SlideShare a Scribd company logo
1 of 26
PRESENTATION
ON
NEURODEGENERATIVE DISORDERS.
WHAT IS NEURODEGENERATIVE DISEASE?
Neurodegeneration is the progressive loss of
structure or functions of neurons including death of
neurons.This causes problems with movement( called
ataxias), or mental functioning ( called dementias).
Neurodegenerative diseases are incurable ,resulting
in progressive degeneration and /or death of neuron
cells.
The greatest risk factor for neurodegenerative
diseases is aging. Mitochondrial DNA mutations as
well as oxidative stress both contribute to aging.
. Dementias are responsible for the greatest burden
of neurodegenerative diseases,with alzheimer’s
representing approximately 60-70% of dementia
cases.
Although treatments may help relieve some of the
physical or mental symptoms , there is currently no
way to slow disease progression and no known cures
Scientist now recognize that the combination of a person’s genes and environment contributes
to their risk of developing a neurodegenerative disease. That is, a person might have a gene
that makes them more susceptible to a certain neurodegenerative disease, but whether
,when, and how severely the person is affected depends on what environmental factors he or
she is exposed to during life.
How is it caused?
Is it just genetic mutations or a combination of a person’s genes and environmental
conditions?
TYPES OF THE NEURODEGENERATIVE DISORDERS:
Progressive loss of selected neuron in
discrete brain areas, resulting in
characteristic disorder of movement ,
cognition, or both.
Include:
Alzheimer disease: dementia and
disordered cognitive function.
Parkinson’s disease: a disabling motor
impairment disorder.
Huntington disease: excessive and
abnormal movement.
Amyotrophic lateral sclerosis(ALS):
progressive weakness and muscle
atrophy.
 Tay Sachs Disease: causes fatty
substance build up in the brain.
What is
Dr. Alois Alzheimer discovered this disease
in 1906 in one of his patient. It is an
irreversible , progressive neurodegenerative
disease that slowly destroys memory and
thinking skills.
It is the most common type of dementia.
The risk increase with the increase of age.
Alzheimer's is not just a disease of old age.
Approximately 200,000 Americans under
the age of 65 have younger-onset
Alzheimer’s disease (also known as early-
onset Alzheimer’s).
Alzheimer's is a progressive
disease, where dementia
symptoms gradually worsen over a
number of years. In its early stages,
memory loss is mild, but with late-
stage Alzheimer's, individuals lose
the ability to carry on a
conversation and respond to their
environment.
Alzheimer’s Disease?
Scientists believe that for most
people, Alzheimer's disease is
caused by a combination of
genetic, lifestyle and environmental
factors that affect the brain over
time.
The exact causes of Alzheimer's
disease aren't fully understood, but
at its core are problems with brain
proteins(Tau tangles and amyloid
plagues) that fail to function
normally, disrupt the work of brain
cells (neurons) and unleash a series
of toxic events.
CAUSE OF
ALZHEIMER’S DISEASE
Memory loss, changes in
memory
Difficulty performing
familiar task, routine
chores
Drastic changes in
personality
Poor or decreased
judgement
Problems in speaking,reading
and writing.
SYMPTOMS OF ALZHEIMER’S
DISEASE
Alzheimer’s medication
For early to moderate Alzheimer’s, your doctor may
prescribe medications such as donepezil (Aricept) or
rivastigmine (Exelon). These drugs can help maintain
high levels of acetylcholine in your brain. This is a type
of neurotransmitter that can help aid your memory.
To treat moderate to severe Alzheimer’s, your doctor
may prescribe donepezil (Aricept) or memantine
(Namenda). Memantine can help block the effects of
excess glutamate. Glutamate is a brain chemical that’s
released in higher amounts in Alzheimer’s disease and
damages brain cells.
What
Is
Parkinson’s
Disease?
Parkinson’s disease is typically considered a
chronic, progressive neurodegenerative
movement disorder.
Parkinson’s primarily cause death of the vital
nerve cells in the area of brain called
SUBSTANTIA NIGRA.
Some of these dying neurons produce dopamine
which acts messenger and sends message to the
part the brain that controls the movement and
coordination.
As the Parkinson’s disease progresses the
amount produced from the brain decreases ,
leading a person unable to control movement
normally
What is the cause of
Parkinson’s Disease?
The cause of Parkinson's disease is
unknown, but several factors appear
to play a role, including:
Your genes.
Environmental triggers.
These changes include:
The presence of Lewy bodies. Clumps of
specific substances within brain cells are
microscopic markers of Parkinson's
disease. These are called Lewy bodies,
and researchers believe these Lewy
bodies hold an important clue to the
cause of Parkinson's disease.
Alpha-synuclein is found within Lewy
bodies. Although many substances are
found within Lewy bodies, scientists
believe an important one is the natural
and widespread protein called alpha-
synuclein (a-synuclein). It's found in all
Lewy bodies in a clumped form that cells
can't break down. This is currently an
important focus among Parkinson's
disease researchers.
Researchers have also noted that
many changes occur in the brains
of people with Parkinson's disease,
although it's not clear why these
changes occur.
1
2
3
If you have Parkinson’s disease, you have a lot of choices for treatment.
There's no cure, but medicine and sometimes surgery can help.
Medicine can often keep your symptoms in check for years.
Levodopa.
When you have Parkinson's, your brain gradually stops making dopamine
-- a chemical that helps send signals in your brain. Levodopa may improve
your symptoms because it causes your body to make more dopamine
To curb nausea and other possible side effects from levodopa,
doctors usually suggest you take a drug called carbidopa along with it.
A combination drug with both medicines is called Sinemet.
. These are drugs that imitate the action of dopamine in your brain.
Parkinson’s Disease Treatment
Dopamine agonists
What Is
Huntington’s
Disease?
Huntington’s disease is a rare and fatal inherited disorder of
the CNS. It is caused by a single dominant allele , which means
that heterozygous individuals will develop the disease.
This disease causes the progressive breakdown of nerve cells
in the brain especially damage in basal ganglia.
Huntington’s disease has a broad impact on a person’s
functional abilities and usually results in movements,
thinking(cognitive) and psychiatric disorders.
Most people with Huntington’s disease develop signs and
symptoms in their 30s and 40s , but the onset of disease may
be earlier or later in life. When disease onset begins before age
20, the condition is called juvenile Huntington’s disease.
CAUSE OF HUNTINGTON’s
DISEASE
Huntington’s disease is caused by a CAG trinucleotide repeat
expansion in the gene encoding the protein, huntingtin.
Unaffected individuals have a stretch of CAG repeats in their genes
that has fewer than 36 repeats – so this would look like
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAG…
People with Huntington’s disease have 36 or more of these repeats.
As CAG in these repeats is translated into the amino acid glutamine,
the mutant huntingtin protein has an abnormally long polyglutamine tract.
This type of mutation is seen in 8 other neurodegenerative diseases.
HUNTINGTON’S DISEASE
IMPULSIVITY
BALANCE
PROBLEMS
SLOW EYE
MOVEMENTS.
SLOWNESS OF
MOVEMENT
DEPRESSION,ANXIETY TROUBLE
SWALLOWING
MUSCLE CONTRACTIONS,
JERKING MOVEMENTS.
FINE MOTOR
TASK AFFECTED.
RESTLESS
FIDGETS
MULTI-TASKING
AFFECTED
CHOREA
INVOLUNTARY
MOVEMENTS
SYMPTOMS OF
TREATMENT OF
NEURODEGENERATIVE
DISORDERS
Medications are available to help
manage the symptoms of
Huntington’s disease , but treatments
can’t prevent the physical, Mental
and behavioral problems from getting
worse.
Although , a group called HDDW
Huntington’s disease drug works does
believe that with physical therapy, and
medication, it can be treated.
For right now, treating Huntigton’s
Involves managing symptoms,
Medications, speech or language
therapy, physical therapy,nutritional
support, exercise are very helpful.
WHAT IS AMYOTROPHIC
LATERAL
SCLEROSIS?
Amyotrophic lateral sclerosis (ALS) is a
group of rare neurological diseases that
mainly involve the nerve cells (neurons)
responsible for controlling voluntary
muscle movement..
1
ALS belongs to a wider group of
disorders known as motor neuron
diseases, which are caused by gradual
deterioration (degeneration) and death
of motor neurons. These motor neurons
initiate and provide vital
communication links between the brain
and the voluntary muscles
2 In ALS ,both the upper motor
neurons and lower motor
neurons degenerate , die and
stop sending messages to the
muscles. Unable to
function,the muscle gradually
weaken, starts to twitch and
waste away.
3
CAUSES
OF
AMYOTROPHIC LATERAL
SCLEROSIS?
Gene mutation. Various
genetic mutations can lead to
inherited ALS, which causes
nearly the same symptoms as
the non inherited form.
Chemical
imbalance. People
with ALS generally
have higher than
normal levels of
glutamate, a
chemical messenger
in the brain, around
the nerve cells in
their spinal fluid. Too
much glutamate is
known to be toxic to
some nerve cells.
Disorganized immune
response. Sometimes a
person's immune system
begins attacking some of his
or her body's own normal
cells, which may lead to the
death of nerve cells.
Protein mishandling. Mishandled proteins within the
nerve cells may lead to a gradual accumulation of
abnormal forms of these proteins in the cells,
destroying the nerve cells
SYMPTOMS OF AMYOTROPHIC LATERAL SCLEROSIS
Difficulty walking or
doing your normal
daily activities
Difficulty keeping
your head up or
having a good
posture.
ALS often starts in
the hands, feet or
limbs, and then
spreads
Slurred speech
or trouble
swallowing.
Tripping and
falling
Hand weakness
or clumsiness
Muscle cramps
and twitching in
your arms,
shoulders and
tongue
Weakness in your
leg, feet or ankles
Treatment of ALS:
No cure has yet been found for ALS.
However, there are treatments available
that can help control symptoms, prevent
unnecessary complications, and make
living with the disease easier.
Supportive care is best provided by
multidisciplinary teams of health care
professionals such as physicians;
pharmacists; physical, occupational, and
speech therapists; nutritionists; social
workers; respiratory therapists and
clinical psychologists; and home care
and hospice nurses. These teams can
design an individualized treatment plan
and provide special equipment aimed at
keeping people as mobile, comfortable,
and independent as possible.
Stephen Hawking was diagnosed
in his early 20s.
He defied predictions as he would
only live a few years but was
wheel chair bound and spoke
through a computerised voice.
What is Tay-Sachs Disease?
Tay-Sachs is a disease of the central
nervous system. It is a
neurodegenerative disorder that most
commonly affects infants. In infants, it is
a progressive disease that is
unfortunately always fatal. Tay-Sachs can
also occur in teens and adults, causing
less severe symptoms, although this
occurs more rarely.
Healthy babies develop vision,
movement, hearing, and other vital
functions in part because enzymes clear
out fatty protein and other unwanted
material that can interfere with growth.
But a baby with Tay-Sachs disease is
born without one of those important
enzymes, hexosaminidase A (HEXA). So,
as those fatty proteins build up in the
brain, they hurt the baby's sight,
hearing, movement, and mental
development.
WHAT
IS
TAY -SACHS?
The genetics behind the cause of Tay-Sachs disease.
 The harmful quantities
of a fatty substance called
ganglioside GM2
accumulate in the nerve
cells of the brain. As the
nerve cells become
distended with fatty
materials, the cells
become damaged and
gradually lose their ability
to function properly. The
affected child fails to
develop appropriate
mental and motor
functions.
The gene mutation
responsible for
development of Tay-
Sachs Disease is the
mutation in HEX-A gene
located in the
chromosome no.15.
Because of this gene
there is less or no
production of enzyme
Hexosaminidase-A
which is an enzyme
responsible for the
normal degradation of
GM2 ganglioside.
SYMPTOMS & TREATMENT
As the GM2 ganglioside builds up in the brain---
 Mental and physical activities of this children
deteriorate.
 As the disease progresses, this child becomes
blind, deaf and inability to swallow.
 Dementia and seizures are also common.
 Eventually, the child is paralyzed.
 Before the disease finally kills them.
Scientist are still researching on the methods for
the treatment of Tay Sachs disease:
 One such method is gene therapy wherein a
healthy gene could be inserted into the one
with Tay Sachs and replacing the defective
copy.
 Enzyme replacement therapy, which would
enable the patient to artificially provide the
missing beta hexoaminidaseA enzyme the
body is lacking.
In the field of neuroscientific research, the field of
neurodegenerative diseases are one of the most active in
respect of both medical and associated social issues.
Recent advances in the basic knowledge of such diseases have
led to a re-evaluation about new therapeutically approaches.
There are no effective treatments for degenerative diseases in
modern society, but we can use Western medicine to deal
with the acute disorders or symptoms and use the advantages
of other integrative treatments to assist Western medicine in
improving the ADL of the patients.
Integrative medicine can, sometimes, exhibit protective
effects or slow the morbidity of these diseases. We believe
that with the development of integrative medicine and
modern science, the former will increasingly take a more and
more important role in the treatment of degenerative
diseases.
01
02
03
THANK YOU.

More Related Content

What's hot

Alzheimer's disease
Alzheimer's diseaseAlzheimer's disease
Alzheimer's diseasecalvsh
 
Molecular Mechanisms of Neurodegeneration: Neurodegenerative Disorders Webin...
Molecular Mechanisms of Neurodegeneration:  Neurodegenerative Disorders Webin...Molecular Mechanisms of Neurodegeneration:  Neurodegenerative Disorders Webin...
Molecular Mechanisms of Neurodegeneration: Neurodegenerative Disorders Webin...QIAGEN
 
Alzheimer’s Disease
Alzheimer’s DiseaseAlzheimer’s Disease
Alzheimer’s Diseasehulyadiels
 
Alzheimers presentation...........
Alzheimers presentation...........Alzheimers presentation...........
Alzheimers presentation...........Muhammad Kamran
 
Neurodegenerative disorders
Neurodegenerative disordersNeurodegenerative disorders
Neurodegenerative disordersRitu_A
 
Alzheimer's disease : Overview, Symptoms, Risk Factor, Causes, Treatment and ...
Alzheimer's disease : Overview, Symptoms, Risk Factor, Causes, Treatment and ...Alzheimer's disease : Overview, Symptoms, Risk Factor, Causes, Treatment and ...
Alzheimer's disease : Overview, Symptoms, Risk Factor, Causes, Treatment and ...Lazoi Lifecare Private Limited
 
Pathophysiology of Alzheimer's disease
Pathophysiology of Alzheimer's diseasePathophysiology of Alzheimer's disease
Pathophysiology of Alzheimer's diseaseDeepanshu Goyal
 
Neurodegenerative Disorders Pharmacotherapy Dr Jayesh Vaghela
Neurodegenerative Disorders Pharmacotherapy Dr Jayesh VaghelaNeurodegenerative Disorders Pharmacotherapy Dr Jayesh Vaghela
Neurodegenerative Disorders Pharmacotherapy Dr Jayesh Vaghelajpv2212
 
Alzheimer's disease
Alzheimer's diseaseAlzheimer's disease
Alzheimer's diseaseIqra Altaf
 
Huntingtons disease
Huntingtons disease Huntingtons disease
Huntingtons disease Rahul Kumar
 
Circulating Biomarkers for Alzheimer's Disease: Neurodegenerative Disorders ...
Circulating Biomarkers for Alzheimer's Disease:  Neurodegenerative Disorders ...Circulating Biomarkers for Alzheimer's Disease:  Neurodegenerative Disorders ...
Circulating Biomarkers for Alzheimer's Disease: Neurodegenerative Disorders ...QIAGEN
 
Alzheimer s disease_powerpoint_skinner_kassandra
Alzheimer s disease_powerpoint_skinner_kassandraAlzheimer s disease_powerpoint_skinner_kassandra
Alzheimer s disease_powerpoint_skinner_kassandraCMoondog
 

What's hot (20)

Alzheimer's disease
Alzheimer's diseaseAlzheimer's disease
Alzheimer's disease
 
Alzheimer's disease
Alzheimer's diseaseAlzheimer's disease
Alzheimer's disease
 
Alzheimers
AlzheimersAlzheimers
Alzheimers
 
Molecular Mechanisms of Neurodegeneration: Neurodegenerative Disorders Webin...
Molecular Mechanisms of Neurodegeneration:  Neurodegenerative Disorders Webin...Molecular Mechanisms of Neurodegeneration:  Neurodegenerative Disorders Webin...
Molecular Mechanisms of Neurodegeneration: Neurodegenerative Disorders Webin...
 
Alzheimer's disease
Alzheimer's diseaseAlzheimer's disease
Alzheimer's disease
 
Alzheimers disease
Alzheimers diseaseAlzheimers disease
Alzheimers disease
 
Alzheimer’s Disease
Alzheimer’s DiseaseAlzheimer’s Disease
Alzheimer’s Disease
 
Alzheimers presentation...........
Alzheimers presentation...........Alzheimers presentation...........
Alzheimers presentation...........
 
Neurodegenerative disorders
Neurodegenerative disordersNeurodegenerative disorders
Neurodegenerative disorders
 
Alzheimer's disease : Overview, Symptoms, Risk Factor, Causes, Treatment and ...
Alzheimer's disease : Overview, Symptoms, Risk Factor, Causes, Treatment and ...Alzheimer's disease : Overview, Symptoms, Risk Factor, Causes, Treatment and ...
Alzheimer's disease : Overview, Symptoms, Risk Factor, Causes, Treatment and ...
 
Alzheimer disease
Alzheimer diseaseAlzheimer disease
Alzheimer disease
 
Prion diseases
Prion diseasesPrion diseases
Prion diseases
 
Alzheimer disease
Alzheimer diseaseAlzheimer disease
Alzheimer disease
 
Alzheimers Disease
Alzheimers DiseaseAlzheimers Disease
Alzheimers Disease
 
Pathophysiology of Alzheimer's disease
Pathophysiology of Alzheimer's diseasePathophysiology of Alzheimer's disease
Pathophysiology of Alzheimer's disease
 
Neurodegenerative Disorders Pharmacotherapy Dr Jayesh Vaghela
Neurodegenerative Disorders Pharmacotherapy Dr Jayesh VaghelaNeurodegenerative Disorders Pharmacotherapy Dr Jayesh Vaghela
Neurodegenerative Disorders Pharmacotherapy Dr Jayesh Vaghela
 
Alzheimer's disease
Alzheimer's diseaseAlzheimer's disease
Alzheimer's disease
 
Huntingtons disease
Huntingtons disease Huntingtons disease
Huntingtons disease
 
Circulating Biomarkers for Alzheimer's Disease: Neurodegenerative Disorders ...
Circulating Biomarkers for Alzheimer's Disease:  Neurodegenerative Disorders ...Circulating Biomarkers for Alzheimer's Disease:  Neurodegenerative Disorders ...
Circulating Biomarkers for Alzheimer's Disease: Neurodegenerative Disorders ...
 
Alzheimer s disease_powerpoint_skinner_kassandra
Alzheimer s disease_powerpoint_skinner_kassandraAlzheimer s disease_powerpoint_skinner_kassandra
Alzheimer s disease_powerpoint_skinner_kassandra
 

Similar to NEURODEGENERATIVE DISORDERS.

Neurodegenerative diseases why they are increasing every day
Neurodegenerative diseases  why they are increasing every dayNeurodegenerative diseases  why they are increasing every day
Neurodegenerative diseases why they are increasing every dayJonathanOttoFan
 
Degenerativers
DegenerativersDegenerativers
Degenerativersmycomic
 
ALZHEIMERS DISEASE.pptx
ALZHEIMERS DISEASE.pptxALZHEIMERS DISEASE.pptx
ALZHEIMERS DISEASE.pptxpunith p
 
Approach to dementia and alzheimers s
Approach to dementia and alzheimers   sApproach to dementia and alzheimers   s
Approach to dementia and alzheimers sMadhumita Sen
 
Neurological disorders
Neurological disordersNeurological disorders
Neurological disordersAldrich Chan
 
6/10 Neurological disorders
6/10 Neurological disorders6/10 Neurological disorders
6/10 Neurological disordersMadeleine Si
 
Organic Brain Syndrome.pptx
Organic Brain Syndrome.pptxOrganic Brain Syndrome.pptx
Organic Brain Syndrome.pptxVandanaGaur8
 
Parkinson’s disease
Parkinson’s diseaseParkinson’s disease
Parkinson’s diseaseRohan Deokar
 
Alzheimerdisease and apoptosis
Alzheimerdisease and apoptosisAlzheimerdisease and apoptosis
Alzheimerdisease and apoptosiseman youssif
 
Alzheimer Disease and Mind Function
Alzheimer Disease and Mind FunctionAlzheimer Disease and Mind Function
Alzheimer Disease and Mind FunctionUNIMAS
 
Neurological disorder
Neurological disorderNeurological disorder
Neurological disorderUE
 
The nervous system, parts, function, illness and diseases
The nervous system, parts, function, illness and diseasesThe nervous system, parts, function, illness and diseases
The nervous system, parts, function, illness and diseasesMariel Flores
 
NEURODEGENERATIVE DISEASES
NEURODEGENERATIVE DISEASESNEURODEGENERATIVE DISEASES
NEURODEGENERATIVE DISEASESGomathi .S
 
ALZHEIMER’S DISEASE.pptx
ALZHEIMER’S DISEASE.pptxALZHEIMER’S DISEASE.pptx
ALZHEIMER’S DISEASE.pptxAkash Ghorpade
 
Alzheimer s
Alzheimer sAlzheimer s
Alzheimer sCMoondog
 

Similar to NEURODEGENERATIVE DISORDERS. (20)

Neurodegenerative diseases why they are increasing every day
Neurodegenerative diseases  why they are increasing every dayNeurodegenerative diseases  why they are increasing every day
Neurodegenerative diseases why they are increasing every day
 
Degenerativers
DegenerativersDegenerativers
Degenerativers
 
ALZHEIMERS DISEASE.pptx
ALZHEIMERS DISEASE.pptxALZHEIMERS DISEASE.pptx
ALZHEIMERS DISEASE.pptx
 
Approach to dementia and alzheimers s
Approach to dementia and alzheimers   sApproach to dementia and alzheimers   s
Approach to dementia and alzheimers s
 
Neurological disorders
Neurological disordersNeurological disorders
Neurological disorders
 
6/10 Neurological disorders
6/10 Neurological disorders6/10 Neurological disorders
6/10 Neurological disorders
 
Organic Brain Syndrome.pptx
Organic Brain Syndrome.pptxOrganic Brain Syndrome.pptx
Organic Brain Syndrome.pptx
 
Parkinson’s disease
Parkinson’s diseaseParkinson’s disease
Parkinson’s disease
 
Alzheimerdisease and apoptosis
Alzheimerdisease and apoptosisAlzheimerdisease and apoptosis
Alzheimerdisease and apoptosis
 
Enfermedades
EnfermedadesEnfermedades
Enfermedades
 
White Matter Project .Pptx
White Matter Project .PptxWhite Matter Project .Pptx
White Matter Project .Pptx
 
Dementia-final
Dementia-finalDementia-final
Dementia-final
 
Dementia
DementiaDementia
Dementia
 
Alzheimer Disease and Mind Function
Alzheimer Disease and Mind FunctionAlzheimer Disease and Mind Function
Alzheimer Disease and Mind Function
 
Neurological disorder
Neurological disorderNeurological disorder
Neurological disorder
 
Dementia
DementiaDementia
Dementia
 
The nervous system, parts, function, illness and diseases
The nervous system, parts, function, illness and diseasesThe nervous system, parts, function, illness and diseases
The nervous system, parts, function, illness and diseases
 
NEURODEGENERATIVE DISEASES
NEURODEGENERATIVE DISEASESNEURODEGENERATIVE DISEASES
NEURODEGENERATIVE DISEASES
 
ALZHEIMER’S DISEASE.pptx
ALZHEIMER’S DISEASE.pptxALZHEIMER’S DISEASE.pptx
ALZHEIMER’S DISEASE.pptx
 
Alzheimer s
Alzheimer sAlzheimer s
Alzheimer s
 

Recently uploaded

Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...CALL GIRLS
 
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Call Girls in Nagpur High Profile
 
Aspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliAspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliRewAs ALI
 
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service CoimbatoreCall Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatorenarwatsonia7
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...astropune
 
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual NeedsBangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual NeedsGfnyt
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.MiadAlsulami
 
(Rocky) Jaipur Call Girl - 9521753030 Escorts Service 50% Off with Cash ON De...
(Rocky) Jaipur Call Girl - 9521753030 Escorts Service 50% Off with Cash ON De...(Rocky) Jaipur Call Girl - 9521753030 Escorts Service 50% Off with Cash ON De...
(Rocky) Jaipur Call Girl - 9521753030 Escorts Service 50% Off with Cash ON De...indiancallgirl4rent
 
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune) Girls Service
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune)  Girls ServiceCALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune)  Girls Service
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune) Girls ServiceMiss joya
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...Taniya Sharma
 
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...jageshsingh5554
 
Call Girls Darjeeling Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Darjeeling Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Darjeeling Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Darjeeling Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...narwatsonia7
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...narwatsonia7
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...Garima Khatri
 
Low Rate Call Girls Patna Anika 8250192130 Independent Escort Service Patna
Low Rate Call Girls Patna Anika 8250192130 Independent Escort Service PatnaLow Rate Call Girls Patna Anika 8250192130 Independent Escort Service Patna
Low Rate Call Girls Patna Anika 8250192130 Independent Escort Service Patnamakika9823
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Miss joya
 
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...Taniya Sharma
 

Recently uploaded (20)

Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
 
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
 
Aspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliAspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas Ali
 
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service CoimbatoreCall Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
 
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual NeedsBangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
 
(Rocky) Jaipur Call Girl - 9521753030 Escorts Service 50% Off with Cash ON De...
(Rocky) Jaipur Call Girl - 9521753030 Escorts Service 50% Off with Cash ON De...(Rocky) Jaipur Call Girl - 9521753030 Escorts Service 50% Off with Cash ON De...
(Rocky) Jaipur Call Girl - 9521753030 Escorts Service 50% Off with Cash ON De...
 
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune) Girls Service
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune)  Girls ServiceCALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune)  Girls Service
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune) Girls Service
 
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Servicesauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
 
Call Girls Darjeeling Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Darjeeling Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Darjeeling Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Darjeeling Just Call 9907093804 Top Class Call Girl Service Available
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
 
Low Rate Call Girls Patna Anika 8250192130 Independent Escort Service Patna
Low Rate Call Girls Patna Anika 8250192130 Independent Escort Service PatnaLow Rate Call Girls Patna Anika 8250192130 Independent Escort Service Patna
Low Rate Call Girls Patna Anika 8250192130 Independent Escort Service Patna
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
 
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
 
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
 

NEURODEGENERATIVE DISORDERS.

  • 2. WHAT IS NEURODEGENERATIVE DISEASE? Neurodegeneration is the progressive loss of structure or functions of neurons including death of neurons.This causes problems with movement( called ataxias), or mental functioning ( called dementias). Neurodegenerative diseases are incurable ,resulting in progressive degeneration and /or death of neuron cells. The greatest risk factor for neurodegenerative diseases is aging. Mitochondrial DNA mutations as well as oxidative stress both contribute to aging. . Dementias are responsible for the greatest burden of neurodegenerative diseases,with alzheimer’s representing approximately 60-70% of dementia cases. Although treatments may help relieve some of the physical or mental symptoms , there is currently no way to slow disease progression and no known cures
  • 3. Scientist now recognize that the combination of a person’s genes and environment contributes to their risk of developing a neurodegenerative disease. That is, a person might have a gene that makes them more susceptible to a certain neurodegenerative disease, but whether ,when, and how severely the person is affected depends on what environmental factors he or she is exposed to during life. How is it caused? Is it just genetic mutations or a combination of a person’s genes and environmental conditions?
  • 4. TYPES OF THE NEURODEGENERATIVE DISORDERS: Progressive loss of selected neuron in discrete brain areas, resulting in characteristic disorder of movement , cognition, or both. Include: Alzheimer disease: dementia and disordered cognitive function. Parkinson’s disease: a disabling motor impairment disorder. Huntington disease: excessive and abnormal movement. Amyotrophic lateral sclerosis(ALS): progressive weakness and muscle atrophy.  Tay Sachs Disease: causes fatty substance build up in the brain.
  • 5. What is Dr. Alois Alzheimer discovered this disease in 1906 in one of his patient. It is an irreversible , progressive neurodegenerative disease that slowly destroys memory and thinking skills. It is the most common type of dementia. The risk increase with the increase of age. Alzheimer's is not just a disease of old age. Approximately 200,000 Americans under the age of 65 have younger-onset Alzheimer’s disease (also known as early- onset Alzheimer’s). Alzheimer's is a progressive disease, where dementia symptoms gradually worsen over a number of years. In its early stages, memory loss is mild, but with late- stage Alzheimer's, individuals lose the ability to carry on a conversation and respond to their environment. Alzheimer’s Disease?
  • 6. Scientists believe that for most people, Alzheimer's disease is caused by a combination of genetic, lifestyle and environmental factors that affect the brain over time. The exact causes of Alzheimer's disease aren't fully understood, but at its core are problems with brain proteins(Tau tangles and amyloid plagues) that fail to function normally, disrupt the work of brain cells (neurons) and unleash a series of toxic events. CAUSE OF ALZHEIMER’S DISEASE
  • 7. Memory loss, changes in memory Difficulty performing familiar task, routine chores Drastic changes in personality Poor or decreased judgement Problems in speaking,reading and writing. SYMPTOMS OF ALZHEIMER’S DISEASE
  • 8. Alzheimer’s medication For early to moderate Alzheimer’s, your doctor may prescribe medications such as donepezil (Aricept) or rivastigmine (Exelon). These drugs can help maintain high levels of acetylcholine in your brain. This is a type of neurotransmitter that can help aid your memory. To treat moderate to severe Alzheimer’s, your doctor may prescribe donepezil (Aricept) or memantine (Namenda). Memantine can help block the effects of excess glutamate. Glutamate is a brain chemical that’s released in higher amounts in Alzheimer’s disease and damages brain cells.
  • 9. What Is Parkinson’s Disease? Parkinson’s disease is typically considered a chronic, progressive neurodegenerative movement disorder. Parkinson’s primarily cause death of the vital nerve cells in the area of brain called SUBSTANTIA NIGRA. Some of these dying neurons produce dopamine which acts messenger and sends message to the part the brain that controls the movement and coordination. As the Parkinson’s disease progresses the amount produced from the brain decreases , leading a person unable to control movement normally
  • 10. What is the cause of Parkinson’s Disease? The cause of Parkinson's disease is unknown, but several factors appear to play a role, including: Your genes. Environmental triggers. These changes include: The presence of Lewy bodies. Clumps of specific substances within brain cells are microscopic markers of Parkinson's disease. These are called Lewy bodies, and researchers believe these Lewy bodies hold an important clue to the cause of Parkinson's disease. Alpha-synuclein is found within Lewy bodies. Although many substances are found within Lewy bodies, scientists believe an important one is the natural and widespread protein called alpha- synuclein (a-synuclein). It's found in all Lewy bodies in a clumped form that cells can't break down. This is currently an important focus among Parkinson's disease researchers. Researchers have also noted that many changes occur in the brains of people with Parkinson's disease, although it's not clear why these changes occur. 1 2 3
  • 11.
  • 12. If you have Parkinson’s disease, you have a lot of choices for treatment. There's no cure, but medicine and sometimes surgery can help. Medicine can often keep your symptoms in check for years. Levodopa. When you have Parkinson's, your brain gradually stops making dopamine -- a chemical that helps send signals in your brain. Levodopa may improve your symptoms because it causes your body to make more dopamine To curb nausea and other possible side effects from levodopa, doctors usually suggest you take a drug called carbidopa along with it. A combination drug with both medicines is called Sinemet. . These are drugs that imitate the action of dopamine in your brain. Parkinson’s Disease Treatment Dopamine agonists
  • 13. What Is Huntington’s Disease? Huntington’s disease is a rare and fatal inherited disorder of the CNS. It is caused by a single dominant allele , which means that heterozygous individuals will develop the disease. This disease causes the progressive breakdown of nerve cells in the brain especially damage in basal ganglia. Huntington’s disease has a broad impact on a person’s functional abilities and usually results in movements, thinking(cognitive) and psychiatric disorders. Most people with Huntington’s disease develop signs and symptoms in their 30s and 40s , but the onset of disease may be earlier or later in life. When disease onset begins before age 20, the condition is called juvenile Huntington’s disease.
  • 14. CAUSE OF HUNTINGTON’s DISEASE Huntington’s disease is caused by a CAG trinucleotide repeat expansion in the gene encoding the protein, huntingtin. Unaffected individuals have a stretch of CAG repeats in their genes that has fewer than 36 repeats – so this would look like CAGCAGCAGCAGCAGCAGCAGCAGCAGCAG… People with Huntington’s disease have 36 or more of these repeats. As CAG in these repeats is translated into the amino acid glutamine, the mutant huntingtin protein has an abnormally long polyglutamine tract. This type of mutation is seen in 8 other neurodegenerative diseases.
  • 15. HUNTINGTON’S DISEASE IMPULSIVITY BALANCE PROBLEMS SLOW EYE MOVEMENTS. SLOWNESS OF MOVEMENT DEPRESSION,ANXIETY TROUBLE SWALLOWING MUSCLE CONTRACTIONS, JERKING MOVEMENTS. FINE MOTOR TASK AFFECTED. RESTLESS FIDGETS MULTI-TASKING AFFECTED CHOREA INVOLUNTARY MOVEMENTS SYMPTOMS OF
  • 16. TREATMENT OF NEURODEGENERATIVE DISORDERS Medications are available to help manage the symptoms of Huntington’s disease , but treatments can’t prevent the physical, Mental and behavioral problems from getting worse. Although , a group called HDDW Huntington’s disease drug works does believe that with physical therapy, and medication, it can be treated. For right now, treating Huntigton’s Involves managing symptoms, Medications, speech or language therapy, physical therapy,nutritional support, exercise are very helpful.
  • 17. WHAT IS AMYOTROPHIC LATERAL SCLEROSIS? Amyotrophic lateral sclerosis (ALS) is a group of rare neurological diseases that mainly involve the nerve cells (neurons) responsible for controlling voluntary muscle movement.. 1 ALS belongs to a wider group of disorders known as motor neuron diseases, which are caused by gradual deterioration (degeneration) and death of motor neurons. These motor neurons initiate and provide vital communication links between the brain and the voluntary muscles 2 In ALS ,both the upper motor neurons and lower motor neurons degenerate , die and stop sending messages to the muscles. Unable to function,the muscle gradually weaken, starts to twitch and waste away. 3
  • 18. CAUSES OF AMYOTROPHIC LATERAL SCLEROSIS? Gene mutation. Various genetic mutations can lead to inherited ALS, which causes nearly the same symptoms as the non inherited form. Chemical imbalance. People with ALS generally have higher than normal levels of glutamate, a chemical messenger in the brain, around the nerve cells in their spinal fluid. Too much glutamate is known to be toxic to some nerve cells. Disorganized immune response. Sometimes a person's immune system begins attacking some of his or her body's own normal cells, which may lead to the death of nerve cells. Protein mishandling. Mishandled proteins within the nerve cells may lead to a gradual accumulation of abnormal forms of these proteins in the cells, destroying the nerve cells
  • 19. SYMPTOMS OF AMYOTROPHIC LATERAL SCLEROSIS Difficulty walking or doing your normal daily activities Difficulty keeping your head up or having a good posture. ALS often starts in the hands, feet or limbs, and then spreads Slurred speech or trouble swallowing. Tripping and falling Hand weakness or clumsiness Muscle cramps and twitching in your arms, shoulders and tongue Weakness in your leg, feet or ankles
  • 20. Treatment of ALS: No cure has yet been found for ALS. However, there are treatments available that can help control symptoms, prevent unnecessary complications, and make living with the disease easier. Supportive care is best provided by multidisciplinary teams of health care professionals such as physicians; pharmacists; physical, occupational, and speech therapists; nutritionists; social workers; respiratory therapists and clinical psychologists; and home care and hospice nurses. These teams can design an individualized treatment plan and provide special equipment aimed at keeping people as mobile, comfortable, and independent as possible. Stephen Hawking was diagnosed in his early 20s. He defied predictions as he would only live a few years but was wheel chair bound and spoke through a computerised voice.
  • 21. What is Tay-Sachs Disease? Tay-Sachs is a disease of the central nervous system. It is a neurodegenerative disorder that most commonly affects infants. In infants, it is a progressive disease that is unfortunately always fatal. Tay-Sachs can also occur in teens and adults, causing less severe symptoms, although this occurs more rarely. Healthy babies develop vision, movement, hearing, and other vital functions in part because enzymes clear out fatty protein and other unwanted material that can interfere with growth. But a baby with Tay-Sachs disease is born without one of those important enzymes, hexosaminidase A (HEXA). So, as those fatty proteins build up in the brain, they hurt the baby's sight, hearing, movement, and mental development. WHAT IS TAY -SACHS?
  • 22. The genetics behind the cause of Tay-Sachs disease.  The harmful quantities of a fatty substance called ganglioside GM2 accumulate in the nerve cells of the brain. As the nerve cells become distended with fatty materials, the cells become damaged and gradually lose their ability to function properly. The affected child fails to develop appropriate mental and motor functions. The gene mutation responsible for development of Tay- Sachs Disease is the mutation in HEX-A gene located in the chromosome no.15. Because of this gene there is less or no production of enzyme Hexosaminidase-A which is an enzyme responsible for the normal degradation of GM2 ganglioside.
  • 23.
  • 24. SYMPTOMS & TREATMENT As the GM2 ganglioside builds up in the brain---  Mental and physical activities of this children deteriorate.  As the disease progresses, this child becomes blind, deaf and inability to swallow.  Dementia and seizures are also common.  Eventually, the child is paralyzed.  Before the disease finally kills them. Scientist are still researching on the methods for the treatment of Tay Sachs disease:  One such method is gene therapy wherein a healthy gene could be inserted into the one with Tay Sachs and replacing the defective copy.  Enzyme replacement therapy, which would enable the patient to artificially provide the missing beta hexoaminidaseA enzyme the body is lacking.
  • 25. In the field of neuroscientific research, the field of neurodegenerative diseases are one of the most active in respect of both medical and associated social issues. Recent advances in the basic knowledge of such diseases have led to a re-evaluation about new therapeutically approaches. There are no effective treatments for degenerative diseases in modern society, but we can use Western medicine to deal with the acute disorders or symptoms and use the advantages of other integrative treatments to assist Western medicine in improving the ADL of the patients. Integrative medicine can, sometimes, exhibit protective effects or slow the morbidity of these diseases. We believe that with the development of integrative medicine and modern science, the former will increasingly take a more and more important role in the treatment of degenerative diseases. 01 02 03