes a label-free electrochemical immunosensor for detecting microRNAs (miRNAs) using antibodies that recognize RNA/DNA hybrids. The sensor uses a conducting polymer/reduced graphene oxide-modified electrode. It detects miRNAs at concentrations as low as 5 femtomolar and can distinguish between fully matched and mismatched sequences. The sensor combines hybridization detection with antibody recognition of miRNA-DNA hybrids to increase reliability through triple verification of the miRNA concentration.
Lectut btn-202-ppt-l28. variants of pcr-iiRishabh Jain
Reverse transcriptase PCR (RT-PCR) is used to amplify cDNA copies of RNA. It involves reverse transcribing RNA to cDNA then amplifying the cDNA with PCR. RT-PCR can be used to study gene expression and diagnose genetic diseases. Variations include band-stab PCR which reamplifies low yield fragments, degenerate PCR which uses mixed primers for related gene families, and anchored PCR which attaches a known sequence to amplify unknown 5' sequences. Real-time PCR monitors fluorescence during amplification to quantify templates in each cycle, allowing visualization of reactions in real-time. It is commonly used to measure changes in gene expression.
Polymerase chain reaction (PCR) is a technique used to amplify a single or few copies of a DNA sequence to generate thousands to millions of copies. It involves repeating cycles of denaturing DNA, annealing primers to the single strands, and extending the primers with a DNA polymerase. Real-time PCR allows quantification of the PCR product at each cycle by detecting fluorescence from DNA-binding dyes or probe hydrolysis. It has applications in diagnosing diseases, detecting gene expression, identifying pathogens, and assessing genetically modified organisms.
1) Researchers identified differential methylation of the GRIN2D gene in colon cancer cells using reduced representation bisulfite sequencing, finding it demethylated in approximately 60% of cell lines. 2) They confirmed this epigenetic alteration led to upregulated GRIN2D expression and assessed its role in the cancer phenotype. 3) Knockdown of GRIN2D expression in demethylated RKO colon cancer cells using shRNA corresponded to reduced cell growth, suggesting GRIN2D demethylation contributes to the tumor cell phenotype. Future replication of these findings is needed to fully understand the significance.
This document describes how real-time PCR can be used to validate microarray data. Real-time PCR provides a quantitative and sensitive method for confirming changes in gene expression observed in microarray experiments. The document outlines a protocol for designing and running a real-time PCR experiment to validate a specific result from a microarray experiment showing increased expression of the TNFAIP3 gene in response to TNFα treatment. Key steps in the protocol include performing reverse transcription of RNA to generate cDNA, setting up a standard curve and controls, and analyzing the real-time PCR data to calculate fold-changes in gene expression.
RAPD (Random Amplification of Polymorphic DNA) is a PCR-based molecular marker technique that involves using short, arbitrary nucleotide primers to randomly amplify genomic DNA fragments. These fragments can then be analyzed as genetic markers. RAPD works by using a single short primer to amplify random DNA sequences from a complex template. Variations in priming sites between individuals result in presence or absence of bands that can be used to analyze genetic relationships. The technique is fast, inexpensive and does not require prior DNA sequence knowledge, but results can lack reproducibility between laboratories.
Q-PCR allows for quantitative analysis of DNA amplification in real-time using fluorescence detection. It monitors accumulation of fluorescent signals during each PCR cycle, allowing quantification of starting DNA template. Common probe-based methods include TaqMan probes with a fluorophore-quencher pair and molecular beacons which become fluorescent upon target binding. SYBR Green also detects amplification nonspecifically by binding double-stranded DNA. Q-PCR provides advantages over conventional PCR such as greater precision, sensitivity, and ability to quantify initial template amounts.
Christine Williams reviews various technologies for detecting cyclic AMP (cAMP) levels in high-throughput screening assays. The review highlights radiometric, fluorescence polarization, luminescence, and electrochemiluminescence methods. It emphasizes practical considerations for choosing an assay to identify modulators of G protein-coupled receptors that signal through cAMP. Future technologies may provide even greater biological information for drug discovery.
There are several types of PCR that have been developed to address different needs:
1) Allele-specific PCR detects single nucleotide polymorphisms using primers designed to match one allele. 2) Multiplex PCR allows amplification of multiple targets simultaneously. 3) Nested PCR uses two sets of primers for two rounds of amplification to increase sensitivity. 4) Reverse transcription PCR amplifies DNA from RNA templates.
There are several types of PCR that are used for different purposes:
1. Allele-specific PCR is used for single nucleotide polymorphism detection and DNA cloning. It requires prior knowledge of DNA sequence variations.
2. Multiplex PCR allows amplification of multiple DNA sequences simultaneously in a single reaction.
3. Nested PCR increases sensitivity by using two sets of primers in two sequential amplification reactions, with the second set binding internal to the first.
Some other types include reverse transcription PCR for amplifying RNA, touchdown PCR to reduce nonspecific amplification, and quantitative PCR for measuring starting DNA/RNA quantities.
Multiplex PCR ppt , its types and their applications along with advantages an...ShimukhYadav
Multiplex PCR allows for the simultaneous amplification of multiple target DNA sequences in a single reaction. It involves including multiple primer pairs specific to different targets in one PCR reaction. The technique was first described in 1988 for the detection of deletions in the Duchenne Muscular Dystrophy gene. Key considerations for multiplex PCR include choosing targets of similar sizes, primers with matching melting temperatures, and optimization of reaction conditions. The method has applications in pathogen detection, genetic testing, forensic analysis, and more due to its ability to rapidly identify multiple sequences from a single sample.
Discovery and Mechanistic Study of Mycobacterium tuberculosis PafA Inhibitors...Dr.Shuaib Ahmad
The document describes research into discovering and characterizing inhibitors of the Mycobacterium tuberculosis protein PafA. Key points:
1. Researchers developed a high-throughput screening assay to identify inhibitors of PafA from a library of compounds. This identified two inhibitors, E-H8 and V-G3, and one activator, B-F2.
2. Further analysis found that E-H8 (called ST1926) selectively inhibited Mtb PafA, while V-G3 inhibited both Mtb and Corynebacterium glutamicum PafA. ST1926 did not work by binding the substrate PanB.
3. ST1926 was found to increase the
Recent advances in diagnosis of malaria By Dr Nidhi RaiDr Nidhi Rai Gupta
This document discusses recent advances in malaria diagnosis. It describes several diagnostic methods including microscopic examination of blood smears, fluorescent microscopy using methods like QBC, antigen detection using rapid diagnostic tests that detect proteins like HRP2 and pLDH, antibody detection methods like IFA and ELISA, and molecular diagnostic methods like PCR, LAMP, microarrays, and mass spectrometry. It provides details on the principles, procedures, advantages, and disadvantages of each method. Microscopic examination remains widely used but newer methods like rapid tests and molecular tools provide improved sensitivity, specificity, and ability to detect species.
Best possible natural ligands which were enlisted on NPACT website were screened ( aid of major drug likeness parameters - pkCSM) and docked with the 2OJG(Target protein) using autodock.
English Drug and Alcohol Commissioners June 2024.pptxMatSouthwell1
Presentation made by Mat Southwell to the Harm Reduction Working Group of the English Drug and Alcohol Commissioners. Discuss stimulants, OAMT, NSP coverage and community-led approach to DCRs. Focussing on active drug user perspectives and interests
The document summarizes research on expressing HIV-1 antigens in plants as a potential vaccine. The researchers found that transient expression in plants is a viable alternative to transgenic plants. They determined that targeting the HIV-1 Gag protein Pr55Gag and its derivative p17/24 to chloroplasts yielded the highest levels of these proteins. Mice vaccinated with p17/24 produced from chloroplasts developed strong CD4+ and CD8+ T cell responses and HIV-specific antibodies, showing it is a promising vaccine candidate.
Los días 20 y 21 de octubre de 2016, la Fundacion Ramón Areces organizó un simposio internacional para analizar las 'Enfermedades raras de la piel: de la clínica al gen y viceversa'. El doctor Fernando Larcher Laguzzi, del CIEMAT-Universidad Carlos III de Madrid-IIS Fundación Jiménez Díaz, ejerció de coordinador.
This study compared microscopy and PCR techniques for diagnosing malaria in suspected patients in Nepal. Of 824 suspected malaria cases tested, 19.2% were confirmed by microscopy, with most being P. vivax (10.9%) or P. falciparum (7.7%) infections. PCR testing of 132 blood samples detected more cases than microscopy, including some microscopy-negative samples. PCR was better able to detect mixed infections and identified some samples to the species level that microscopy identified only as Plasmodium. While PCR is more sensitive for detection and useful for research, microscopy remains the standard for routine diagnosis due to its lower cost and feasibility.
This document describes experiments aimed at isolating bacteriophage mutants with altered tolerance for plating when the gpD capsid protein is fused to foreign proteins. The author isolated "IPDF" mutants of phage i434Dam123 that could not plate when gpD-fusions were expressed from a plasmid. These IPDF mutants were then used to select "supIPDF" mutants that regained the ability to plate equally in the presence or absence of gpD-fusions. Sequencing showed the mutations responsible for the IPDF and supIPDF phenotypes were located outside of the D and E genes. This suggests there are extragenic mutations that can enhance or suppress the toxicity of gpD-fusions towards viable phage
Real-time PCR allows for both detection and quantification of specific DNA or RNA sequences. It works by measuring the accumulation of fluorescent signals produced during each amplification cycle in real time. Key advantages include its high sensitivity, ability to detect small amounts of nucleic acids from few cells, and use of fluorescent probes and primers for sequence-specific detection. The document provides details on using real-time PCR to quantify the 2b gene of Cucumber mosaic virus, a plant virus, including reaction components, cycling parameters, and quantification methods using standard curves or comparative threshold analysis.
Antibodies directed to rna dna hybrids-an electrochemical immunosensor for mi...hbrothers
This document describes a label-free electrochemical immunosensor for detecting microRNAs (miRNAs) using antibodies that recognize RNA/DNA hybrids. The sensor uses a conducting polymer/reduced graphene oxide-modified electrode. It detects miRNAs at concentrations as low as 5 femtomolar and can distinguish between fully matched and mismatched sequences. The sensor combines hybridization detection with antibody recognition of miRNA-DNA hybrids to increase reliability through triple verification of the miRNA concentration.
Lectut btn-202-ppt-l28. variants of pcr-iiRishabh Jain
Reverse transcriptase PCR (RT-PCR) is used to amplify cDNA copies of RNA. It involves reverse transcribing RNA to cDNA then amplifying the cDNA with PCR. RT-PCR can be used to study gene expression and diagnose genetic diseases. Variations include band-stab PCR which reamplifies low yield fragments, degenerate PCR which uses mixed primers for related gene families, and anchored PCR which attaches a known sequence to amplify unknown 5' sequences. Real-time PCR monitors fluorescence during amplification to quantify templates in each cycle, allowing visualization of reactions in real-time. It is commonly used to measure changes in gene expression.
Polymerase chain reaction (PCR) is a technique used to amplify a single or few copies of a DNA sequence to generate thousands to millions of copies. It involves repeating cycles of denaturing DNA, annealing primers to the single strands, and extending the primers with a DNA polymerase. Real-time PCR allows quantification of the PCR product at each cycle by detecting fluorescence from DNA-binding dyes or probe hydrolysis. It has applications in diagnosing diseases, detecting gene expression, identifying pathogens, and assessing genetically modified organisms.
1) Researchers identified differential methylation of the GRIN2D gene in colon cancer cells using reduced representation bisulfite sequencing, finding it demethylated in approximately 60% of cell lines. 2) They confirmed this epigenetic alteration led to upregulated GRIN2D expression and assessed its role in the cancer phenotype. 3) Knockdown of GRIN2D expression in demethylated RKO colon cancer cells using shRNA corresponded to reduced cell growth, suggesting GRIN2D demethylation contributes to the tumor cell phenotype. Future replication of these findings is needed to fully understand the significance.
This document describes how real-time PCR can be used to validate microarray data. Real-time PCR provides a quantitative and sensitive method for confirming changes in gene expression observed in microarray experiments. The document outlines a protocol for designing and running a real-time PCR experiment to validate a specific result from a microarray experiment showing increased expression of the TNFAIP3 gene in response to TNFα treatment. Key steps in the protocol include performing reverse transcription of RNA to generate cDNA, setting up a standard curve and controls, and analyzing the real-time PCR data to calculate fold-changes in gene expression.
RAPD (Random Amplification of Polymorphic DNA) is a PCR-based molecular marker technique that involves using short, arbitrary nucleotide primers to randomly amplify genomic DNA fragments. These fragments can then be analyzed as genetic markers. RAPD works by using a single short primer to amplify random DNA sequences from a complex template. Variations in priming sites between individuals result in presence or absence of bands that can be used to analyze genetic relationships. The technique is fast, inexpensive and does not require prior DNA sequence knowledge, but results can lack reproducibility between laboratories.
Q-PCR allows for quantitative analysis of DNA amplification in real-time using fluorescence detection. It monitors accumulation of fluorescent signals during each PCR cycle, allowing quantification of starting DNA template. Common probe-based methods include TaqMan probes with a fluorophore-quencher pair and molecular beacons which become fluorescent upon target binding. SYBR Green also detects amplification nonspecifically by binding double-stranded DNA. Q-PCR provides advantages over conventional PCR such as greater precision, sensitivity, and ability to quantify initial template amounts.
Christine Williams reviews various technologies for detecting cyclic AMP (cAMP) levels in high-throughput screening assays. The review highlights radiometric, fluorescence polarization, luminescence, and electrochemiluminescence methods. It emphasizes practical considerations for choosing an assay to identify modulators of G protein-coupled receptors that signal through cAMP. Future technologies may provide even greater biological information for drug discovery.
There are several types of PCR that have been developed to address different needs:
1) Allele-specific PCR detects single nucleotide polymorphisms using primers designed to match one allele. 2) Multiplex PCR allows amplification of multiple targets simultaneously. 3) Nested PCR uses two sets of primers for two rounds of amplification to increase sensitivity. 4) Reverse transcription PCR amplifies DNA from RNA templates.
There are several types of PCR that are used for different purposes:
1. Allele-specific PCR is used for single nucleotide polymorphism detection and DNA cloning. It requires prior knowledge of DNA sequence variations.
2. Multiplex PCR allows amplification of multiple DNA sequences simultaneously in a single reaction.
3. Nested PCR increases sensitivity by using two sets of primers in two sequential amplification reactions, with the second set binding internal to the first.
Some other types include reverse transcription PCR for amplifying RNA, touchdown PCR to reduce nonspecific amplification, and quantitative PCR for measuring starting DNA/RNA quantities.
Multiplex PCR ppt , its types and their applications along with advantages an...ShimukhYadav
Multiplex PCR allows for the simultaneous amplification of multiple target DNA sequences in a single reaction. It involves including multiple primer pairs specific to different targets in one PCR reaction. The technique was first described in 1988 for the detection of deletions in the Duchenne Muscular Dystrophy gene. Key considerations for multiplex PCR include choosing targets of similar sizes, primers with matching melting temperatures, and optimization of reaction conditions. The method has applications in pathogen detection, genetic testing, forensic analysis, and more due to its ability to rapidly identify multiple sequences from a single sample.
Discovery and Mechanistic Study of Mycobacterium tuberculosis PafA Inhibitors...Dr.Shuaib Ahmad
The document describes research into discovering and characterizing inhibitors of the Mycobacterium tuberculosis protein PafA. Key points:
1. Researchers developed a high-throughput screening assay to identify inhibitors of PafA from a library of compounds. This identified two inhibitors, E-H8 and V-G3, and one activator, B-F2.
2. Further analysis found that E-H8 (called ST1926) selectively inhibited Mtb PafA, while V-G3 inhibited both Mtb and Corynebacterium glutamicum PafA. ST1926 did not work by binding the substrate PanB.
3. ST1926 was found to increase the
Recent advances in diagnosis of malaria By Dr Nidhi RaiDr Nidhi Rai Gupta
This document discusses recent advances in malaria diagnosis. It describes several diagnostic methods including microscopic examination of blood smears, fluorescent microscopy using methods like QBC, antigen detection using rapid diagnostic tests that detect proteins like HRP2 and pLDH, antibody detection methods like IFA and ELISA, and molecular diagnostic methods like PCR, LAMP, microarrays, and mass spectrometry. It provides details on the principles, procedures, advantages, and disadvantages of each method. Microscopic examination remains widely used but newer methods like rapid tests and molecular tools provide improved sensitivity, specificity, and ability to detect species.
Best possible natural ligands which were enlisted on NPACT website were screened ( aid of major drug likeness parameters - pkCSM) and docked with the 2OJG(Target protein) using autodock.
English Drug and Alcohol Commissioners June 2024.pptxMatSouthwell1
Presentation made by Mat Southwell to the Harm Reduction Working Group of the English Drug and Alcohol Commissioners. Discuss stimulants, OAMT, NSP coverage and community-led approach to DCRs. Focussing on active drug user perspectives and interests
Solution manual for managerial accounting 18th edition by ray garrison eric n...rightmanforbloodline
Solution manual for managerial accounting 18th edition by ray garrison eric noreen and peter brewer_compressed
Solution manual for managerial accounting 18th edition by ray garrison eric noreen and peter brewer_compressed
NURSING MANAGEMENT OF PATIENT WITH EMPHYSEMA .PPTblessyjannu21
Prepared by Prof. BLESSY THOMAS, VICE PRINCIPAL, FNCON, SPN.
Emphysema is a disease condition of respiratory system.
Emphysema is an abnormal permanent enlargement of the air spaces distal to terminal bronchioles, accompanied by destruction of their walls and without obvious fibrosis.
Emphysema of lung is defined as hyper inflation of the lung ais spaces due to obstruction of non respiratory bronchioles as due to loss of elasticity of alveoli.
It is a type of chronic obstructive
pulmonary disease.
It is a progressive disease of lungs.
Cancer treatment has advanced significantly over the years, offering patients various options tailored to their specific type of cancer and stage of disease. Understanding the different types of cancer treatments can help patients make informed decisions about their care. In this ppt, we have listed most common forms of cancer treatment available today.
VEDANTA AIR AMBULANCE SERVICES IN REWA AT A COST-EFFECTIVE PRICE.pdfVedanta A
Air Ambulance Services In Rewa works in close coordination with ground-based emergency services, including local Emergency Medical Services, fire departments, and law enforcement agencies.
More@: https://tinyurl.com/2shrryhx
More@: https://tinyurl.com/5n8h3wp8
At Malayali Kerala Spa Ajman, Full Service includes individualized care for every client. We specifically design each massage session for the individual needs of the client. Our therapists are always willing to adjust the treatments based on the client's instruction and feedback. This guarantees that every client receives the treatment they expect.
By offering a variety of massage services, our Ajman Spa Massage Center can tackle physical, mental, and emotional illnesses. In addition, efficient identification of specific health conditions and designing treatment plans accordingly can significantly enhance the quality of massaging.
At Malayali Kerala Spa Ajman, we firmly believe that everyone should have the option to experience top-quality massage services regularly. To achieve that goal we offer cheap massage services in Ajman.
If you are interested in experiencing transformative massage treatment at Malayali Kerala Spa Ajman, you can use our Ajman Massage Center WhatsApp Number to schedule your next massage session.
Contact @ +971 529818279
Visit @ https://malayalikeralaspaajman.com/
Sectional dentures for microstomia patients.pptxSatvikaPrasad
Microstomia, characterized by an abnormally small oral aperture, presents significant challenges in prosthodontic treatment, including limited access for examination, difficulties in impression making, and challenges with prosthesis insertion and removal. To manage these issues, customized impression techniques using sectional trays and elastomeric materials are employed. Prostheses may be designed in segments or with flexible materials to facilitate handling. Minimally invasive procedures and the use of digital technologies can enhance patient comfort. Education and training for patients on prosthesis care and maintenance are crucial for compliance. Regular follow-up and a multidisciplinary approach, involving collaboration with other specialists, ensure comprehensive care and improved quality of life for microstomia patients.
2024 Media Preferences of Older Adults: Consumer Survey and Marketing Implica...Media Logic
When it comes to creating marketing strategies that target older adults, it is crucial to have insight into their media habits and preferences. Understanding how older adults consume and use media is key to creating acquisition and retention strategies. We recently conducted our seventh annual survey to gain insight into the media preferences of older adults in 2024. Here are the survey responses and marketing implications that stood out to us.
Test bank clinical nursing skills a concept based approach 4e pearson educati...rightmanforbloodline
Test bank clinical nursing skills a concept based approach 4e pearson education
Test bank clinical nursing skills a concept based approach 4e pearson education
Test bank clinical nursing skills a concept based approach 4e pearson education
Sunscreens, IP-I, Dr. M.N.CHISHTI, Asst Prof. Dept of Pharmaceutics, YBCCPA
PfGDH.pptx
1. Development of aptasensors for malaria using Plasmodium
falciparum Glutamate dehydrogenase as target antigen.
2. Contents
Chapter 1: Introduction, motivation and objectives
Chapter 2: Cloning, expression, purification and characterization of
Plasmodium falciparum and Human, glutamate dehydrogenase.
Chapter 3: Development of aptamer specific for PfGDH and its
characterization.
Chapter 4: Protein induced fluorescence enhancement based biosensor
Chapter 5: Development of capacitive aptasensor
Chapter 6: Development of aptaFET biosensor
Chapter 7: Dye coupled aptamer captured enzyme catalysed reaction for
detection of Pan specific and P. falciparum malaria in laboratory set up
and instrument free paper based format.
Summary of work
Future direction of research
Publications
References
Acknowledgements
5. MDR Malaria: A Global threat
Plasmodium falciparum distribution
Drug resistant malaria
RTS S –The world’s first malaria
vaccine by GSK and Gates
foundation
Targeting sporozites
o Low efficacy
o Genetically variablilty
6. 6
Techniques Sensitivity
(parasites/µ
l)
Pros Cons
Microscopy 5-10 Distinguishes
between species
and stages, gold
standard
Requires
skilled labour
time
consuming
Quantitative
buffy coat
<15 Easy and
sensitive
Expensive and
chances of
leaking and
loss of
parasites
Polymerase
chain reaction
≥1 Highly sensitive Time and
resource
intensive
Rapid
diagnostic tests
(RDTs)
50–100 Low cost and fast
detection (~30
min)
Less sensitive,
non
quantitative
and unstable
RD
Ts
Diagnostic methods
Malaria Diagnosis
7. 7
Biomarkers for malaria
Lactate dehydrogenase (LDH)
-Structurally and kinetically distinct from human LDH, however not specific to
P.falciparum
Hemozoin
-Appears as clusters in the digestive vacuole, Not detectable in young ring
stages
Glutamate dehydrogenase (GDH)
-Absent in RBC. Present in low concentration
Aldolase
-Distinct from host Aldolase, only detectable in high concentration
Histidine rich protein –II (HRP-II)
-Unique biomarker specific to P.falciparum, False negatives due to Prozone effect
The current available most of RDTs in
the market based on Targeting of
PLDH as Pan specific and PfHRP-II as
falciparum biomarker.
8. Biomarkers for Malaria
• Just enough data to raise suspicion
• WHO-Recommendations against use of
HRP-II based RDTs.
9. Pf GDH is potent biomarker for Malaria
Location
Sequence
Structure
Expression through out the parasitic life
cycle
Present in good concentration in parasitic
cytoplasm
Specific Inhibitor for PfGDH
Presence in serum
18 December 2022 9
10. 10
Challenges
Quantitative test: Quantitatively estimate the
biomarker
Stability: Antibody based systems are unstable
in hot and humid climates
Sensitivity : Efficient to detect biomarker in
case of asymptomatic malaria
Low cost: Especially with the point of view of
developing countries
12. Cloning, expression and purification of PfGDH and HGDH
• cDNA from 3D7 asynchronous P. falciparum Obtained from ATCC, HGDH TA clone obtained
from Bioserve.
• 0.8 % agarose gel stained with EtBr, 10 % SDS PAGE stained with commassie blue stain.
13. Characterization of PfGDH and HGDH
Western blot of recombinant PfGDH (I) and HGDHa (II) with anti His antibody (1:5000
dilution) over PVDF membrane (A). Secondary structure estimation of PfGDH and HGDHa
(1mg/ml) in 10 mM phosphate and Tris buffer respectively (B).
Alpha Beta Turns Random
PfGDH 28% 5% 30% 37%
HGDH 27% 58% - 15%
14. Characterization of PfGDH
C
• AUC result of PfGDH showing
different fractions of oligomers
(A, B).
• Maldi Mass Spectroscopy Analysis
of PfGDH, hexameric protein of
PfGDH denatured in the presence
of 0.5M DTT and 10% SDS.
~54 KDa
15. Enzyme Kinetics parameters for PfGDH
18 December 2022 15
A. PfGDH activity was measured spectrophotometrically by following the change in absorbance at 340
nm. The forward reaction (deamination of glutamate) was followed in the presence of 100 µM NADP
in assay buffer (50 mM potassium phosphate buffer), pH 8.0.
B. Competitive Inhibition of PfGDH in presence of Isopthalic Acid. (Deamination of glutamate) was
followed in the presence of 100 µM NADP in assay buffer (50 mM potassium phosphate buffer),
pH 8.0, Glutamate- 10mM.
16. Conclusion
• The PfGDH, HGDH were cloned, expressed and purified.
• The Purified protein characterized through various techniques (AUC,
CD Spectroscopy, MALDI-MS).
• The Michaelis Menten (Km) value is calculated for recombinant
PfGDH, HGDH and found 4.10±0.28 mM, 4.36±0.18 mM respectively.
• Isopathalic acid act as specific inhibitor to competitively inhibit the
PfGDH activity not HGDH.
16
18. AFM images of A. Bare PVDF membrane.
B. PVDF-PfGDH. C. PVDF-PfGDH Aptamer.
Library
5’-CACCTAATACGACTCACTATAGCGGATCCGA-N40-
CTGGCTCGAACAAGCTTGC-3’
Forward primer:
5’-CACCTAATACGACTCACTATAGCGGA-3’
Reverse primer:
5’-Biotin-GCAAGCTTGTTCGAGCCAG-3’
18
Decreasing Binding time
PCR amplification at the end of SELEX
cycle 1-17 respectively. Counter selex against
PVDF after 6, 8, 10 (Marked with Yellow
Star) and Counter selex against HGDH after
S13, S15 (Marked with Red Triangle).
Screening and characterization of aptamers specific for PfGDH
19. SELEX- Cloning and Sequencing
19
Screening of 55 TA clones
through restriction enzyme
(EcoR1) digestion. M: marker,
Control: digestion product of
plasmid from a blue colony.
Positive clones are labeled
with star selected for
sequencing
20. SELEX- Cloning and Sequencing
20
Selex Alignment- Different aptamer sequence group on the basis of percentage sequence matches in
decreasing order (A>B>C>D>E)
Group Aptamer
Name
Sequence of Aptamer Percentage
sequence
match
A NG37
NG46
NG51
NG53
TCCGACCACGGCCAGCTCACCACGCTCCTCCCCCCCTCCCCCGC
----------CCCCACTCACTGCTCGGACTCTCCCCCTCCCCGC
----------CCCCACTCACTGCTCGGACTCTCCCCCTCCCCGC
----------CCCCACTCACTGCTCGGACTCTCCCCCTCCCCGC
B NG3
NG55
NG9
NG36
TCCGAGCCGGGGTGTTCTGTTGGCGGGGGCGG--TGGGCGGG---
TCCGAGTGGCCTGGGCGTGCGGGGGTGGGGGGGTGGAGCGCGGC-
TCCGAGTGGCCTGGGCGTGCAGGGGTGGGGGGGGTGGAGCCTGGC
TCCGAGTGGCCTGGGCGTGCGGGGGTGGGGGGGTGGAGCGCGGC-
C NG4
NG15
NG11
TCCGATTCCCCCCCCGCACCTCACCCTACCATGCCCGCCTCCCGC
TCCGACCCCCCCTCCTGTGCTCGTCGTG-GCTCTTCCATTCCGGC
TCCGAACCCCACGAAGTGTGCTGGCTCTT-CTTGACCCATTCCGGC
D NG24
NG29
NG18
TCCGACACCCGGGTTTTCCCATCCGTTCCCCCGCTCCCCCCGGC-
TCCGAGGGG-GGGTGGGTGGTTCCCTCCCGCCGCTCCCCCTTGGC
-------CG-TGATGCTCTCTCTCCTCCCGCCGCTCCCCCTTGGC
E NG21
NG35
TCCGACAACAGCCCACCCCCCACCCCGGACAACTCCCTGCT-----CGGC
TCCGACCTATC-----CCCCTTCCCCGGTTCTCCTTCTGGTCTCGTCGGC
Decreasing
order
of
percentage
sequence
matches
21. Structure prediction of aptamer NG3 and NG51
21
• The sequences of NG3 and NG51 uncovers the presence of G-rich regions which
might contribute to the formation of complex G-quadruplex structures.
• The G quadruplex prediction software QGRS Mapper predicted a total of 2 QGRS
sequences for NG3 and Zero QGRS sequence for NG51.
A. CD analysis of NG3 and NG51 aptamer. (B)Secondary structures of NG3 and NG51 aptamer
predicted by mfold software.
NG NG3
NG51
Signature peaks of
Anti Parallel G quadruplex
22. Electrophoretic mobility shift assay with NG3 and NG51
22
Electrophoretic mobility shift assay (EMSA). PfGDH at various concentrations (0.1uM to 2.4uM,
and 0.25 nM Aptamer NG3, NG51. Stained with cyber gold and Commassie blue staining in 6%
polyacrylamide native gel.
23. Binding affinity of developed Aptamer in solution
23
CD spectra (A) NG3 and (B) NG51 in the presence of the target protein PfGDHa (0µM to 1.0µM) and negative control
proteins HGDHa, HSA( Human Serum Albumin), HRP-II (Histidine rich protein), PfLDH (Plasmodium falciparum
lactate dehydrogenase) CD spectra of (C) NG3 and (D) NG51.
Kd for NG3=0.5 ± 0.04 μM
Kd for NG51=1.1 ± 0.20uM
F= Bmax* abs(x)/Kd+abs(x)
24. Binding affinity of developed Aptamer on surface
24
SPR data of NG3 (A) and NG51 (B) with different concentration of PfGDH and dissociation
constant (Kd) for respective aptamer . Specificity of aptamer with analogous protein.
25. Conclusion
• The two aptamer (NG3, NG51) against PfGDH were developed.
• The NG3 forming the G quadruplex structure.
• The Kd found 0.5±0.04 µM and 1.1± 0.2 µM with CD spectroscopy
for NG3 and NG51 respectively.
• The Kd found 78±4.58 nM and 370±14.37 nM with SPR spectroscopy
for NG3 and NG51 respectively.
• Gibbs Energy was also calculated for both of aptamer (NG3, NG51)
and found -56.9, -36.65 KJ/Mole respectivily based on SPR data
indicate prompt interaction of aptamer with target.
25
26. 26
Chapter 4
Protein induced fluorescence
enhancement based detection of PfGDH
using aptamer carbon dot.
Handheld fluorescence spectrophotometer
29. Covalent linking of Aptamer with C Dots
FTIR spectra of NG3aptamer (black) Cdot (blue) and Cdot-aptamer conjugate after EDC/NHS
activation covalent linkage (red).
30. Fluorometric Detection of PfGDH for Malaria
(A) Excitation and Emission spectra of Cdot, aptamer, PfGDH, Cdot-aptamer and Cdot-
aptamer/PfGDH complex in binding buffer. (B) PIFE of Cdot-aptamer conjugate with increasing
concentration of PfGDH protein spiked in binding buffer (C) Calibration plot for PIFE response
with PfGDH protein spiked in binding buffer
QY of Cdot/apt 34%
Increased up to 40 %
in presence of PfGDH
31. Fluorometric Detection of PfGDH for Malaria
A. Time optimization study for PIFE. B. PIFE response in srum. Calibration plot for PIFE response of the Cdot-
aptamer conjugate against different concentration of PfGDH spiked in human serum diluted in binding buffer
(E) PIFE response of Cdot-aptmer conjugate with different nonspecific malaria (PfLDH, PfHRP-II) and human
(HSA, HGDH) proteins each at a concentration of 10nM spiked in binding buffer.
LOD is found 0.48 and 2.58 nM in
buffer and serum respectively.
32. Docking of PfGDH with NG3 aptamer
• NG3 Sequence mFOLD Dot bracket annotation of NG3 3D structure of
NG3 Dock with PfGDH(2BMA) and NG3 with patchdock/PLIP software
Analysis through PyMOL.
32
Name of amino acid and position
Hydropho
bic Pocket
Meth 384, Gly 300, 370,169 Leu 119, Lys 401, Try 195,
Ile 397,281 Cystine 446, Arg 395, Glu 444,440
Interacting
Amino
acid/
Nucleotide
Hydrophobic
Interaction
H- Bond Salt Bridge
299Ser:28C
313Pro:81C
396Glu:56C
41Lys:49C
203Asn:53G
205Arg:45G
211Tyr:43C
440Glu:45G
41Lys:48G
205Arg:45,46T
255Lys:83T
274His:43,67C
Florescence life time of Cdot, Cdot-aptamer and
Cdot-aptamer-PfGDH with excitation at λ 308nm.
33. Conclusion
• Carbon dot of average size ~ 2nm were synthesized from L glutamic
acid through pyrolysis.
• Amine modified Aptamer covalently linked with C dot through
EDC/NHS chemistry.
• Selective protein induced fluorescence enhancement were observed
in Cdot/Aptamer for various concentration of PfGDH (1nM to 50nM)
no interference from analogous protein and in serum .
• LOD is found 0.48, 2.58nM in spiked Buffer and Serum (4x diluted)
respectively.
33
35. Capacitive Aptasensor based detection of PfGDH for
Malaria diagnosis
35
For POC application Non faradic EIS is preferable than faradic EIS
Cdl
Csl
37. Characterization of SAM
37
The results of AFM characterization before and after modification showed that the topographic roughness
gradually decreased from bare gold (1.52 nm) to aptamer modified gold electrode (1.41 nm) and blocked
aptasensor electrode (1.33 nm). The cyclic voltammetry performed in presence of K3(Fe(CN)6).
38. Detection of PfGDH in spiked undiluted serum
38
(A) Non-Faradaic measurement data in serum Phase response vs frequency. (B) Capacitance
response of NG3 aptamer-PfGDH with circled enlarged image in inset. (C) Calibration curve plot
capacitance response at 2 Hz. (D) Response of NG3 aptamer with analogue proteins spiked in
serum
39. Conclusion
• Surface assembled monolayer successfully formed with NG3
aptamer/MCH in 1:100 ratio .
• The Sensor has been developed which can detect PfGDH in buffer
and undiluted human serum in linear range (100fM-100nM).
• The sensitivity of the aptasensor as derived from the slopes of the
calibration curves in serum and buffer samples were 0.12 (10-7F)/ log
([PfGDH] pM) and 0.09 (10-7F)/ log([PfGDH] pM), respectively
• The limit of detection was calculated 0.43±0.08pM, 0.77±0.13pM for
buffer and serum respectively.
39
40. 40
Chapter 6
Development of aptamer based field
effect transistor (aptaFET) biosensor for
detection of PfGDH in serum sample.
41. Extended Gate Field Effect Transistor for Malaria Diagnosis
41
In EGFET, Gate is extended from transistor
42. Working circuit and IDµE
42
Working circuit of aptaFET biosensor. An interdigitated
gold electrode (IDµE) with pseudo reference electrode
connected to the gate of n type MOSFET. The aptamer
target binding reaction carried out on surface of IDµE
and FET system transduced this binding event into
electrical signal.
43. Characterization of SAM
43
A. Characterization of surface modification with AFM, (i) bare gold chip electrode (ii) surface assembled monolayer with
MCH/Aptamer/ Au. (B) Faradic EIS characterization of sensor fabrication, over IDµE chip and scanned in 10 mM potassium
hexacyano ferrate solution prepared in PBS. (C) Stability studies of IDµE in binding buffer from the plot of drain current
versus time.
S.N
o
Electrodes/SAM Rs (Ω) Rct (Ω) Cdl (µF) W (Ωs-1/2)
1. IDµE 144.27 118.5 17.1 885.66
2. IDµE/Aptamer/MCH 151.14 620.23 2.56 848.74
3. IDµE/Aptamer/MCH/Blockin
g
155.76 1778.1 1.34 825.34
Rms roughness 0.41
Average height 1.35
Rms roughness 0.53
Average height 1.48
Rms roughness 0.47
Average height 1.71
Theoretically calculated Debye length (ƛ)= 1.5
45. Detection of PfGDH in spiked buffer and diluted serum
45
A) FET response of PfGDH spiked in buffer, with (B) calibration plot between PfGDH
concentration in log10 term (0.1pM to 10nM) and shift in Vgs. (C) FET response of PfGDH spiked
in serum, with (D) calibration plot of PfGDH concentration verses shift in Vgs
LOD was found 16.7 and 48.6 pM in spiked
buffer and 10 fold diluted serum
Calculated Isoelectric point (pI) of PfGDH= 6.6
Theoretically calculated pI for PfGDH = 7.4
46. Interference study of EgFET sensor
46
A. Plot of Id versus Vg voltage for the target (PfGDH) and different potential interfering
proteins. The analysis was performed in buffer at 10nM concentration with 30 min time of
incubation, shift in Vg observed at 1.4 µA drain current. (B) Specificity of NG3 aptasensor
with analogous spiked protein
47. Conclusion
• Surface assembled monolayer was formed over Interdigitated
micro gold electrode and characterized.
• The EgFET Sensor has been developed which can detect
PfGDH in buffer and diluted human serum in linear range
(100fM-10nM) respectively.
• The Limit of detection was calculated and found 16.7±
1.88pM, 48.6± 3.47pM for buffer and serum respectively.
47
48. 48
Chapter 7
Dye coupled aptamer captured enzyme catalysed reaction
for detection of Pan specific and P. falciparum malaria in
laboratory set up and instrument free paper based format.
50. Resazurin/Resorufin
• Resazurin non toxic, cell permeable and non fluorescent blue colour
compound.
• Resazurin reactivity with NADH and other reducing agents transform
into Resorufin which is highly fluorescent, pink colour
50
51. Optimization of Aptamer/Protein loading with Mag Beds
51
Binding ratio of aptamers with enzyme capture efficiency with streptavidin coated magnetic
beads for (A) NG3/PfGDH and (B) P38/PLDH. Time optimization study for absorbance intensity at
different concentrations of the target captured enzymes (C) PfGDH (D) PLDH.
52. Detection of Malaria Biomarker PfGDH, PLDH with
Instruments
52
Calibration plots derived from absorbance and fluorescence characteristics for (A) PLDH, (B)
PfGDH in binding buffer and (C) PLDH, (D) PfGDH in serum.
53. Syringe Modification and Operation
53
Fabrication of modified syringe (A) real image with its components (B) Drawings of fabricated
syringe.
55. 55
Paper based analytical devices
Rapid analysis
Less expensive
Small sample volume
Little or no external
equipment or power
Affordable
Sensitive
Specific
User friendly
Rapid-Robust Equipment
free
Delivered to those
who need it
ASSURED ( WHO)
(Martinez et al, 2010 Diagnostics for the developing world: microfluidic paper-based analytical devices )
56. Preparation of polymer coated paper
56
SEM images showing surface topography of modified paper (A), control (i), chitosan treated (ii),
sericine treated (iii) and DEAE treated (iv) at 250 x magnification and inset respective image
magnified at 5000 x. Dye entrapment efficiency over Whatman filter paper (control) and
modified paper (B). The pixel intensity and Overall dye adsorbing efficiency by treated paper.
57. 57
Detection of Malaria Biomarker PfGDH, PLDH without
Instrument
Colour response on paper matrix against different concentration of PLDH (A), PfGDH (B) spiked
in binding buffer and PLDH (C), PfGDH (D) spiked in serum.
59. Conclusion
59
• Ratio of Aptamer (NG3, P38) with streptavidin magnetic beads
optimized and found that 1:20 ratio showed maximum loading.
• Optimization of time have been performed and found 60 min suitable
for diagnostic test*.
• Syringe with magnet and paper wick has been modified .
Technique Surface/
Electrode
Probe Detection
range
Target
Antigen
Response time LOD
Instrument based
UV-Visible
spectroscopy
Magnetic
beads
aptamer 1 pM- 100
nM
PLDH and
PfGDH
60 min
0.55±0.09 pM,
1.34±0.12 pM for
PLDH and PfGDH
respectively
Instrument based
Fluorescence
spectroscopy
1.72±0.13 pM,
1.43±0.14 pM for
PLDH and PfGDH
respectively
Instrument free
68.75 ± 7.64 ,69.25
± 8.22 pM for
PfGDH and PLDH
respectively
For Instrument based LOD = 3X SD of Blank/ slope of calibration
curve
For Instrument free LOD = LOB + 1.65 x SD of lowest concentration,
where limit of blank (LOB) = mean of blank + 1.65 x SD of blank
60. Overview of work
• PfGDH and HGDH genes were cloned, Expressed, Purified and characterized.
• Aptamer for PfGDH has been developed through SELEX procedure. The dissociation
constant was measured in liquid (CD) and over solid surface (SPR).
60
S. No Method Platform Range of Detection Limit of Detction
1. Carbon Dot based Fluorescence
Spectroscopy
1 to 50nM 2.58nM in Diluted Serum (4X)
2. Capacitive aptamer based Non faradic
electrochemical
spectroscopy
100fM to 100nM 0.77pM in Serum
3. Aptamer Based EgFET Non faradic FET
sensor
100fM to 10nM 48.6pM in Diluted Serum
(10X)
4. Magnetic beads based
detection (DECAMAL) for
PfGDH and PfLDH.
Colorimetric,
Fluorimetric,
Paper based
1pM to 100nM 0.55 (PLDH), 1.34 (PfGDH) pM UV-
Vis in Serum
1.72 (PLDH), 1.43 (PfGDH) pM
Fluorescence in Serum
110 (PLDH), 121 (PfGDH)
Instrument free in Serum
61. 61
Future direction of work
The three dimension structure for PfGDH is already known, to understand exact
mechanism and binding motif of developed aptamer over PfGDH, interactions
study through X-ray crystallographic, NMR spectroscopy need to be done in
order to decipher the linkage chemistry.
The capacitance based sensor concept could be executed in a pragmatic lab on
chip platform similar to glucose sensor for fast, simple malaria detection
approach. Since the above sensor performed at very low frequency (2 Hz),
designing of a miniaturized instrumentation for point of care device is easy for
implementation.
In dye based method to further reduce the cost SMB can be replaced with
chitosan capped iron oxide magnetic particles and functionalised with aptamer
to fulfil current market need for low cost (~0. 20 $ per test) malaria.
62. S.
No.
Name Sequence of Aptamer (5'-3') Target
1 P38 5'(Biotin)TTTTCACCTAATACGACTCACTATAGCGG
ATCCGACAATAATACACTTTGCTCCCCTGTGGCTTT
TCGCACTCGCCTGGCTCGAACAAGCTTGC-3'
PLDH
2 NG3 5'(Biotin)TTTTCACCTCATACGACTCACTATAGCGG
ATCCGAGCCGGGGTGTTCTGTTGGCGGGGGCGGTG
GGCGGGCTGGCTCGAACAAGCTTGC-3'
PfGDH
S. No Name Buffer composition
1. Coupling Buffer 10 mM TrisCl, 100 mM NaCl, pH 7.5,
2. Binding Buffer 50 mM potassium phosphate buffer, 5 mM NaCl, 5
mM KCl, 2.5 mM MgCl2 , pH 8.0
3. Cocktail Buffer Lactate-50 mM, Glutamate-10 mM, APAD-1 mM,
NADP-0.2 mM, Resazurin-0.40 mM, Phenazinetho
sulphate- 0.37 mM in 50 mM potassium phosphate
buffer
63. Improvement of Aptamer Affinity by Dimerization, February 2008, Sensors 8(2)
DOI: 10.3390/s8021090
64. The colloidal milk powder was used as reference solution. The average life time was calculated
from equation (ii). Where Ai is distribution of particle and τ is measured life time.
Editor's Notes
shows that the cases have consistently declined from 2.08 million to 1.08 million during 2001 to 2016. Similarly Pf cases have declined from 1.0 to 0.71 million cases during the same period. Less than 2000 deaths were reported during all the years within this period with a peak in 2006 when an epidemic was reported in NE States
Band gap measured through tauc equation- (αhυ)1/n=β(hυ - Eg)
The surface root mean square roughness (Rrms) of bare electrode was increased from 1.73 nm to 2.32 nm following formation of the surface assembled monolayer. The average distance of aptamer from electrode surface (Rrms average= Rrms of SAM - Rrms of blank) was 0.59 nm, which facilitated the aptamer target interaction due to closer distance thus, overcoming the Debye length limitation.
The surface modification was further characterized by EIS using nyquist plot (Figure 2b). From the Rct plot the increase in charge transfer resistance (Rct) valuef rom 245±15Ω for bare electrode to 778±43Ω after co-immobilization of aptamer/MCH and to 1955±78Ω following subsequent blocking with starting buffer and MCH was evident
The Debye length κ-1 was calculated using equation (1) where ɛr is the relative permittivity, ɛo dielectric constant, kB Boltzmann constant, T temperature, e elementary charge, NA Avogadro number and I is the ionic strength of solution:
κ-1 =(εr εo kB T / 2NAe2I)1/2 ------------------------------(1)