Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer therapeutic target. However, very little is known about its expression and regulation in human tissues. The purpose of this study was to characterize the expression pattern of PDF in cancerous tissues and to identify mechanisms that regulate its expression.
Frizzled-8 receptor is activated by the Wnt-2 ligand in non-small cell lung c...Enrique Moreno Gonzalez
This document summarizes a research study that investigated the activation of Wnt-2 signaling through the Frizzled-8 receptor in non-small cell lung cancer (NSCLC). The study found a correlation between increased expression of Wnt-2 and Frizzled-8 in lung cancer tissue samples. A novel dominant-negative Wnt-2 construct (dnhWnt-2) inhibited Wnt-2 signaling activation and reduced colony formation of NSCLC cells in vitro and tumor growth in a mouse xenograft model. The dnhWnt-2 construct may provide a new therapeutic approach for targeting the Wnt pathway in lung cancer.
Circular RNAs (circRNAs) are a class of non-coding RNAs that can regulate gene expression by interacting with microRNAs (miRNAs). This document reviews the roles of circRNAs in human disorders through circRNA-miRNA interactions. It discusses how specific circRNAs like CDR1as have been found to be dysregulated in neurological disorders, cancers, and cardiovascular diseases and can contribute to disease by sponging up certain miRNAs. The prospect of using circRNAs as biomarkers for disease diagnosis and prognosis is also mentioned.
This document reviews microRNAs (miRNAs) related to the occurrence, diagnosis, and prognosis of non-small cell lung cancer (NSCLC). It discusses how some miRNAs act as oncogenes in NSCLC by promoting proliferation, migration, and invasion through targeting tumor suppressor genes. Other miRNAs act as tumor suppressors by inhibiting oncogenes. The expression levels of certain miRNAs have diagnostic and prognostic value for NSCLC. Some miRNAs show potential as biomarkers for early detection of NSCLC or for distinguishing NSCLC subtypes. Circulating miRNAs may also serve as biomarkers for cancer detection and prognosis. Single nucleotide polymorphisms in miRNA genes have been associated with survival in NSCLC patients.
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...QIAGEN
Epithelial ovarian cancer is the fifth leading cause of cancer-related deaths of women in the United States and Europe and ranks as the second most common type of gynecological malignancy. Most cases are diagnosed in advanced stages and although the response rates to platinum-based chemotherapy are high, the majority of patients nevertheless have poor survival rates. Although the reasons for these poor outcomes are likely to be multifactorial, one particular area of interest has recently focused on hematogenous tumor cell dissemination that has been shown to originate from disseminated tumor cells (DTCs) in the bone marrow (BM) and circulating tumor cells (CTCs) in the blood. Here, we demonstrate that the negative prognostic impact of CTCs and DTCs arise from specific cellular phenotypes and are associated with platinum-resistance and stem cell-associated proteins.
This document discusses genomic oncology and personalized medicine, using lung cancers as a model. It summarizes several key technologies that enable genomic oncology like cDNA microarrays, array CGH, and next generation sequencing. It provides examples of how these technologies have been used to classify cancers like diffuse large B-cell lymphoma and myelodysplastic syndrome, and identify genetic mutations that can guide targeted therapies for cancers like EGFR-mutated lung cancer.
Abnormal expression of Pygopus 2 correlates with a malignant phenotype in hum...Enrique Moreno Gonzalez
Pygopus 2 (Pygo2) is a Pygo family member and an important component of the Wnt signaling transcriptional complex. Despite this data, no clinical studies investigating Pygo2 expression in lung cancer have yet been reported.
1) The study investigated the role of the long non-coding RNA NNT-AS1 in progesterone resistance in endometrial cancer.
2) The researchers found that NNT-AS1 and survivin expression were increased, while miR-542-3p expression was decreased, in progesterone-resistant endometrial cancer cells.
3) Experiments showed that NNT-AS1 regulates progesterone resistance in endometrial cancer by functioning as a competing endogenous RNA for miR-542-3p, thereby regulating survivin expression.
Nigella sativa bioactives against Non-Small Cell Lung Cancer & Breast CancerYusuf Asad
This document summarizes a study on targeting the ERK and AKT pathways in non-small cell lung cancer and triple-negative breast cancer cells with bioactives from Nigella sativa. The study found that thymoquinone (TQ) and thymol (THY) from N. sativa exhibited cytotoxic effects on cancer cells in a dose-dependent manner. Combining THY and TQ showed greater inhibition of cell viability than either component alone. Treatment with the combination also significantly downregulated expression of the AKT and ERK genes involved in proliferation. The findings suggest TQ may improve the efficacy of THY as an adjuvant therapy for lung and breast cancers.
Frizzled-8 receptor is activated by the Wnt-2 ligand in non-small cell lung c...Enrique Moreno Gonzalez
This document summarizes a research study that investigated the activation of Wnt-2 signaling through the Frizzled-8 receptor in non-small cell lung cancer (NSCLC). The study found a correlation between increased expression of Wnt-2 and Frizzled-8 in lung cancer tissue samples. A novel dominant-negative Wnt-2 construct (dnhWnt-2) inhibited Wnt-2 signaling activation and reduced colony formation of NSCLC cells in vitro and tumor growth in a mouse xenograft model. The dnhWnt-2 construct may provide a new therapeutic approach for targeting the Wnt pathway in lung cancer.
Circular RNAs (circRNAs) are a class of non-coding RNAs that can regulate gene expression by interacting with microRNAs (miRNAs). This document reviews the roles of circRNAs in human disorders through circRNA-miRNA interactions. It discusses how specific circRNAs like CDR1as have been found to be dysregulated in neurological disorders, cancers, and cardiovascular diseases and can contribute to disease by sponging up certain miRNAs. The prospect of using circRNAs as biomarkers for disease diagnosis and prognosis is also mentioned.
This document reviews microRNAs (miRNAs) related to the occurrence, diagnosis, and prognosis of non-small cell lung cancer (NSCLC). It discusses how some miRNAs act as oncogenes in NSCLC by promoting proliferation, migration, and invasion through targeting tumor suppressor genes. Other miRNAs act as tumor suppressors by inhibiting oncogenes. The expression levels of certain miRNAs have diagnostic and prognostic value for NSCLC. Some miRNAs show potential as biomarkers for early detection of NSCLC or for distinguishing NSCLC subtypes. Circulating miRNAs may also serve as biomarkers for cancer detection and prognosis. Single nucleotide polymorphisms in miRNA genes have been associated with survival in NSCLC patients.
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...QIAGEN
Epithelial ovarian cancer is the fifth leading cause of cancer-related deaths of women in the United States and Europe and ranks as the second most common type of gynecological malignancy. Most cases are diagnosed in advanced stages and although the response rates to platinum-based chemotherapy are high, the majority of patients nevertheless have poor survival rates. Although the reasons for these poor outcomes are likely to be multifactorial, one particular area of interest has recently focused on hematogenous tumor cell dissemination that has been shown to originate from disseminated tumor cells (DTCs) in the bone marrow (BM) and circulating tumor cells (CTCs) in the blood. Here, we demonstrate that the negative prognostic impact of CTCs and DTCs arise from specific cellular phenotypes and are associated with platinum-resistance and stem cell-associated proteins.
This document discusses genomic oncology and personalized medicine, using lung cancers as a model. It summarizes several key technologies that enable genomic oncology like cDNA microarrays, array CGH, and next generation sequencing. It provides examples of how these technologies have been used to classify cancers like diffuse large B-cell lymphoma and myelodysplastic syndrome, and identify genetic mutations that can guide targeted therapies for cancers like EGFR-mutated lung cancer.
Abnormal expression of Pygopus 2 correlates with a malignant phenotype in hum...Enrique Moreno Gonzalez
Pygopus 2 (Pygo2) is a Pygo family member and an important component of the Wnt signaling transcriptional complex. Despite this data, no clinical studies investigating Pygo2 expression in lung cancer have yet been reported.
1) The study investigated the role of the long non-coding RNA NNT-AS1 in progesterone resistance in endometrial cancer.
2) The researchers found that NNT-AS1 and survivin expression were increased, while miR-542-3p expression was decreased, in progesterone-resistant endometrial cancer cells.
3) Experiments showed that NNT-AS1 regulates progesterone resistance in endometrial cancer by functioning as a competing endogenous RNA for miR-542-3p, thereby regulating survivin expression.
Nigella sativa bioactives against Non-Small Cell Lung Cancer & Breast CancerYusuf Asad
This document summarizes a study on targeting the ERK and AKT pathways in non-small cell lung cancer and triple-negative breast cancer cells with bioactives from Nigella sativa. The study found that thymoquinone (TQ) and thymol (THY) from N. sativa exhibited cytotoxic effects on cancer cells in a dose-dependent manner. Combining THY and TQ showed greater inhibition of cell viability than either component alone. Treatment with the combination also significantly downregulated expression of the AKT and ERK genes involved in proliferation. The findings suggest TQ may improve the efficacy of THY as an adjuvant therapy for lung and breast cancers.
Sequencing 60,000 Samples: An Innovative Large Cohort Study for Breast Cancer...QIAGEN
This slidedeck focuses on the design of a large cohort study for assessing breast cancer risk and how an innovative digital sequencing approach is able to solve the previously unmet challenges of this type of NGS study design. Our speaker, Dr. Fergus J. Couch of the Mayo Clinic, presents on the design of this NCI-funded project, which comprises the sequencing of 60,000 samples to assess the risk of breast cancer through association with targeted genes. The design and size of the study requires an accurate, robust and high-throughput sequencing method. The investigators are using a digital DNA sequencing approach from QIAGEN that incorporates molecular barcodes to tag and remove PCR duplicates and increase NGS assay sensitivity. The approach also uses proprietary chemistry that enables uniform sequencing to efficiently utilize sequencing power and deliver optimized results.
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTDinie Fariz
Next generation sequencing (NGS) has revolutionized cancer treatment by enabling high throughput DNA sequencing. This document discusses several applications of NGS in cancer treatment including whole exome sequencing of tumors from 25 patients to identify genetic mutations, using avatar mouse models to test proposed treatment strategies, detecting mutations in liquid biopsies, and identifying somatic mutations in leukemia patients. Challenges of NGS include analyzing large amounts of data, accurately interpreting variants, and addressing ethical issues.
Next generation sequencing (NGS) has various applications in cancer treatment and research. It can be used to identify novel cancer mutations, detect hereditary cancer syndromes, enable personalized cancer treatment based on a patient's genetic profile, and detect circulating tumor DNA (ctDNA). NGS allows comprehensive analysis of cancer genomes and biomarkers for molecular diagnosis, prognosis, and monitoring treatment response. Challenges include analyzing large amounts of NGS data and accurately interpreting genetic variations, but its clinical utility continues to advance personalized cancer care.
Genes and Tissue Culture Technology - Next Generation Sequencing - Applicatio...Tiong Qi En
A short presentation on the applications of next generation sequencing in cancer treatment. All content displayed and shared remains the courtesy of Taylor's University. Published 17/10/18.
This study analyzed 264 gastric cancers for mutations in exons 9 and 20 of the PIK3CA gene. PIK3CA mutations were found in 42 cases (16%), all heterozygous missense mutations. The most common mutation was H1047R in exon 20 (62% of mutations) and the second most common was Q546K in exon 9 (9.5% of mutations). A meta-analysis of 27 publications found that the ratio of exon 20 to exon 9 mutations varied by cancer type, being highest in gastric cancer. The exon mutation selectivity is a signature of the cancer type.
Assessing the clinical utility of cancer genomic and proteomic data across tu...Gul Muneer
This document summarizes a study that used machine learning to predict cancer patient survival based on integrating multiple types of molecular and clinical data from The Cancer Genome Atlas. The study found that combining molecular data like gene expression, methylation, and mutations with clinical data significantly improved survival prediction for kidney, ovarian, and lung cancers compared to using single data types alone. Analyzing the models provided biological insights into molecular subtypes and markers correlated with survival outcomes. The results suggest that more comprehensive molecular profiling of tumors could help stratify patients and identify targets for personalized cancer treatment.
Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...Gul Muneer
We performed the first proteogenomic study on a prospectively collected colon cancer cohort. Comparative proteomic and phosphoproteomic analysis of paired tumor and normal adjacent tissues produced a catalog of colon cancer-associated proteins and phosphosites, including known and putative new biomarkers, drug targets, and cancer/testis antigens. Proteogenomic integration not only prioritized genomically inferred targets, such as copy-number drivers and mutation-derived neoantigens, but also yielded novel findings. Phosphoproteomics data associated Rb phosphorylation with increased proliferation and decreased apoptosis in colon cancer, which explains why this classical tumor suppressor is amplified in colon tumors and suggests a rationale for targeting Rb phosphorylation in colon cancer. Proteomics identified an association between decreased CD8 T cell infiltration and increased glycolysis in microsatellite instability-high (MSI-H) tumors, suggesting glycolysis as a potential target to overcome the resistance of MSI-H tumors to immune checkpoint blockade. Proteogenomics presents new avenues for biological discoveries and therapeutic development.
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challeng...Yoon Sup Choi
I reviewed recent advances, challenges, and opportunities to implement clinical cancer genomics. Case studies of advanced systems, such as Foundation Medicine, MI-ONCOSEQ are introduced for benchmark. A few fundamental limitations to establish personalized oncology are also discussed.
This document describes a study that generated synthetic spike-in mRNA-Seq data to validate fusion detection methods in cancer gene research. Researchers created artificial fusion transcripts between known cancer genes and incorporated these into cell line RNA at varying concentrations. They then sequenced the samples and analyzed the data using fusion detection tools to establish analytical parameters like sensitivity and specificity. The synthetic spike-ins allowed validation of fusion detection without real tumor samples, providing a reference for evaluating such methods in clinical and diagnostic applications of RNA-Seq.
This document summarizes a study examining the role of tropomyosin-related kinase B (TrkB) in metastatic pancreatic cancer. The study found that TrkB was overexpressed in highly metastatic pancreatic cancer cells compared to parental cells. TrkB overexpression correlated with perineural invasion, positive retroperitoneal margins, and shorter time to liver metastasis in patient samples. The metastatic cells also showed increased activation of ERK1/2 and increased expression of IL-8 and VEGF, which are involved in invasion and metastasis. This suggests TrkB overexpression may promote the aggressive growth and metastasis of pancreatic cancer by activating signaling pathways and increasing expression of genes involved in these processes. TrkB may therefore be a novel therapeutic target for pancreatic cancer.
This document summarizes a study that analyzed abnormal promoter methylation of the adenomatous polyposis coli (APC) gene in Iranian lung cancer patients. The study used a quantitative real-time PCR method called MethyLight to detect DNA methylation of the APC gene promoter in 97 primary lung cancers, 20 lung samples from non-cancer patients, and 43 healthy controls. APC promoter methylation was detected in 47% of tumor samples, 25% of non-cancer lung samples, and 7% of healthy controls. The median methylation level was highest in tumor samples and lowest in healthy controls, with a statistically significant difference. The results suggest aberrant APC gene methylation is correlated with primary lung tumors in
Alternative lengthening of telomeres is enriched in, and impacts survival of ...Joshua Mangerel
This study investigated the prevalence and significance of alternative lengthening of telomeres (ALT) in pediatric brain tumors. The researchers screened 517 pediatric brain tumor samples for ALT using the C-circle assay and validated the results with other assays. They found that ALT was detected in a subset of malignant pediatric brain tumors, especially primitive neuroectodermal tumors, choroid plexus carcinomas, and high-grade gliomas. Somatic mutations in TP53 were strongly associated with ALT. ALT attenuated the poor prognosis associated with TP53 mutations in some tumor types. ALT positive tumors had higher survival rates than ALT negative tumors for children with TP53 mutant malignant gliomas and choroid plexus carcinomas. This suggests ALT may impact survival
Role of tp53 mutations in therapy related acute myeloid leukaemia(t-aml)Mohsin Maqbool
TP53 mutations are highly enriched in therapy-related acute myeloid leukemia (t-AML) compared to de novo AML. The study sequenced genomes from 22 t-AML cases and found a similar mutation burden but a higher frequency of TP53 mutations compared to de novo AML. Further sequencing of 149 genes in 89 additional t-AML/t-MDS cases confirmed TP53 as the most commonly mutated gene. Some t-AML patients were found to have TP53 mutations in samples collected before cytotoxic therapy, suggesting these pre-existing clones are selected for by therapy. Experiments in mouse models also showed HSPCs with TP53 mutations have a competitive advantage after chemotherapy.
The OncoScan(TM) platform for analysis of copy number and somatic mutations i...Lawrence Greenfield
The OncoScan microarray offers high-quality copy number, genotype, and somatic mutation data with whole-genome coverage and high resolution in cancer genes for use with challenging FFPE samples.
1) The study found that the tumor protein p53 regulates the expression of the immune checkpoint protein PDL1 (programmed death ligand 1) via the microRNA miR-34.
2) Delivery of miR-34a in a mouse model of lung cancer using a liposomal formulation (MRX34) reduced PDL1 expression in tumors and increased tumor-infiltrating immune cells.
3) Combining MRX34 with radiation therapy further increased immune cell numbers in tumors and showed potential as a novel cancer therapeutic approach.
This document discusses gene therapy approaches for prostate cancer that have been investigated. It outlines several strategies, including delivering genes to induce cell death or inhibit cell growth, activate the immune system against tumor cells, and target specific gene expression. Clinical trials are evaluating therapies using the herpes simplex virus gene with ganciclovir to activate a prodrug, as well as other approaches to manipulate cell proliferation, apoptosis, angiogenesis, and the immune response. Tissue-specific delivery and regulation of gene expression offer promise for gene therapy in prostate cancer.
This document summarizes recent proteomic studies that have enhanced our understanding of discoidin domain receptors (DDRs). Proteomic profiling has identified phosphorylation of DDR1 and DDR2 in lung, cholangiocarcinoma, and sarcoma tumors, demonstrating their activation in vivo. Studies also suggest crosstalk between DDRs and other receptor tyrosine kinases like EGFR in cancer. Chemical proteomics has identified DDRs as off-target binding partners of kinase inhibitors originally developed for other targets like BCR-ABL, highlighting their potential as therapeutic targets. Together, these proteomic approaches are providing new insights into DDR signaling networks and roles in health and disease.
The Application of Next Generation Sequencing (NGS) in cancer treatmentPremadarshini Sai
Next-generation sequencing (NGS) has several advantages for cancer treatment including high throughput sequencing, screening of multiple genes simultaneously, and decreased costs. NGS faces challenges from complex data analysis and validation of new technologies. Key clinical applications of NGS include whole genome sequencing, transcriptome analysis via RNA-seq, and sequencing of cell-free DNA. Future areas of development include immunotherapy, epigenetics research, and using circulating tumor cells to detect early relapse. More research is still needed to fully realize the potential of NGS in personalized cancer treatment.
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...Gul Muneer
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neutrophils. Lung tumors disrupt bone homeostasis and increase osteoblast activity and bone formation. Osteoblasts amplify tumor-associated SiglecFhigh neutrophils that promote tumor growth through angiogenesis, immunosuppression and other mechanisms. Serum from tumor-bearing mice increases osteoblast activity through elevated sRAGE, which stimulates neutrophil maturation. SiglecFhigh neutrophils correlate with poor survival in lung cancer patients. Therefore, lung tumors communicate with bone through factors like sRAGE to modulate osteoblasts and promote neutrophil-driven tumor progression.
HDAC4 and HDAC7 Promote Breast and Ovarian Cancer Cell Migration by Regulatin...CrimsonpublishersCancer
Breast and ovarian cancer have been remained as a highly malignant tumor among women, posing a serious threat to women health worldwide. In this study, we were aimed to investigate the underlying mechanism of breast and ovarian cancer cell migration. Wound healing assay showed that MDA-MB-231and C13* have higher migration potential compare with MCF-7 and OV2078 cells, as well as regulated epithelial-mesenchymal transition (EMT) marker. We found that HDAC4 and HADC7 mRNA are up regulated in MDA-MB-231 and C13* cells. Moreover, target HDAC4 and HDAC7 by TSA or shRNA block MDA-MB-231and C13* migration. These results reveal a new link between HDACs and EMT in the regulation of breast and ovarian cancer migration.
Post-diagnosis hemoglobin change associates with overall survival of multiple...Enrique Moreno Gonzalez
Anemia refers to low hemoglobin (Hb) level and is a risk factor of cancer patient survival. The National Comprehensive Cancer Network recently suggested that post-diagnosis Hb change, regardless of baseline Hb level, indicates the potential presence of anemia. However, there is no epidemiological study evaluating whether Hb change has direct prognostic values for cancer patients at the population level.
Sequencing 60,000 Samples: An Innovative Large Cohort Study for Breast Cancer...QIAGEN
This slidedeck focuses on the design of a large cohort study for assessing breast cancer risk and how an innovative digital sequencing approach is able to solve the previously unmet challenges of this type of NGS study design. Our speaker, Dr. Fergus J. Couch of the Mayo Clinic, presents on the design of this NCI-funded project, which comprises the sequencing of 60,000 samples to assess the risk of breast cancer through association with targeted genes. The design and size of the study requires an accurate, robust and high-throughput sequencing method. The investigators are using a digital DNA sequencing approach from QIAGEN that incorporates molecular barcodes to tag and remove PCR duplicates and increase NGS assay sensitivity. The approach also uses proprietary chemistry that enables uniform sequencing to efficiently utilize sequencing power and deliver optimized results.
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTDinie Fariz
Next generation sequencing (NGS) has revolutionized cancer treatment by enabling high throughput DNA sequencing. This document discusses several applications of NGS in cancer treatment including whole exome sequencing of tumors from 25 patients to identify genetic mutations, using avatar mouse models to test proposed treatment strategies, detecting mutations in liquid biopsies, and identifying somatic mutations in leukemia patients. Challenges of NGS include analyzing large amounts of data, accurately interpreting variants, and addressing ethical issues.
Next generation sequencing (NGS) has various applications in cancer treatment and research. It can be used to identify novel cancer mutations, detect hereditary cancer syndromes, enable personalized cancer treatment based on a patient's genetic profile, and detect circulating tumor DNA (ctDNA). NGS allows comprehensive analysis of cancer genomes and biomarkers for molecular diagnosis, prognosis, and monitoring treatment response. Challenges include analyzing large amounts of NGS data and accurately interpreting genetic variations, but its clinical utility continues to advance personalized cancer care.
Genes and Tissue Culture Technology - Next Generation Sequencing - Applicatio...Tiong Qi En
A short presentation on the applications of next generation sequencing in cancer treatment. All content displayed and shared remains the courtesy of Taylor's University. Published 17/10/18.
This study analyzed 264 gastric cancers for mutations in exons 9 and 20 of the PIK3CA gene. PIK3CA mutations were found in 42 cases (16%), all heterozygous missense mutations. The most common mutation was H1047R in exon 20 (62% of mutations) and the second most common was Q546K in exon 9 (9.5% of mutations). A meta-analysis of 27 publications found that the ratio of exon 20 to exon 9 mutations varied by cancer type, being highest in gastric cancer. The exon mutation selectivity is a signature of the cancer type.
Assessing the clinical utility of cancer genomic and proteomic data across tu...Gul Muneer
This document summarizes a study that used machine learning to predict cancer patient survival based on integrating multiple types of molecular and clinical data from The Cancer Genome Atlas. The study found that combining molecular data like gene expression, methylation, and mutations with clinical data significantly improved survival prediction for kidney, ovarian, and lung cancers compared to using single data types alone. Analyzing the models provided biological insights into molecular subtypes and markers correlated with survival outcomes. The results suggest that more comprehensive molecular profiling of tumors could help stratify patients and identify targets for personalized cancer treatment.
Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...Gul Muneer
We performed the first proteogenomic study on a prospectively collected colon cancer cohort. Comparative proteomic and phosphoproteomic analysis of paired tumor and normal adjacent tissues produced a catalog of colon cancer-associated proteins and phosphosites, including known and putative new biomarkers, drug targets, and cancer/testis antigens. Proteogenomic integration not only prioritized genomically inferred targets, such as copy-number drivers and mutation-derived neoantigens, but also yielded novel findings. Phosphoproteomics data associated Rb phosphorylation with increased proliferation and decreased apoptosis in colon cancer, which explains why this classical tumor suppressor is amplified in colon tumors and suggests a rationale for targeting Rb phosphorylation in colon cancer. Proteomics identified an association between decreased CD8 T cell infiltration and increased glycolysis in microsatellite instability-high (MSI-H) tumors, suggesting glycolysis as a potential target to overcome the resistance of MSI-H tumors to immune checkpoint blockade. Proteogenomics presents new avenues for biological discoveries and therapeutic development.
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challeng...Yoon Sup Choi
I reviewed recent advances, challenges, and opportunities to implement clinical cancer genomics. Case studies of advanced systems, such as Foundation Medicine, MI-ONCOSEQ are introduced for benchmark. A few fundamental limitations to establish personalized oncology are also discussed.
This document describes a study that generated synthetic spike-in mRNA-Seq data to validate fusion detection methods in cancer gene research. Researchers created artificial fusion transcripts between known cancer genes and incorporated these into cell line RNA at varying concentrations. They then sequenced the samples and analyzed the data using fusion detection tools to establish analytical parameters like sensitivity and specificity. The synthetic spike-ins allowed validation of fusion detection without real tumor samples, providing a reference for evaluating such methods in clinical and diagnostic applications of RNA-Seq.
This document summarizes a study examining the role of tropomyosin-related kinase B (TrkB) in metastatic pancreatic cancer. The study found that TrkB was overexpressed in highly metastatic pancreatic cancer cells compared to parental cells. TrkB overexpression correlated with perineural invasion, positive retroperitoneal margins, and shorter time to liver metastasis in patient samples. The metastatic cells also showed increased activation of ERK1/2 and increased expression of IL-8 and VEGF, which are involved in invasion and metastasis. This suggests TrkB overexpression may promote the aggressive growth and metastasis of pancreatic cancer by activating signaling pathways and increasing expression of genes involved in these processes. TrkB may therefore be a novel therapeutic target for pancreatic cancer.
This document summarizes a study that analyzed abnormal promoter methylation of the adenomatous polyposis coli (APC) gene in Iranian lung cancer patients. The study used a quantitative real-time PCR method called MethyLight to detect DNA methylation of the APC gene promoter in 97 primary lung cancers, 20 lung samples from non-cancer patients, and 43 healthy controls. APC promoter methylation was detected in 47% of tumor samples, 25% of non-cancer lung samples, and 7% of healthy controls. The median methylation level was highest in tumor samples and lowest in healthy controls, with a statistically significant difference. The results suggest aberrant APC gene methylation is correlated with primary lung tumors in
Alternative lengthening of telomeres is enriched in, and impacts survival of ...Joshua Mangerel
This study investigated the prevalence and significance of alternative lengthening of telomeres (ALT) in pediatric brain tumors. The researchers screened 517 pediatric brain tumor samples for ALT using the C-circle assay and validated the results with other assays. They found that ALT was detected in a subset of malignant pediatric brain tumors, especially primitive neuroectodermal tumors, choroid plexus carcinomas, and high-grade gliomas. Somatic mutations in TP53 were strongly associated with ALT. ALT attenuated the poor prognosis associated with TP53 mutations in some tumor types. ALT positive tumors had higher survival rates than ALT negative tumors for children with TP53 mutant malignant gliomas and choroid plexus carcinomas. This suggests ALT may impact survival
Role of tp53 mutations in therapy related acute myeloid leukaemia(t-aml)Mohsin Maqbool
TP53 mutations are highly enriched in therapy-related acute myeloid leukemia (t-AML) compared to de novo AML. The study sequenced genomes from 22 t-AML cases and found a similar mutation burden but a higher frequency of TP53 mutations compared to de novo AML. Further sequencing of 149 genes in 89 additional t-AML/t-MDS cases confirmed TP53 as the most commonly mutated gene. Some t-AML patients were found to have TP53 mutations in samples collected before cytotoxic therapy, suggesting these pre-existing clones are selected for by therapy. Experiments in mouse models also showed HSPCs with TP53 mutations have a competitive advantage after chemotherapy.
The OncoScan(TM) platform for analysis of copy number and somatic mutations i...Lawrence Greenfield
The OncoScan microarray offers high-quality copy number, genotype, and somatic mutation data with whole-genome coverage and high resolution in cancer genes for use with challenging FFPE samples.
1) The study found that the tumor protein p53 regulates the expression of the immune checkpoint protein PDL1 (programmed death ligand 1) via the microRNA miR-34.
2) Delivery of miR-34a in a mouse model of lung cancer using a liposomal formulation (MRX34) reduced PDL1 expression in tumors and increased tumor-infiltrating immune cells.
3) Combining MRX34 with radiation therapy further increased immune cell numbers in tumors and showed potential as a novel cancer therapeutic approach.
This document discusses gene therapy approaches for prostate cancer that have been investigated. It outlines several strategies, including delivering genes to induce cell death or inhibit cell growth, activate the immune system against tumor cells, and target specific gene expression. Clinical trials are evaluating therapies using the herpes simplex virus gene with ganciclovir to activate a prodrug, as well as other approaches to manipulate cell proliferation, apoptosis, angiogenesis, and the immune response. Tissue-specific delivery and regulation of gene expression offer promise for gene therapy in prostate cancer.
This document summarizes recent proteomic studies that have enhanced our understanding of discoidin domain receptors (DDRs). Proteomic profiling has identified phosphorylation of DDR1 and DDR2 in lung, cholangiocarcinoma, and sarcoma tumors, demonstrating their activation in vivo. Studies also suggest crosstalk between DDRs and other receptor tyrosine kinases like EGFR in cancer. Chemical proteomics has identified DDRs as off-target binding partners of kinase inhibitors originally developed for other targets like BCR-ABL, highlighting their potential as therapeutic targets. Together, these proteomic approaches are providing new insights into DDR signaling networks and roles in health and disease.
The Application of Next Generation Sequencing (NGS) in cancer treatmentPremadarshini Sai
Next-generation sequencing (NGS) has several advantages for cancer treatment including high throughput sequencing, screening of multiple genes simultaneously, and decreased costs. NGS faces challenges from complex data analysis and validation of new technologies. Key clinical applications of NGS include whole genome sequencing, transcriptome analysis via RNA-seq, and sequencing of cell-free DNA. Future areas of development include immunotherapy, epigenetics research, and using circulating tumor cells to detect early relapse. More research is still needed to fully realize the potential of NGS in personalized cancer treatment.
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...Gul Muneer
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neutrophils. Lung tumors disrupt bone homeostasis and increase osteoblast activity and bone formation. Osteoblasts amplify tumor-associated SiglecFhigh neutrophils that promote tumor growth through angiogenesis, immunosuppression and other mechanisms. Serum from tumor-bearing mice increases osteoblast activity through elevated sRAGE, which stimulates neutrophil maturation. SiglecFhigh neutrophils correlate with poor survival in lung cancer patients. Therefore, lung tumors communicate with bone through factors like sRAGE to modulate osteoblasts and promote neutrophil-driven tumor progression.
HDAC4 and HDAC7 Promote Breast and Ovarian Cancer Cell Migration by Regulatin...CrimsonpublishersCancer
Breast and ovarian cancer have been remained as a highly malignant tumor among women, posing a serious threat to women health worldwide. In this study, we were aimed to investigate the underlying mechanism of breast and ovarian cancer cell migration. Wound healing assay showed that MDA-MB-231and C13* have higher migration potential compare with MCF-7 and OV2078 cells, as well as regulated epithelial-mesenchymal transition (EMT) marker. We found that HDAC4 and HADC7 mRNA are up regulated in MDA-MB-231 and C13* cells. Moreover, target HDAC4 and HDAC7 by TSA or shRNA block MDA-MB-231and C13* migration. These results reveal a new link between HDACs and EMT in the regulation of breast and ovarian cancer migration.
Post-diagnosis hemoglobin change associates with overall survival of multiple...Enrique Moreno Gonzalez
Anemia refers to low hemoglobin (Hb) level and is a risk factor of cancer patient survival. The National Comprehensive Cancer Network recently suggested that post-diagnosis Hb change, regardless of baseline Hb level, indicates the potential presence of anemia. However, there is no epidemiological study evaluating whether Hb change has direct prognostic values for cancer patients at the population level.
Social Media Strategy for International NGOs & UniversitiesFastPivot
astPivot’s CEO & Co-Founder, Matthew Ledford opened with a high level overview of those social media platforms currently being used by the majority of the world’s population. FastPivot’s Director of Social Media Communications, Jonathan Poston was next in line; he presented three university case studies (LNU-MSU College of International Business, Universidad de Espirtu Santo International Careers Program, Eastern Illinois University), which demonstrated unique strategies by which universities employ to implement effective social media marketing campaigns. Weidong “Jim” Zhang, Admissions Counselor at Maharishi University of Management, discussed “how to use Chinese social media to recruit Chinese students.”
Este documento describe los diferentes tipos de usos no aprobados de medicamentos recetados. Existen dos tipos principales: 1) usar un medicamento aprobado para una enfermedad para tratar una enfermedad diferente, y 2) recetar un medicamento para tratar la enfermedad para la que fue aprobado pero ignorando ciertas especificaciones. Aunque los usos no aprobados son legales, a menudo carecen de evidencia y pueden ser inapropiados o riesgosos.
Organic Gardening for Primary Schools
`
For more information, Please see websites below:
`
Organic Edible Schoolyards & Gardening with Children
http://scribd.com/doc/239851214
`
Double Food Production from your School Garden with Organic Tech
http://scribd.com/doc/239851079
`
Free School Gardening Art Posters
http://scribd.com/doc/239851159`
`
Increase Food Production with Companion Planting in your School Garden
http://scribd.com/doc/239851159
`
Healthy Foods Dramatically Improves Student Academic Success
http://scribd.com/doc/239851348
`
City Chickens for your Organic School Garden
http://scribd.com/doc/239850440
`
Simple Square Foot Gardening for Schools - Teacher Guide
http://scribd.com/doc/239851110
Nitroglycerin 0.4% ointment vs placebo in the treatment of pain resulting fro...Enrique Moreno Gonzalez
This randomized, double-blind, placebo-controlled study compared nitroglycerin (NTG) 0.4% ointment to placebo for treating pain from chronic anal fissures. 247 patients applied either NTG or placebo ointment twice daily for 21 days. The primary outcome was change in pain levels from days 14-18. While the prespecified analysis found no difference, post hoc analyses found NTG reduced pain more than placebo. Headache was the most common side effect. This was the first such study to control for analgesics used to treat NTG-induced headaches, finding NTG 0.4% effectively reduced chronic anal fissure pain compared to placebo.
Anti-lymphangiogenic properties of mTOR inhibitors in head and neck squamous ...Enrique Moreno Gonzalez
Tumor dissemination to cervical lymph nodes via lymphatics represents the first step in the metastasis of head and neck squamous cell carcinoma (HNSCC) and is the most significant predictor of tumor recurrence decreasing survival by 50%. The lymphatic suppressing properties of mTOR inhibitors are not yet well understood.
The cysteinyl leukotriene 2 receptor contributes to all-trans retinoic acid-i...Enrique Moreno Gonzalez
Cysteinyl leukotrienes (CysLTs) are potent pro-inflammatory mediators that are increased in samples from patients with inflammatory bowel diseases (IBDs). Individuals with IBDs have enhanced susceptibility to colon carcinogenesis. In colorectal cancer, the balance between the pro-mitogenic cysteinyl leukotriene 1 receptor (CysLT1R) and the differentiation-promoting cysteinyl leukotriene 2 receptor (CysLT2R) is lost. Further, our previous data indicate that patients with high CysLT1R and low CysLT2R expression have a poor prognosis. In this study, we examined whether the balance between CysLT1R and CysLT2R could be restored by treatment with the cancer chemopreventive agent all-trans retinoic acid (ATRA).
Sox2 suppresses the invasiveness of breast cancer cells via a mechanism that ...Enrique Moreno Gonzalez
Sox2, an embryonic stem cell marker, is aberrantly expressed in a subset of breast cancer (BC). While the aberrant expression of Sox2 has been shown to significantly correlate with a number of clinicopathologic parameters in BC, its biological significance in BC is incompletely understood.
Perceived benefits and barriers to exercise for recently treated patients wit...Enrique Moreno Gonzalez
Understanding the physical activity experiences of patients with multiple myeloma (MM) is essential to inform the development of evidence-based interventions and to quantify the benefits of physical activity. The aim of this study was to gain an in-depth understanding of the physical activity experiences and perceived benefits and barriers to physical activity for patients with MM.
Fatty liver index correlates with non-alcoholic fatty liver disease, but not ...Enrique Moreno Gonzalez
Fatty liver index (FLI) was recently established to predict non-alcoholic fatty liver disease (NAFLD) in general population, which is known to be associated with coronary artery atherosclerotic disease (CAD).
This study aims to investigate whether FLI correlates with NAFLD and with newly diagnosed CAD in a special Chinese population who underwent coronary angiography.
Sticky siRNAs targeting survivin and cyclin B1 exert an antitumoral effect on...Enrique Moreno Gonzalez
Melanoma represents one of the most aggressive and therapeutically challenging malignancies as it often gives rise to metastases and develops resistance to classical chemotherapeutic agents. Although diverse therapies have been generated, no major improvement of the patient prognosis has been noticed. One promising alternative to the conventional therapeutic approaches currently available is the inactivation of proteins essential for survival and/or progression of melanomas by means of RNA interference. Survivin and cyclin B1, both involved in cell survival and proliferation and frequently deregulated in human cancers, are good candidate target genes for siRNA mediated therapeutics.
Chemokine (C-X-C) ligand 1 (CXCL1) protein expression is increased in aggress...Enrique Moreno Gonzalez
This study examined CXCL1 protein expression in 152 bladder tissue samples, including 142 cancer samples and 10 benign samples, using immunohistochemical staining. The key findings were:
1) CXCL1 protein expression was present in cancerous bladder tissues but entirely absent in benign bladder tissues.
2) CXCL1 expression was significantly higher in high-grade and high-stage tumors compared to low-grade and low-stage tumors.
3) Increased CXCL1 expression was associated with reduced disease-specific survival and overall survival.
So in summary, this study found that CXCL1 protein expression is increased in more aggressive bladder cancers and associated with poorer survival outcomes. This suggests CXCL1 may play a
Intensity-modulated radiotherapy with simultaneous modulated accelerated boos...Enrique Moreno Gonzalez
To present our experience of intensity-modulated radiotherapy (IMRT) with simultaneous modulated accelerated radiotherapy (SMART) boost technique in patients with nasopharyngeal carcinoma (NPC).
Intraepithelial lymphocyte distribution differs between the bulb and the seco...Enrique Moreno Gonzalez
Evaluation of intraepithelial duodenal lymphocytosis (IDL) is important in celiac disease (CD). There is no established cut-off value for increased number of IELs in the bulb. We therefore investigated the relation between IEL counts in the bulb and duodenal specimens in non-celiac subjects.
Antibiotic exposure and the development of coeliac disease: a nationwide case...Enrique Moreno Gonzalez
The intestinal microbiota has been proposed to play a pathogenic role in coeliac disease (CD). Although antibiotics are common environmental factors with a profound impact on intestinal microbiota, data on antibiotic use as a risk factor for subsequent CD development are scarce.
Association between variations in the fat mass and obesity-associated gene an...Enrique Moreno Gonzalez
It is clear that genetic variations in the fat mass and obesity-associated (FTO) gene affect body mass index and the risk of obesity. Given the mounting evidence showing a positive association between obesity and pancreatic cancer, this study aimed to investigate the relation between variants in the FTO gene, obesity and pancreatic cancer risk.
Clinical features and outcome of cryptogenic hepatocellular carcinoma compare...Enrique Moreno Gonzalez
Cryptogenic hepatocellular carcinoma (HCC) is thought to arise due to non-alcoholic fatty liver disease (NAFLD). This study investigated the prevalence, clinical features, and outcomes of cryptogenic HCC and compared them with those of HCC related to hepatitis B virus infection (HBV-HCC), hepatitis C virus infection (HCV-HCC), and alcohol (ALCHCC) in Korea.
A phase I/II trial to evaluate the safety, feasibility and activity of salvag...Enrique Moreno Gonzalez
The current standard treatment of patients with relapsed or refractory diffuse large cell B-Cell lymphoma (DLBCL) primarily consists of intensified salvage therapy and, if the disease is chemo-sensitive, high dose therapy followed with autologous stem cell transplantation. In the rituximab era however, this treatment approach has shown only limited benefit. In particular, patients relapsing after rituximab-containing primary treatment have an adverse prognosis, especially if this occurs within the first year after therapy or if the disease is primarily refractory. Therefore there is an ultimate need for improved salvage treatment approaches.
Implication from thyroid function decreasing during chemotherapy in breast ca...Enrique Moreno Gonzalez
Thyroid hormones have been shown to regulate breast cancer cells growth, the absence or reduction of thyroid hormones in cells could provoke a proliferation arrest in G0-G1 or weak mitochondrial activity, which makes cells insensitive to therapies for cancers through transforming into low metabolism status. This biological phenomenon may help explain why treatment efficacy and prognosis vary among breast cancer patients having hypothyroid, hyperthyroid and normal function. Nevertheless, the abnormal thyroid function in breast cancer patients has been considered being mainly caused by thyroid diseases, few studied influence of chemotherapy on thyroid function and whether its alteration during chemotherapy can influence the respose to chemotherapy is still unclear. So, we aimed to find the alterations of thyroid function and non-thyroidal illness syndrome (NTIS) prevalence druing chemotherapy in breast cancer patients, and investigate the influence of thyroid hormones on chemotherapeutic efficacy.
Epigenetic regulation and role of metastasis suppressor genes in pancreatic d...Enrique Moreno Gonzalez
Pancreatic ductal adenocarcinoma (PDAC) is distinguished by rapid dissemination. Thus, genetic and/or epigenetic deregulation of metastasis suppressor genes (MSG) is a likely event during early pancreatic carcinogenesis and a potential diagnostic marker for the disease. We investigated 9 known MSGs for their role in the dissemination of PDAC and examined their promoters for methylation and its use in PDAC detection.
Translation of microarray data into clinically relevant cancer diagnostic tes...Tapan Baral
This study aimed to develop a simple and inexpensive diagnostic test to distinguish between malignant pleural mesothelioma (MPM) and lung adenocarcinoma (ADCA) based on gene expression ratios, as current methods can be challenging. The researchers used microarray data from 31 MPM and 150 ADCA samples to identify genes with highly correlated expression levels between the two cancer types. They tested the accuracy of diagnostic ratios formed from combinations of two or three of these genes in differentiating between MPM and ADCA in 149 additional samples. Using two or three gene expression ratios achieved 95% and 99% accurate differential diagnosis, respectively, demonstrating this approach may provide a clinically useful diagnostic tool.
Deadenylase Expression in Small Cell Lung Cancer Related To Clinical Characte...JohnJulie1
Lung cancer is the second common malignancy and the most aggressive cancer worldwide with late diagnosis and poor prognosis. The search for biomarkers that promote early diagnosis and improve therapeutic strategies focuses to the understanding of the mechanisms underlying cancer development and progression. The deregulation of gene expression is one of the cancer hallmarks reflected to the stability...
Deadenylase Expression in Small Cell Lung Cancer Related To Clinical Characte...AnonIshanvi
Lung cancer is the second common malignancy and the most aggressive cancer worldwide with late diagnosis and poor prognosis. The search for biomarkers that promote early diagnosis and improve therapeutic strategies focuses to the understanding of the mechanisms underlying cancer development and progression
Deadenylase Expression in Small Cell Lung Cancer Related To Clinical Characte...daranisaha
Lung cancer is the second common malignancy and the most aggressive cancer worldwide with late diagnosis and poor prognosis. The search for biomarkers that promote early diagnosis and improve therapeutic strategies focuses to the understanding of the mechanisms underlying cancer development and progression. The deregulation of gene expression is one of the cancer hallmarks reflected to the stability...
Deadenylase Expression in Small Cell Lung Cancer Related To Clinical Characte...EditorSara
Lung cancer is the second common malignancy and the most aggressive cancer worldwide with late diagnosis and poor prognosis. The search for biomarkers that promote early diagnosis and improve therapeutic strategies focuses to the understanding of the mechanisms underlying cancer development and progression. The deregulation of gene expression is one of the cancer hallmarks reflected to the stability..
Deadenylase Expression in Small Cell Lung Cancer Related To Clinical Characte...semualkaira
Lung cancer is the second common malignancy and the most aggressive cancer worldwide with late diagnosis and poor prognosis. The search for biomarkers that promote early diagnosis and improve therapeutic strategies focuses to the understanding of the mechanisms underlying cancer development and progression. The deregulation of gene expression is one of the cancer hallmarks reflected to the stability..
Deadenylase Expression in Small Cell Lung Cancer Related To Clinical Characte...semualkaira
Lung cancer is the second common malignancy and the most aggressive cancer worldwide with late diagnosis and poor prognosis. The search for biomarkers that promote early diagnosis and improve therapeutic strategies focuses to the understanding of the mechanisms underlying cancer development and progression. The deregulation of gene expression is one of the cancer hallmarks reflected to the stability...
Deadenylase Expression in Small Cell Lung Cancer Related To Clinical Characte...NainaAnon
This study examined the expression levels of deadenylases in small cell lung cancer (SCLC) clinical samples and their correlation to patient clinical characteristics and survival. Real-time PCR analysis found that the deadenylases PARN, CNOT6, CNOT7, and NOC were differentially expressed between malignant and normal lung tissue samples. Higher expression levels of PARN, CNOT6, and CNOT7 correlated with older patient age and decreased overall survival of 180 days or less. The results suggest these deadenylases may serve as prognostic biomarkers for SCLC patient outcomes.
Odontogenic ameloblast-associated protein (ODAM) inhibits growth and migratio...Enrique Moreno Gonzalez
The Odontogenic Ameloblast-associated Protein (ODAM) is expressed in a wide range of
normal epithelial, and neoplastic tissues, and we have posited that ODAM serves as a novel
prognostic biomarker for breast cancer and melanoma. Transfection of ODAM into breast
cancer cells yields suppression of cellular growth, motility, and in vivo tumorigenicity.
Herein we have extended these studies to the effects of ODAM on cultured melanoma cell
lines.
This study investigated the combination of carboplatin and the Mdm2 inhibitor Nutlin-3a for treating triple-negative breast cancer (TNBC). In vitro, carboplatin and Nutlin-3a showed strong synergy in promoting cell death in TNBC cells. Combination treatment led to increased DNA damage (gH2AX) and Mdm2 localization to chromatin. In a mouse model of human TNBC, combination treatment significantly reduced primary tumor growth and lung metastases compared to single agents, with minimal toxicity. The results suggest that targeting Mdm2 is a promising approach for improving carboplatin therapy for TNBC.
Propolis with its active component CAPE (Caffeic Acid Phenethyl Ester) stops breast cancer cell growth. These results of CAPE are present in the naturopathic formulation
of propolis, a widely available natural substance with an extended safety record, making it a naturally-occurring and readily available epigenetic agent with great potential in breast cancer and oncology in general. The ability to link the biological effects of a naturopathic remedy to the pharmacologic effects seen with an exciting class of drugs in the treatment of cancer opens the door to a host of new therapeutic opportunities for patients.
As an uncommon malignant tumor, hypopharyngeal cancer accounts for 3–5% of head and neck tumors [1]. Most pathological types of hypopharyngeal cancer are squamous cell carcinoma. Due to the occult anatomical location of hypopharyngeal cancer and poor surgical effect, local recurrence or distant metastasis often occurs in patients with hypopharyngeal cancer following surgery.
This study explored the role of miR-630 in enhancing the chemotherapeutic sensitivity of BRCA1 mutant triple-negative breast cancer (TNBC) cell lines. The researchers found that combining carboplatin and gemcitabine chemotherapy with the PARP inhibitor olaparib upregulated miR-630 expression in BRCA1 mutant MDA-MB-436 and HCC1937 TNBC cell lines. Overexpression of miR-630 suppressed cell proliferation, migration, and invasion, whereas inhibition of miR-630 increased these effects. Therefore, miR-630 plays an important tumor suppressor role in increasing the chemotherapeutic sensitivity of PARP inhibitors for BRCA1 mutant TNBC, which may be one mechanism of how PAR
Cancer Immunol Res-2015-Manuel-2326-6066.CIR-14-0214 (3)Melanie Lampa
The combination of Salmonella-based therapy targeting indoleamine 2,3-dioxygenase (shIDO-ST) and an enzyme (PEGPH20) that depletes tumor hyaluronan (HA) induced complete regression of aggressive pancreatic tumors in mouse models. Mice treated with this combination showed significant decreases in tumor burden and extended survival, with 30-60% of mice showing no evidence of tumors 8 weeks after treatment. In contrast, other treatment combinations including monotherapies were not effective. The combination of shIDO-ST and PEGPH20 appeared to facilitate entry of bacteria and activated immune cells into otherwise impermeable tumors, highlighting its potential as an effective treatment for pancreatic cancer.
This document discusses a study analyzing the distribution of promoter hypermethylation of the p16 gene in male and female colorectal cancer patients in Kashmir, India. The study found different p16 promoter hypermethylation profiles in male and female patients, with occurrence being more frequent in males than females, though not statistically significant. Promoter hypermethylation of p16 was significantly associated with colorectal cancer in both sexes. The study aimed to contribute to understanding the role of epigenetic changes in colorectal cancer development and progression.
BRCA1 Promoter Methylation and Clinicopathological Characteristics in Sporadi...UniversitasGadjahMada
1) The study investigated BRCA1 promoter methylation and its association with clinicopathological characteristics in 56 Indonesian breast cancer patients.
2) BRCA1 promoter methylation was detected in 48 of 56 (85%) patients. Lower BRCA1 mRNA expression was associated with higher methylation levels, suggesting epigenetic silencing of BRCA1.
3) However, no significant associations were found between methylation levels, BRCA1 expression, and clinicopathological factors like tumor stage or size. This study provides the first analysis of BRCA1 methylation in an Indonesian breast cancer population.
Association of common palb2 polymorphisms with ovarian cancer a case control ...IJARIIT
Background: The partner and localizer of breast cancer 2 (PALB2) has an essential role in BRCA2 mediated DNA
double-strand break repair by serving as a bridging molecule and acting as the physical and functional link between BRCA1&
2 proteins. Truncating mutations in the PALB2 gene are rare but are thought to be associated with increased risk of developing
breast and /or ovarian cancer in different populations. The present study was designed to investigate the variants of PALB2 and
their association with OC.
Material &Methods: A total of 150 histopathologically confirmed ovarian cancer patients and 250 healthy age matched controls
were collected. Three SNPs c.2794 G/A( rs45624036), c.1010 T/C(rs45494092), and c.1676A/G(rs152451) of PALB2 gene were
selected and genotyped by ARMS-PCR followed by agarose gel electrophoresis. Appropriate statistical tests were applied to test
for the significance of the results.
Results: A significant association of G/A (rs45624036) in inheritance models was observed & at the allelic level, the A allele
conferred four-fold increased risk compared to G allele. Regarding T/C (rs45494092) polymorphism all the models revealed an
association with OC and C allele showing eight-fold increased risk. With respect to A/G (rs152451) polymorphism, the protective
role was observed in tested inheritance models in OC patients.
The Haplo analysis for the combination of all the three variants revealed increased risk with A-T-A and G-C-G
haplotypes.(OR=4.50 ;95%CI 1.85-10.94;p=0.001,OR=26.36 ;95%CI 2.33 -297.91;p= 0.0085), whereas other haplotypes
conferred a protective role in OC.
Conclusions: The present study suggests an essential role of PALB2 in the etiology of ovarian cancer.
Incidence of pneumonia and risk factors among patients with head and neck can...Enrique Moreno Gonzalez
This study investigated the incidence and patient- and treatment-related risk factors related to pneumonia acquired during radiotherapy (PNRT) in head and neck cancer (HNC) patients.
Gene expression analysis of a Helicobacter pyloriinfected and high-salt diet-...Enrique Moreno Gonzalez
Helicobacter pylori (H. pylori) infection and excessive salt intake are known as important risk factors for stomach cancer in humans. However, interactions of these two factors with gene expression profiles during gastric carcinogenesis remain unclear. In the present study, we investigated the global gene expression associated with stomach carcinogenesis and prognosis of human gastric cancer using a mouse model.
Acute myeloid leukemia (AML) is a hematopoietic malignancy with a dismal outcome in the majority of cases. A detailed understanding of the genetic alterations and gene expression changes that contribute to its pathogenesis is important to improve prognostication, disease monitoring, and therapy. In this context, leukemia-associated misexpression of microRNAs (miRNAs) has been studied, but no coherent picture has emerged yet, thus warranting further investigations.
Recently, a phase II clinical trial in hepatocellular carcinoma (HCC) has suggested that the combination of sorafenib and 5-fluorouracil (5-FU) is feasible and side effects are manageable. However, preclinical experimental data explaining the interaction mechanism(s) are lacking. Our objective is to investigate the anticancer efficacy and mechanism of combined sorafenib and 5-FU therapy in vitro in HCC cell lines MHCC97H and SMMC-7721.
Differences in microRNA expression during tumor development in the transition...Enrique Moreno Gonzalez
The prostate is divided into three glandular zones, the peripheral zone (PZ), the transition zone (TZ), and the central zone. Most prostate tumors arise in the peripheral zone (70-75%) and in the transition zone (20-25%) while only 10% arise in the central zone. The aim of this study was to investigate if differences in miRNA expression could be a possible explanation for the difference in propensity of tumors in the zones of the prostate.
Multicentric and multifocal versus unifocal breast cancer: differences in the...Enrique Moreno Gonzalez
This study compared the expression of E-cadherin, β-catenin, and MUC1 in multicentric/multifocal breast cancers versus unifocal breast cancers of identical tumor size and grade. The study found significantly downregulated expression of E-cadherin in multicentric/multifocal cancers compared to unifocal cancers. In contrast, no significant differences were seen in β-catenin expression between the two groups. Within the unifocal group, E-cadherin and β-catenin expression were positively correlated, but this was not seen in the multicentric/multifocal group. The results suggest multicentric/multifocal and unifocal breast cancers differ in E-
The life in sight application study (LISA): design of a randomized controlled...Enrique Moreno Gonzalez
It is widely recognized that spiritual care plays an important role in physical and psychosocial well-being of cancer patients, but there is little evidence based research on the effects of spiritual care. We will conduct a randomized controlled trial on spiritual care using a brief structured interview scheme supported by an e-application. The aim is to examine whether an assisted reflection on life events and ultimate life goals can improve quality of life of cancer patients.
Clinical and experimental studies regarding the expression and diagnostic val...Enrique Moreno Gonzalez
Carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) is a multifunctional Ig-like cell adhesion molecule that has a wide range of biological functions. According to previous reports, serum CEACAM1 is dysregulated in different malignant tumours and associated with tumour progression. However, the serum CEACAM1 expression in nonsmall-cell lung carcinomas (NSCLC) is unclear. The different expression ratio of CEACAM1-S and CEACAM1-L isoform has seldom been investigated in NSCLC. This research is intended to study the serum CEACAM1 and the ratio of CEACAM1-S/L isoforms in NSCLC.
Assessment of preoperative exercise capacity in hepatocellular carcinoma pati...Enrique Moreno Gonzalez
Cardiopulmonary exercise testing measures oxygen uptake at increasing levels of work and predicts cardiopulmonary performance under conditions of stress, such as after abdominal surgery. Dynamic assessment of preoperative exercise capacity may be a useful predictor of postoperative prognosis. This study examined the relationship between preoperative exercise capacity and event-free survival in hepatocellular carcinoma (HCC) patients with chronic liver injury who underwent hepatectomy.
Overexpression of YAP 1 contributes to progressive features and poor prognosi...Enrique Moreno Gonzalez
Yes-associated protein 1 (YAP 1), the nuclear effector of the Hippo pathway, is a key regulator of organ size and a candidate human oncogene in multiple tumors. However, the expression dynamics of YAP 1 in urothelial carcinoma of the bladder (UCB) and its clinical/prognostic significance are unclear.
CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1a...Enrique Moreno Gonzalez
Glioblastomas, the most common and malignant brain tumors of the central nervous system, exhibit high invasive capacity, which hinders effective therapy. Therefore, intense efforts aimed at improved therapeutics are ongoing to delineate the molecular mechanisms governing glioma cell migration and invasion.
Differentiation of irradiation and cetuximab induced skin reactions in patien...Enrique Moreno Gonzalez
In order to improve the clinical outcome of patients with locally advanced squamous cell carcinoma of the head and neck (LASCCHN) not being capable to receive platinum-based chemoradiation, radiotherapy can be intensified by addition of cetuximab, a monoclonal antibody that blocks the epidermal growth factor receptor (EGFR). The radioimmunotherapy with cetuximab is a feasible treatment option showing a favourable toxicity profile. The most frequent side effect of radiotherapy is radiation dermatitis, the most common side effect of treatment with cetuximab is acneiform rash. Incidence and severity of these frequent, often overlapping and sometimes limiting skin reactions, however, are not well explored. A clinical and molecular differentiation between radiogenic skin reactions and skin reactions caused by cetuximab which may correlate with outcome, have never been described before.
Cholestasis induces reversible accumulation of periplakin in mouse liverEnrique Moreno Gonzalez
Periplakin (PPL) is a rod-shaped cytolinker protein thought to connect cellular adhesion junctional complexes to cytoskeletal filaments. PPL serves as a structural component of the cornified envelope in the skin and interacts with various types of proteins in cultured cells; its level decreases dramatically during tumorigenic progression in human epithelial tissues. Despite these intriguing observations, the physiological roles of PPL, especially in noncutaneous tissues, are still largely unknown. Because we observed a marked fluctuation of PPL expression in mouse liver in association with the bile acid receptor farnesoid X receptor (FXR) and cholestasis, we sought to characterize the role of PPL in the liver and determine its contributions to the etiology and pathogenesis of cholestasis.
Functional p53 is required for rapid restoration of daunorubicin-induced lesi...Enrique Moreno Gonzalez
This document summarizes a research article that studied the role of p53 in daunorubicin (DNR)-induced lesions in the spleen. The key findings were:
1) DNR treatment caused more rapid cell death and weight loss in the spleens of wild type mice compared to p53-null mice.
2) While wild type mouse spleens recovered normal morphology 8 days after DNR treatment, p53-null mouse spleens still had large necrotic lesions.
3) DNR treatment increased p21 levels in wild type mice but not p53-null mice, indicating p53 is required for p21 induction.
4) The results suggest p53
Cost-effectiveness of MRI for breast cancer screening in BRCA1/2 mutation car...Enrique Moreno Gonzalez
Women with mutations in BRCA1 or BRCA2 are at high risk of developing breast cancer and, in British Columbia, Canada, are offered screening with both magnetic resonance imaging (MRI) and mammography to facilitate early detection. MRI is more sensitive than mammography but is more costly and produces more false positive results. The purpose of this study was to calculate the cost-effectiveness of MRI screening for breast cancer in BRCA1/2 mutation carriers in a Canadian setting.
Impaired mitochondrial beta-oxidation in patients with chronic hepatitis C: r...Enrique Moreno Gonzalez
Hepatic steatosis is often seen in patients with chronic hepatitis C (CH-C). It is still unclear whether these patients have an impaired mitochondrial β-oxidation. In this study we assessed mitochondrial β-oxidation in CH-C patients by investigating ketogenesis during fasting.
Este documento presenta la laudatio del Dr. Enrique Moreno González, quien recibe el grado de Doctor Honoris Causa de la Universidad de Málaga. Resalta la trayectoria académica y profesional del Dr. Moreno, incluyendo sus logros en cirugía hepática y de trasplantes, sus cargos y distinciones, y su dedicación a la enseñanza. El orador destaca al Dr. Moreno como pionero quirúrgico, maestro, y persona comprometida con mejorar la atención médica a través
Optimal schedule of Bacillus Calmette-Guerin for non-muscle-invasive bladder ...Enrique Moreno Gonzalez
To explore the necessity of maintenance, efficacy of low-dose and superiority of various combination therapies of Bacillus Calmette-Guérin (BCG) in treatment of superficial bladder cancer (BCa).
Environment inside even a small tumor is characterized by total (anoxia) or partial oxygen deprivation, hypoxia. It has been shown that radiotherapy and some conventional chemotherapies may be less effective in hypoxia, and therefore it is important to investigate how different drugs act in different microenvironments. In this study we perform a large screening of the effects of 19 clinically used or experimental chemotherapeutic drugs on four different cell lines in conditions of normoxia, hypoxia and anoxia.
NAVIGATING THE HORIZONS OF TIME LAPSE EMBRYO MONITORING.pdfRahul Sen
Time-lapse embryo monitoring is an advanced imaging technique used in IVF to continuously observe embryo development. It captures high-resolution images at regular intervals, allowing embryologists to select the most viable embryos for transfer based on detailed growth patterns. This technology enhances embryo selection, potentially increasing pregnancy success rates.
Breast cancer: Post menopausal endocrine therapyDr. Sumit KUMAR
Breast cancer in postmenopausal women with hormone receptor-positive (HR+) status is a common and complex condition that necessitates a multifaceted approach to management. HR+ breast cancer means that the cancer cells grow in response to hormones such as estrogen and progesterone. This subtype is prevalent among postmenopausal women and typically exhibits a more indolent course compared to other forms of breast cancer, which allows for a variety of treatment options.
Diagnosis and Staging
The diagnosis of HR+ breast cancer begins with clinical evaluation, imaging, and biopsy. Imaging modalities such as mammography, ultrasound, and MRI help in assessing the extent of the disease. Histopathological examination and immunohistochemical staining of the biopsy sample confirm the diagnosis and hormone receptor status by identifying the presence of estrogen receptors (ER) and progesterone receptors (PR) on the tumor cells.
Staging involves determining the size of the tumor (T), the involvement of regional lymph nodes (N), and the presence of distant metastasis (M). The American Joint Committee on Cancer (AJCC) staging system is commonly used. Accurate staging is critical as it guides treatment decisions.
Treatment Options
Endocrine Therapy
Endocrine therapy is the cornerstone of treatment for HR+ breast cancer in postmenopausal women. The primary goal is to reduce the levels of estrogen or block its effects on cancer cells. Commonly used agents include:
Selective Estrogen Receptor Modulators (SERMs): Tamoxifen is a SERM that binds to estrogen receptors, blocking estrogen from stimulating breast cancer cells. It is effective but may have side effects such as increased risk of endometrial cancer and thromboembolic events.
Aromatase Inhibitors (AIs): These drugs, including anastrozole, letrozole, and exemestane, lower estrogen levels by inhibiting the aromatase enzyme, which converts androgens to estrogen in peripheral tissues. AIs are generally preferred in postmenopausal women due to their efficacy and safety profile compared to tamoxifen.
Selective Estrogen Receptor Downregulators (SERDs): Fulvestrant is a SERD that degrades estrogen receptors and is used in cases where resistance to other endocrine therapies develops.
Combination Therapies
Combining endocrine therapy with other treatments enhances efficacy. Examples include:
Endocrine Therapy with CDK4/6 Inhibitors: Palbociclib, ribociclib, and abemaciclib are CDK4/6 inhibitors that, when combined with endocrine therapy, significantly improve progression-free survival in advanced HR+ breast cancer.
Endocrine Therapy with mTOR Inhibitors: Everolimus, an mTOR inhibitor, can be added to endocrine therapy for patients who have developed resistance to aromatase inhibitors.
Chemotherapy
Chemotherapy is generally reserved for patients with high-risk features, such as large tumor size, high-grade histology, or extensive lymph node involvement. Regimens often include anthracyclines and taxanes.
“Psychiatry and the Humanities”: An Innovative Course at the University of Mo...Université de Montréal
“Psychiatry and the Humanities”: An Innovative Course at the University of Montreal Expanding the medical model to embrace the humanities. Link: https://www.psychiatrictimes.com/view/-psychiatry-and-the-humanities-an-innovative-course-at-the-university-of-montreal
The skin is the largest organ and its health plays a vital role among the other sense organs. The skin concerns like acne breakout, psoriasis, or anything similar along the lines, finding a qualified and experienced dermatologist becomes paramount.
Computer in pharmaceutical research and development-Mpharm(Pharmaceutics)MuskanShingari
Statistics- Statistics is the science of collecting, organizing, presenting, analyzing and interpreting numerical data to assist in making more effective decisions.
A statistics is a measure which is used to estimate the population parameter
Parameters-It is used to describe the properties of an entire population.
Examples-Measures of central tendency Dispersion, Variance, Standard Deviation (SD), Absolute Error, Mean Absolute Error (MAE), Eigen Value
STUDIES IN SUPPORT OF SPECIAL POPULATIONS: GERIATRICS E7shruti jagirdar
Unit 4: MRA 103T Regulatory affairs
This guideline is directed principally toward new Molecular Entities that are
likely to have significant use in the elderly, either because the disease intended
to be treated is characteristically a disease of aging ( e.g., Alzheimer's disease) or
because the population to be treated is known to include substantial numbers of
geriatric patients (e.g., hypertension).
Summer is a time for fun in the sun, but the heat and humidity can also wreak havoc on your skin. From itchy rashes to unwanted pigmentation, several skin conditions become more prevalent during these warmer months.
2. Overexpression of peptide deformylase in breast,
colon, and lung cancers
Harsharan Randhawa1,†
Email: Harsharan.Randhawa@my.ndsu.edu
Shireen Chikara1,†
Email: Shireen.Chikara@my.ndsu.edu
Drew Gehring1
Email: drew.gehring@unmc.edu
Tuba Yildirim2
Email: yildirimt55@gmail.com
Jyotsana Menon3
Email: Sukumarakurup.Krishnakumar@ndsu.edu
Katie M Reindl1*
*
Corresponding author
Email: Katie.Reindl@ndsu.edu
1
Department of Biological Sciences, North Dakota State University, Fargo, ND,
USA
2
Department of Biology, Faculty of Art and Science, Amasya University,
Amasya, Turkey
3
Ben May Department for Cancer Research, University of Chicago, Chicago, IL,
USA
†
Equal contributors.
Abstract
Background
Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer
therapeutic target. However, very little is known about its expression and regulation in human
tissues. The purpose of this study was to characterize the expression pattern of PDF in
cancerous tissues and to identify mechanisms that regulate its expression.
Methods
The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an
enzyme involved in a related pathway with PDF, were determined using tissue panels
containing cDNA from patients with various types of cancer (breast, colon, kidney, liver,
lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also
3. determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated
with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF
and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines.
Finally, the effects of a PDF inhibitor, actinonin, on the proliferation of breast, colon, and
prostate cell lines were determined using the CyQUANT assay.
Results
PDF and MAP1D mRNA levels were elevated in cancer cell lines compared to non-cancer
lines. PDF mRNA levels were significantly increased in breast, colon, and lung cancer
samples while MAP1D mRNA levels were increased in just colon cancers. The expression of
PDF and MAP1D varied with stage in these cancers. Further, PDF protein expression was
elevated in colon cancer tissue samples. Inhibition of the MEK/ERK, but not PI3K or mTOR,
pathway reduced the expression of PDF and MAP1D in both colon and lung cancer cell lines.
Further, inhibition of PDF with actinonin resulted in greater reduction of breast, colon, and
prostate cancer cell proliferation than non-cancer cell lines.
Conclusions
This is the first report showing that PDF is over-expressed in breast, colon, and lung cancers,
and the first evidence that the MEK/ERK pathway plays a role in regulating the expression of
PDF and MAP1D. The over-expression of PDF in several cancers and the inhibition of
cancer cell growth by a PDF inhibitor suggest this enzyme may act as an oncogene to
promote cancer cell proliferation.
Background
In prokaryotic organisms, the N-terminal methionine excision (NME) pathway is
indispensible for proper protein functioning. This pathway involves two enzymes; peptide
deformylase (PDF) which removes the formyl group from the initial methionine in nascent
peptides, and methionine aminopeptidase (MAP) which subsequently removes the initial
methionine [1]. Until recently, PDF was thought to exist only in prokaryotic organisms and
hence has been the target of antimicrobial agents [2-5]. However, the recent discovery of
PDF and a MAP isoform in the mitochondria of eukaryotes raises questions regarding their
role in human cells [6-8].
Studies show that human PDF (HsPDF) can cleave the formyl group from an initiator
methionine, but with reduced kinetics compared to the prokaryotic versions of the enzyme
[2,8,9]. However, many of the respiratory Complex I peptides generated from mtDNA,
putative substrates for PDF and MAP1D, retain their formylated initiator methionine [10]. In
contrast, a recent report suggests that inhibition of PDF with actinonin results in reduced
aerobic respiratory capacity by influencing the expression of proteins derived from the
mtDNA [11].
While there are conflicting views for their role in NME in humans, it is likely PDF and
MAP1D have alternative functions. Indeed, RNA interference of MAP1D altered anchorage-
dependent growth of colon cancer cells [12] and inhibition of PDF with actinonin and
numerous analogs decreased proliferation of many cancer cells while having minimal effects
on non-cancer cell lines [13]. Further, PDF inhibitors resulted in a reduced tumor volume in a
4. mouse xenograft model using HL-60 [14]. These results have lead to recent studies focused
on the design of inhibitors to target PDF in cancer [14-16].
Despite these advances, little is known about the expression and regulation of the NME
enzymes in cancers. MAP1D is over-expressed in colon cancer [12], but no study has
reported the expression of PDF in cancerous compared to normal tissues. Further, no study
has described a mechanism that regulates human PDF or MAP1D expression. Therefore, the
purpose of this study was to identify the expression profiles of PDF and MAP1D in human
cancers compared to normal tissues and to identify a signaling pathway involved in
regulating their expression. Given the role of human PDF and MAP1D in cancer cell growth
and adhesion, we hypothesized that these proteins would be up-regulated in cancer cells and
tissues compared to normal and their expression would be modulated by growth-regulatory
pathways. In this paper, we report that PDF is elevated in breast, colon, and lung cancer
tissues and MAP1D is elevated in colon cancer tissue samples compared to non-cancer
controls. We also show that PDF and MAP1D mRNA expression is down-regulated when
MEK/ERK signaling is disrupted.
Methods
Cell culture
All cell lines, unless otherwise noted, were obtained from ATCC (Manassas, VA) and
cultured at 37°C with 5% carbon dioxide. Hs578Bst normal breast cells were maintained in
Hybri-Care Medium (ATCC) supplemented with 1.5 g/L sodium bicarbonate (Sigma; St.
Louis, MO), 30 ng/ml mouse EGF (BD Biosciences; San Jose, CA), and 10% fetal bovine
serum (FBS; Atlanta Biologicals; Lawrenceville, GA). Hs578T breast cancer cells were
cultured in Dulbecco's Modified Eagle's Medium (DMEM; Thermo Scientific; Waltham,
MA) supplemented with 0.01 mg/ml bovine insulin (Sigma) and 10% FBS. CCD-18Co
normal colon cells were maintained in Eagle's Minimum Essential Medium (EMEM; ATCC)
supplemented with 10% FBS. HT-29 colon cancer cells were cultured in McCoy’s 5a
(Thermo Scientific) medium supplemented with 10% FBS. Hs888Lu normal lung fibroblasts
and A549 lung cancer cells were cultured in DMEM plus 10% FBS. PrEC normal prostate
epithelial cells were obtained from Cambrex Corporation (East Rutherford, NJ) and
propagated in PrEGM media with Bulletkit growth supplements (Cambrex). PC-3 cells were
grown in Ham’s F-12 K medium supplemented with 10% FBS.
Human tissue samples and cDNA
TissueScan Cancer qPCR Arrays containing cDNA from normal and cancer tissue samples
were purchased from Origene (Rockville, MA). The cDNA panels (cancer survey panel
CSRT101, breast cancer panel BCRT101, matched colon cancer panel HCRT103, and
matched lung cancer panel HLRT104), each had 48–96 samples per microplate. Equal
loading of cDNA was verified by the manufacturer. Additionally, matched normal and colon
cancer samples were obtained from two patients at the Veteran’s Affairs (VA) Hospital in
Fargo, ND. This research was approved by the University of South Dakota and the North
Dakota State University Institutional Review Board and performed according to the ethical
guidelines imposed by these boards. Informed consent was obtained from each participant.
Total RNA was isolated from human cell lines using the Fisher SurePrep Kit (Waltham, MA)
and from human tissue samples using TRI Reagent (Molecular Research Center; Cincinnati,
5. OH) as per the manufacturer’s suggestions. 100 ng of total RNA were reverse transcribed
into cDNA using the qScript cDNA synthesis kit (Quanta Biosciences; Gaithersburg, MD).
Signal transduction pathway inhibitors
HT-29 colon cancer cells were seeded into a 6 well plate at 1.5 million cells per well and
incubated overnight. The next day, the cells were treated for 5 hours with 10 µM U0126, 10
µM LY294002, or 10 µM rapamycin (all from Cell Signaling). Total RNA or total protein
was collected from the cells for further analysis.
QPCR
Primers against human PDF and MAP1D were designed using Primer Express software
(Applied Biosystems; Carlsbad, CA) and synthesized by Integrated DNA Technologies
(Coralville, IA). Primer sequences were as follows; PDF forward
AGGCGCTGTGTCGGGAGTGC, PDF reverse TCTCGCAGCCCTCGGGAAAG, MAP1D
forward TATAGTTTTGCCGGCTGCAGT, MAP1D reverse
ATGTGCTTAGGAACCGGATGA, β-actin forward
CAGCCATGTACGTTGCTATCCAGG, β-actin reverse
AGGTCCAGACGCAGGATGGCATG. Steady-state mRNA levels of PDF or MAP1D were
determined for all cDNAs by real-time PCR using PerfeCTa SYBR Green FastMix (Quanta
Biosciences). The cycling parameters were 95°C for 10 min followed by 40 cycles of 95°C
for 30 sec and 60°C for 1 min and a dissociation program that included 95°C for 1 min, 55°C
for 30 sec, and 95°C for 30 sec ramping up at 0.2°C/sec. One distinct peak was observed for
the primer sets. For the cell lines, qPCR standards were prepared using human PDF and
MAP1D full-length cDNA clones from Open Biosystems (Catalog numbers IHS1380-
97652083 and MHS4426-99238965, Huntsville, AL). The 1010
molecules/µL standard was
serially diluted to 102
molecules/µL. The standards were run alongside the cDNA from the
human cell lines in order to approximate the copy number of PDF or MAP1D in these cells.
For the cDNA panels, fold-change in mRNA expression was calculated by comparing
normalized threshold cycle numbers (CT) in the cancerous tissue compared to the normal
tissues. The cell experiments were performed triplicate.
SDS-PAGE and western blotting
Cell pellets or human tissue samples from the VA Hospital were lysed using an SDS lysis
buffer (Cell Signaling Technologies, Danvers, MA) containing protease and phosphatases
inhibitors (Roche; Indianapolis, IN). Samples were briefly sonicated to dissociate cell
membranes. Fifty µg of total protein isolated from the human cell lines or tissues were
separated on 10% SDS-polyacrylamide gels at 100 V for 1 hr. Proteins were transferred to
nitrocellulose membranes at 100 V for 75 min at 4°C. Blots were then probed overnight at
4°C with primary antibodies. The PDF antibody was a kind gift from Carmela Giglione and
Thierry Meinnel (Centre National de la Recherche Scientifique, Gif-sur-Yvette, France). The
MAP1D antibody was obtained from R&D Systems (Minneapolis, MN). The total and
phosphor-ERK antibodies were purchased from Cell Signaling. The next day, blots were
rinsed with 1X TBS-tween (0.1%) and probed with anti-rabbit secondary antibody (Jackson
Immuno Research; West Grove, PA) for 1 hr at room temperature. The western blots were
analyzed using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher
Scientific; Rockford, IL) and images captured using the MultiImage™ Light Cabinet (Alpha
6. Innotech; San Leandro, CA). PDF levels were normalized to β-actin (Cell Signaling)
expression. Immunoblots were performed in triplicate.
Toxicity assay
Hs578Bst, Hs578T, CCD-18Co, HT-29, PrEC, and PC-3 cells were plated in 96-well
microplates in growth medium at a density of 5,000 cells/well and incubated for 24 hours.
The cells were then treated for 4 days with 0–250 uM actinonin. The CyQUANT (Life
Technologies; Grand Island, NY) cell proliferation assay was performed according to the
manufacturer’s instructions. Fluorescent readings were taken on day 4 to determine the
percentage of viable cells. Each condition was performed with eight replicates, and the
experiments were repeated three times.
Statistical analysis
SigmaPlot v12 software (Systat Software Inc.; Chicago, IL) was used for all statistical
analyses. For all tests, a p-value cut-off of < 0.05 was used to determine statistical
significance. For the cell lines, the PDF and MAP1D values were related to the standard
curves for the respective targets to yield the approximate mRNA copy number/cell. These
values were then normalized to β-actin values. The data are expressed as the average copy
number ± SD for 3 replicates. A t-test comparing the PDF or MAP1D mRNA copy number in
the cancer cell lines to the copy number in their respective normal cell lines. For the cancer
tissue cDNA plates, the average Ct value for all of the non-cancer tissue samples was set to 1.
The data are expressed as the relative fold change in each individual sample compared to the
average of these controls. A t-test was run for PDF mRNA expression in the cancer survey
samples compared to their non-cancer controls. One-way ANOVA on ranks was done using
Dunn’s method for multiple comparisons in the cancer stage I-III breast, colon, and lung
samples compared to their normal tissues. A paired t-test was done to compare the effect of
actinonin on the proliferation of the cancer cell line to the normal cell line. The data represent
the percentage of viable cells ± SD for 8 replicates. Finally, a t-test was used to determine the
effect of U0126 on the expression of PDF and MAP1D mRNA in 3 independent replicates.
Results
PDF and MAP1D expression is elevated in human cancer cell lines
We compared the expression of PDF and MAP1D in four different types (breast, colon, lung,
and prostate) of cancer cell lines to non-cancer cell lines. PDF mRNA expression was
significantly higher in the HT-29 colon, A549 lung, and PC-3 prostate cancer cell lines
compared to the CCD-18Co colon, Hs888Lu lung, and PrEC prostate non-cancer cell lines
(Figure 1). MAP1D was significantly elevated in the PC-3 compared to PrEC cell line, but
was not significantly different in the other pairs of cell lines (Figure 1). The Hs578Bst and
Hs578T cell lines are a normal breast and breast cancer cell line isolated from the same
patient. These cell lines did not significantly differ in their PDF or MAP1D expression,
although PDF was slightly elevated and MAP1D was reduced. The data suggest that PDF and
MAP1D expression varies across cell type and that they show altered expression in cancer
compared to non-cancer cells.
7. Figure 1 PDF and MAP1D mRNA expression varies across human cell lines. The
expression of PDF and MAP1D mRNA in normal breast (Hs578Bst), colon (CCD-18Co),
lung (Hs888Lu), and prostate (PrEC) cell lines was compared to the expression in breast
cancer (Hs578T), colon cancer (HT29), lung cancer (A549), and prostate cancer (PC3) cell
lines, respectively. The mRNA copy numbers for PDF and MAP1D were related to cDNA
standards for these two genes and then normalized to β-actin levels. PDF was significantly
(denoted by “a”) elevated in the colon, lung, and prostate cancer cell lines compared to their
respective normal cell lines while MAP1D was significantly (denoted by “b”) elevated only
in the prostate cancer cell line. The data represent the average mRNA copy number for 3
replicate experiments ± SD.
Actinonin inhibits the growth of both cancer and non-cancer cell lines
The effect of the PDF inhibitor actinonin on the proliferation capacity of colon, breast, and
prostate cancer and non-cancer cell lines was measured. Actinonin inhibited the proliferation
of both cancer and non-cancer cell lines in a concentration-dependent manner, but had greater
inhibition of cell proliferation in cancer cells compared to non-cancer cells (Figure 2A-C).
The IC50’s were 19.3, 17.3, and 113.5 µM for the Hs578T, HT-29, and PC-3 cancer cell lines,
respectively while the IC50’s were 208, 31.9, and 207.4 µM for the Hs578Bst, CCD-18Co,
and PrEC cells, respectively. While the IC50 was higher in the normal colon compared to the
colon cancer cell line, the difference in the percentage of viable cells was not statistically
significant. In contrast, actinonin significantly affected the growth of breast and prostate
cancer cells compared to their non-cancer cell controls. In general, the data suggest that
inhibition of PDF by actinonin has a greater effect on proliferation of cancer cells compared
to normal cells.
Figure 2 Actinonin inhibits the growth of cancer cell lines to a greater degree than non-
cancer cell lines. (A) Normal breast (Hs578Bst) and breast cancer (Hs578T), (B) normal
colon (CCD18Co) and colon cancer (HT29), and (C) normal prostate (PrEC) and prostate
cancer (PC3) cell lines were treated with 0–250 µM actinonin for 96 hrs before the
percentage of viable cells was determined. The growth-inhibitory effect of actinonin was
significantly greater in the breast cancer and prostate cancer cell lines than in their non-cancer
control cell lines. The data represent the percentage of viable cells ± SD for 3 experiments
with 8 replicates each.
PDF mRNA is elevated in many cancer tissues
TissueScanTM
Cancer qPCR Arrays containing cDNA from 96 tissue samples representing
eight different cancers (breast, colon, kidney, liver, lung, ovary, prostate, thyroid) were used
to determine PDF expression in cancer compared to non-cancer tissues. For each tissue type,
the array contained 3 normal control tissues and 9 cancer tissues. With the exception of liver
cancer that showed no change compared to control liver samples, PDF was at least slightly
elevated in all cancer tissues compared to control, and PDF mRNA levels were significantly
elevated in the breast, colon, and lung cancer tissue samples compared to their non-cancer
samples (Figure 3). Breast cancer showed a 5.8-fold increase in expression of PDF while
colon and lung showed a 3.5 and 3.4-fold increase in PDF expression, respectively.
Figure 3 PDF mRNA is significantly elevated in breast, colon, and lung cancer. With the
exception of liver, that showed equal expression, PDF was elevated in all cancers (●)
8. compared to non-cancer/normal (○) tissues. All stages of disease were pooled for the cancer
groups. Statistically significant differences (*) were observed in breast, colon, and lung
cancers with expression values 5.8, 3.5, and 3.4-fold higher in cancer compared to normal
tissues, respectively.
Additional tissue panels for breast, colon, and lung cancer patients were used to validate the
previous results and to assess MAP1D levels in these cancer types. Colon and lung tissue
panels contained 48 matched normal and cancer tissue samples from 24 cancer patients while
the breast tissue panels contained 48 unmatched tissue samples that included 12 normal
breast tissue controls and 36 breast cancer samples at various disease stages. Similar to the
first results, PDF was elevated in breast, colon, and lung cancer samples and showed stage-
dependent expression with the highest expression in late stage breast cancer, but early stage
colon and lung cancers (Figure 4A). MAP1D mRNA expression was elevated in early-stage
colon cancer samples, and was surprisingly reduced in breast cancer samples compared to
control samples (Figure 4B). There was no significant change in MAP1D mRNA levels in
lung cancer samples at any stage compared to control. These results suggest PDF and
MAP1D expression is altered in certain cancer tissues and that expression of these enzymes is
correlated with the stage of disease.
Figure 4 PDF and MAP1D mRNA expression varies with stage in breast, colon, and
lung cancer samples. (A) PDF and (B) MAP1D mRNA expression is shown for normal (●)
tissues relative to stage I (○), stage II (▼), and stage III (∆) tissues for breast, colon, and lung
cancer patients. PDF levels are significantly (*) elevated in late-stage breast, and early-stage
colon and lung cancers while MAP1D levels are significantly increased in early-stage colon
cancer, but decreased in breast cancer.
PDF protein levels are elevated in colon cancer tissues
To verify that the increased PDF mRNA levels translated to increased PDF protein levels, we
screened two sets of colon cancer tissues for PDF expression. Matched colon cancer and
normal colon tissue sets were obtained from two patients at the VA Hospital in Fargo, ND in
accordance with IRB policies. Western blotting for PDF revealed a striking elevation of PDF
expression in the tumor sample of both of these patients relative to their matched normal
colon tissue (Figure 5).
Figure 5 PDF protein expression is elevated in colon tumor tissues. Western blotting was
done to determine the expression of PDF in colon cancer tissue samples (T) relative to
normal colon tissue (N) from two patients. Elevated PDF levels were found in the colon
tumor samples for each patient. A β-actin antibody was used to confirm equal protein loading
of the tissue samples for each patient. Two replicate experiments were performed and this
image shows one representative experiment.
Inhibition of MEK/ERK results in reduced expression of PDF and MAP1D in
colon cancer cells
The regulation of PDF or MAP1D expression in human cells has not been previously studied.
To understand potential mechanisms that regulate PDF and MAP1D gene expression, we
used pharmacological inhibitors to target the MEK/ERK, PI3K, and mTOR signaling
pathways and determined their effects on PDF or MAP1D expression. Treatment of HT-29
9. colon cancer cells with the MEK inhibitor U0126 resulted in a 51% reduction in expression
of PDF mRNA and a 47% reduction in MAP1D (Figure 6A). Western blotting confirmed that
U0126 inhibited ERK signalling these cells (Figure 6B). Unlike U0126, the PI3K inhibitor
LY294002 and mTOR inhibitor rapamycin did not have an effect on PDF expression in HT-
29 cells (Figure 6C).
Figure 6 Inhibition of MEK down-regulates PDF and MAP1D mRNA expression in
colon cancer cells. (A) Treatment of HT-29 colon cancer cells with 10 µM U0126 for 5 hr
resulted in about a 50% reduction in both PDF and MAP1D mRNA expression. (B) Western
blot analysis confirmed that 5 hr treatment of HT-29 colon cancer cells with 10 µM U0126
reduced phosphorylated ERK (pERK) levels. Total ERK (tERK) expression was determined
in order to show equal protein loading. (C) Treatment of HT-29 cells with other inhibitors
Ly294002 (LY) and rapamycin (Rap) does not affect PDF mRNA expression. These
experiments were repeated 3 times and the data represent the average relative gene
expression in the inhibitor-treated cells relative to the vehicle-treated controls. Statistically
significant (p < 0.05) differences are denoted by *.
Discussion
PDF and MAP are essential enzymes in prokaryotic peptide synthesis, but their role in
eukaryotic cells is less appreciated. Previous studies have suggested PDF and MAP1D as
therapeutic targets for cancer treatment given their roles in modulating cell proliferation,
adhesion, and aerobic respiration [11-13]. As a result, the goal of this research was to
characterize the expression pattern of PDF and MAP1D in human cancer tissues in order to
better understand their potential roles in these cancers.
Over-expression of MAP1D has been previously observed in colon cancer tissues; 7 out of 8
colon cancer patients showed increased MAP1D mRNA expression and 9 out of 12 patients
showed increased MAP1D protein expression [12]. Similarly, we also found that MAP1D
was elevated in colon cancers, but not lung cancers. Interestingly we found that MAP1D
mRNA expression was significantly reduced in breast cancer samples compared to normal
breast tissue. This is the first report to suggest PDF is over-expressed in cancer, particularly
breast, colon, and lung. Stage-dependent expression of PDF was observed in the tissue
samples where higher expression was found in early stages of colon and lung cancer, but later
stages of breast cancer. Early expression of PDF indicates it plays a role in the proliferation
of tumor cells. The over-expression of PDF and MAP1D, particularly in early-stage colon
cancer, suggests that these enzymes are important for cancer cell growth.
PDF and MAP1D are encoded in the nuclear genome (chromosome 16 and 2, respectively)
and translocate to mitochondria [14]. It was interesting to find that the expression of both
HsPDF and MAP1D was regulated by a similar pathway. Use of the MEK inhibitor U0126
resulted in about a 50% reduction in PDF and MAP1D expression in a human colon cell line.
Conversely, rapamycin and LY294002 had little effect on PDF expression suggesting the
MEK/ERK pathway specifically contributes to the expression of NME enzymes. A genetic
and functional linkage of PDF and MAP1D has been shown in other animal genomes
suggesting the tight regulation of NME activity in eukaryotic mitochondria (Serero et al.,
2003). The involvement of a growth-regulatory pathway in modulating PDF expression,
provides further support that PDF promotes the growth of tumors and lends support to the
pursuit of PDF inhibitors as cancer therapies.
10. Lee et al. showed that the PDF inhibitor actinonin selectively inhibited the proliferation of
numerous cancer cell lines while having a minimal effect on the growth of non-cancer cell
lines [13]. Similarly, our data show that actinonin had significantly greater growth-inhibitory
effects on breast and prostate cancer cells than non-cancer cell lines. These results suggest
that PDF does play a role in the growth of cancer cells and may offer a selective target for
cancer treatment.
Conclusions
In conclusion, we found that PDF is up-regulated in several cancer types including breast,
colon, and lung. Our data suggest that the MEK/ERK pathway contributes to the expression
of PDF and MAP1D colon cancer cells. Finally, we demonstrated that the PDF inhibitor
actinonin inhibits the growth of cancer cell lines to a greater degree than non-cancer cell
lines. These data suggest that PDF and MAP1D may function as oncogenes to promote tumor
development and are potential selective targets for colon cancer therapy.
Abbreviations
(ERK), Extracellular-signal-regulated kinase; (MAP), Methionine aminopeptidase; (MEK),
Mitogen-activated protein kinase kinase; (mtDNA), Mitochondrial DNA; (mTOR),
Mammalian target of rapamycin; (NME), N-terminal methionine excision; (PDF), Peptide
deformylase; (PI3K), Phosphatidylinositol 3-kinase
Competing interests
The authors have no competing interests in relation to this paper.
Authors' contributions
KR conceived, designed, and performed mRNA expression and actinonin experiments,
analyzed the data, and wrote the manuscript. HR and SC performed mRNA and protein
expression experiments, analyzed the data, and wrote the manuscript. DG and TY conducted
gene regulation experiments using the signaling molecule inhibitors and analyzed the data.
JM assisted with the design of the expression and regulation experiments and data analysis.
All authors read and approved the final manuscript.
Acknowledgements
We are very grateful to Carmela Giglione and Thierry Meinnel of the Centre National de la
Recherche Scientifique, Gif-sur-Yvette, France for kindly providing the PDF antibody. We
would like to thank the Veteran’s Affairs Hospital in Fargo, ND and their research staff Jodie
Haring, Candice Nelson, Jessica Clairmont, William Becker, Mark Jensen, and Edward
Sauter for their help collecting the human colon cancer tissues for this study. This study was
supported by 2P20 RR015566 from the National Center for Research Resources (NCRR), a
component of the National Institutes of Health (NIH) to KMR and the NDSU Department of
Biological Sciences.
11. References
1. Solbiati J, Chapman-Smith A, Miller JL, Miller CG, Cronan JE Jr: Processing of the N
termini of nascent polypeptide chains requires deformylation prior to methionine
removal. J Mol Biol 1999, 290(3):607–614.
2. Nguyen KT, Hu X, Colton C, Chakrabarti R, Zhu MX, Pei D: Characterization of a
human peptide deformylase: implications for antibacterial drug design. Biochemistry
2003, 42(33):9952–9958.
3. Giglione C, Meinnel T: Peptide deformylase as an emerging target for antiparasitic
agents. Expert Opin Ther Targets 2001, 5(1):41–57.
4. Giglione C, Pierre M, Meinnel T: Peptide deformylase as a target for new generation,
broad spectrum antimicrobial agents. Mol Microbiol 2000, 36(6):1197–1205.
5. Leeds JA, Dean CR: Peptide deformylase as an antibacterial target: a critical
assessment. Curr Opin Pharmacol 2006, 6(5):445–452.
6. Giglione C, Serero A, Pierre M, Boisson B, Meinnel T: Identification of eukaryotic
peptide deformylases reveals universality of N-terminal protein processing mechanisms.
EMBO J 2000, 19(21):5916–5929.
7. Serero A, Giglione C, Meinnel T: Distinctive features of the two classes of eukaryotic
peptide deformylases. J Mol Biol 2001, 314(4):695–708.
8. Serero A, Giglione C, Sardini A, Martinez-Sanz J, Meinnel T: An unusual peptide
deformylase features in the human mitochondrial N-terminal methionine excision
pathway. J Biol Chem 2003, 278(52):52953–52963.
9. Lee MD, Antczak C, Li Y, Sirotnak FM, Bornmann WG, Scheinberg DA: A new human
peptide deformylase inhibitable by actinonin. Biochem Biophys Res Commun 2003,
312(2):309–315.
10. Carroll J, Fearnley IM, Walker JE: Definition of the mitochondrial proteome by
measurement of molecular masses of membrane proteins. Proc Natl Acad Sci USA 2006,
103(44):16170–16175.
11. Escobar-Alvarez S, Gardner J, Sheth A, Manfredi G, Yang G, Ouerfelli O, Heaney ML,
Scheinberg DA: Inhibition of human peptide deformylase disrupts mitochondrial
function. Mol Cell Biol 2010, 30(21):5099–5109.
12. Leszczyniecka M, Bhatia U, Cueto M, Nirmala NR, Towbin H, Vattay A, Wang B,
Zabludoff S, Phillips PE: MAP1D, a novel methionine aminopeptidase family member is
overexpressed in colon cancer. Oncogene 2006, 25(24):3471–3478.
13. Lee MD, She Y, Soskis MJ, Borella CP, Gardner JR, Hayes PA, Dy BM, Heaney ML,
Philips MR, Bornmann WG, et al: Human mitochondrial peptide deformylase, a new
anticancer target of actinonin-based antibiotics. J Clin Invest 2004, 114(8):1107–1116.
12. 14. Antczak C, Shum D, Bassit B, Frattini MG, Li Y, Stanchina E, Scheinberg DA, Djaballah
H: Identification of benzofuran-4,5-diones as novel and selective non-hydroxamic acid,
non-peptidomimetic based inhibitors of human peptide deformylase. Bioorg Med Chem
Lett 2011, 21(15):4528–4532.
15. Antczak C, Shum D, Escobar S, Bassit B, Kim E, Seshan VE, Wu N, Yang G, Ouerfelli
O, Li YM, et al: High-throughput identification of inhibitors of human mitochondrial
peptide deformylase. J Biomol Screen 2007, 12(4):521–535.
16. Escobar-Alvarez S, Goldgur Y, Yang G, Ouerfelli O, Li Y, Scheinberg DA: Structure
and activity of human mitochondrial peptide deformylase, a novel cancer target. J Mol
Biol 2009, 387(5):1211–1228.