PCR Amplification Of Tem gene of ESBL E.coli

In-vitro Production Of Short
Nucleotides and SELEX Process

Who are we?
Ramashree and Sajini

This is going to be a long
presentation!
(We will try our best to not make it
boring)

Forget the fancy title adorned by
even fancier words
(Our project is for a noble cause)
We are trying to find a cure for a microbe
that doesn’t respond to antibiotics

• Our Project deals with a super strong bacteria
that can kill people in different stages if left
untreated.
• Oh wait! Treatment? What treatment? There
is no cure.
• Didn’t we tell you that our bacteria was Super
Strong?

ESBL E.coli
It’s a mutant strain
(hence, the mystery deepens!)

ESBL E.coli
• ESBL stands for Extended Spectrum Beta
Lactamase
• It means that this particular strain of E.coli is
resistant to a wide range of antibiotics ( 8
different classes of antibiotics)
• We call our bacteria the Octobiotic Bacteria.
(That is something we came up with)

So, is it just a multidrug
resistant microbe?
(pffft! What’s with all the hype?)

• As much as we wish it were, IT IS NOT.
• This strain of E.coli changes from being the
healthy bacteria that helps digest our food in
our intestines to the mutant strain which can
potentially kill us.

Legend speaks of a legendary
warrior – ESBL E.coli
(Once upon a time…
….and the story unfolds)

Nosocomial Infections
• Nosocomial infections are infections acquired
by a resident of the hospital or a visitor to the
hospital.
• Because hospitals are teaming with diseases
harbored by a multitude of patients with an
even bigger number of people visiting them
• Not to mention the army of nurses and
doctors working there.

Be scared. Be very scared!
• Urinary Tract Infections
• Blood poisoning
• Bacteremia
• Gastro-intestinal and skin infections

Who is responsible?
Is it you, Bacteria? Is it you, Fungus?
Or is it you, Virus?

SURPRISE!
• It’s them all.
• BACTERIA
• VIRUS
• FUNGUS
• Parasites as well

We are concerned only
about the bacterial
agents.

And this is what E.coli
unleashes

• Cloudy Urine
• Pain while urinating
• Burning sensations while urinating
• Need to urinate often
• Bloody urine
• Foul smelling urine
• Back pain

Extended Spectrum Beta Lactamase
• They are enzymes that hydrolyze extended
spectrum cephalosporins with an oxymino
side chain
• These cephalasporins include cefotaxime,
ceftriaxone, ceftazidime
• They are plasmid encoded enzymes.

• The genes responsible are TEM-1, TEM-2 and
SHV
• Mutations of these genes correspond to the
altering of the amino acid configuration
around the active site of these beta-
lactamases.

TEM-1
Amino acid substitutions take place at
positions 104, 164, 238 and 240

WAR 1
• Collect ESBL E.coli isolates (from patients or
from soil)
• Screen them
• Confirm them

Inoculation
• The sample was inoculated initially in 100ml
of nutrient broth to which 10mg of ampicillin
was added.
• In subsequent trials we changed the medium.
• We inoculated the bacteria in Luria Bertani
broth.

Screening - DDST
Augmentin Disk (20µg of amoxilin + 10µg of
clavulanic acid) in the centre surrounded by 3
cefotaxime tablets (30µg each)

WAR 2
• Isolate the DNA from the plasmid
• Perform gel electrophoresis
• Confirm by PCR amplification

Chapter 4
Plasmid DNA isolation

Trial 1
• Bacteria was inoculated in Nutrient Broth
• Two flasks containing 100 ml of broth were
taken
• One contained ampicillin and the other did
not.
• 1ml of culture was taken from each flask and
centrifuged at 10600rpm for 5 minutes

Solutions 1, 2 & 3
• Solution 1: 50mM Glucose, 25mM Tris pH 8.0,
10mM EDTA pH 8.0 – Re-suspension Solution
• Solution 2: 0.2N NaOH, 1% SDS – Lysis
Solution
• Solution 3: 60 ml of 5M Potassium Acetate,
11.5 ml of Glacial Acetic Acid and 28.5 ml of
distilled water – Neutralizing Solution
• PCI mixture: 12.5% Phenol, 12% Chloroform
and 0.5% Iso amyl alcohol

• 200µl of ice-cold re-suspension buffer was
added to the pellet and vortexed gently
• 10 mins later, 200µl of Lysis Buffer was added
to the pellet and was incubated at RT
• 5 mins later, 200µl of Neutralizing solution
was added ( a white precipitate was formed)
and was incubated by keeping it in on ice.

• 15 minutes later, the samples were
centrifuged at 13000 rpm for 20 minutes at
-4˚C
• Equal volume of PCI was added to the
supernatant collected and vortexed
• It was centrifuged at 13000rpm for 5 minutes
at RT and the supernatant was transferred to
a fresh eppendorf tube.

• 500µl of ice-cold ethanol (70%) was added
and centrifuged at 10000 rpm for 10 minutes
at -4˚C
• The alcohol was discarded and the pellet was
air dried for 10 minutes
• The pellet was dissolved in 20µl of TE
buffer(1X)

1 2 3 4
Lane 1 - 100bp ladder
Lane 2 - Sample 1 (amp)
Lane 3 - Sample 2 (w/o amp)
Lane 4 - 1kb ladder

Trial 2
• We inoculated the bacteria in LB broth
containing ampicillin.
• The same protocol was followed.

1 2 3 4

Trial 3
• We used two samples taken from a culture
grown overnight and a culture that was 2 days
old.
• We added RNase to the TE buffer
• The same protocol was followed.

Lane 1 - 1kp ladder
Lane 2 - Sample 1 (fresh)
Lane 4 - Sample 3 (old)
Lanes 5,6,7,8 - empty
1 2 3 4 5 6 7 8

Trial 3
• We increased the cell mass by using 5ml of
fresh culture (amp + LB broth)
• We increased the volume of the solutions
added.
• From 200µl to 300µl of Lysis Buffer.
• From 200µl to 250µl of Neutralizing solution

1 2 3 4
Lane 1 - 1kp ladder

Trial 4
• We increased the incubation periods for each
of the steps when the solutions are added.
• From 10 minutes to 30 minutes

1 2 3 4
Lane 1 - 1k ladder

Trial 5
• We realized that the increased exposure of
the lysis solution to our bacterial cells
degraded the DNA.
• We decreased the incubation from 30 minutes
to 5 minutes and these were the observations

Upon adding neutralizing solution

Centrifugation after adding PC

Centrifugation after adding
ethanol

Final Pellet – Plasmid DNA
Pellet

1 2 3 4 5
Lane 1 - 1kp ladder

PCR
• Milli Q water
• Agarose
• TBE buffer
• Ethidium bromide
• Primers (10p/ml)
• Primer sequence (5’-3’)
• TEM
• TEM F CTTCCTGTTTTTGCTCAACCCA (717 bp)
• TEM R TACGATACGGGAGGGCTTAC
• PCR machine (eppendorf thermocyclometer)
• Electrophoresis Unit

Master mix :
• Distilled water -70µl
• PCR Reaction buffer-10µl
• dNTPs -2µl
• Forward Primer -2µl
• Reverse Primer -2µl
• Taq Polymerase -2µl
Total volume was made to 22µl

• Tube containing mastermix was spun and
then 22µl of the mix was aliquoted into each
of the PCR tubes.
• 3µl of the sample DNA was then added to
those PCR tubes and finally the volume was
made to 25µl.
• These tubes were then placed in a
thermocycler and the program was set as
follows.

PCR Program
• Initial denaturation: 1min at 94°C
• Annealing: 1min at 58°C
• Extension: 1min at 72°C
• Denaturation: 15sec at 95°C
• Go to step 3 for 30 cycles
• Final Extension: 7min at 72°C
• 4°C forever
• End

1 2 3 4 5 6 7 8
Lane 4 - empty
Lane 7 - Sample 5
(dh5α)
Lane 8 – 1kb ladder

Chapter 5
Same battle. New squad.

Plasmid DNA isolation
• We decided to use a new bacterial culture
hoping that the new bacteria would have a
higher copy number which is essential for our
plasmid DNA isolation. (copy number is
directly proportional to the presence of
plasmid in the bacterium)
• We repeated the isolation and performed
PCR.

PCR Amplification Of Tem gene of ESBL E.coli

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Similar to PCR Amplification Of Tem gene of ESBL E.coli

Similar to PCR Amplification Of Tem gene of ESBL E.coli (20)

Recently uploaded

Recently uploaded (20)

PCR Amplification Of Tem gene of ESBL E.coli