cytokines play a key role in controlling the immune system. It facilitate other cells and organs to work, with this presentation you will be able to learn about what are cytokines, their types, & their biological roles along with diseases related to cytokines and cytokines based therapies.
cytokines play a key role in controlling the immune system. It facilitate other cells and organs to work, with this presentation you will be able to learn about what are cytokines, their types, & their biological roles along with diseases related to cytokines and cytokines based therapies.
A presentation descripes tumors,pathogensis,devlopment,antigenes and genes.
how host responds to them and how tumors evade immunity with latest lines of therapy and prevention.
facaulity of pharmacy.Damascus university.master of libaratory diagnossis. immunology.
Baraa ALomar and feras deban
A presentation descripes tumors,pathogensis,devlopment,antigenes and genes.
how host responds to them and how tumors evade immunity with latest lines of therapy and prevention.
facaulity of pharmacy.Damascus university.master of libaratory diagnossis. immunology.
Baraa ALomar and feras deban
WDR7 up-regulation upon knocking down of neighboring noncoding RNA using siRN...Vahid Erfani-Moghadam
Objective(s): Breast cancer is the second leading cause of cancer death in females. Understanding molecular mechanisms in cancer cells compared with normal cells is crucial for diagnostic and therapeutic strategies. Long intergenic non-protein coding RNA, a regulator of reprogramming (lincRNA-RoR) is a noncoding RNA which initially was detected in induced pluripotent stem cells, and it has an important role in cell reprogramming and highly expressed in breast cancer cells. A key point in successful gene silencing is the usage of siRNA delivery system that is safe and efficient. Materials and Methods: In this study, the fifth-generation of PAMAM dendrimer is used as a nanocarrier for entering siRNA molecules for gene silencing of lincRNA-RoR. WDR7 is the gene encoding adjacent of lincRNA-RoR, which has an important role in apoptosis and cell cycle. Gel retardation assay was used to find the best Negative/Positive (N/P) molar charge ratio of siRNA- PAMAM transfected into MDA-MB 231 cells. MTT assay was performed 24 hr after transfection revealed the IC50 value (half maximal inhibitory concentrations) about 100 nanomolar for lincRNA-ROR siRNA. Results: The lincRNA-RoR and WDR7 gene expression changes were evaluated by real-time PCR after siRNA treatment and showed an increase in the gene expression of WDR7. Conclusion: This study showed that PAMAM dendrimer G5/ siRNA could be a useful system delivery for future gene therapy approaches.
RNA splicing mutations and human disease: Pompe disease - Emanuele Buratti
Convegno del 25 novembre "Diagnosi e management della glicogenosi tipo 2" - Centro di coordinamento regionale malattie rare FVG
Edman Degradation is one of the N-terminal amino acid sequence analysis methods for peptide chains/proteins sequencing. The protein is reacted with PTC under weakly basic conditions and then treated with an acid to free the amino-terminal residue of the peptide chain in the form of PTH-AA for subsequent analysis. Peptide Mapping analysis is an effective method for rapidly localizing protein sequences and is a commonly used strategy in protein identification. The method uses mass spectrometry for peptide analysis and compares the obtained spectra with a protein database to obtain amino acid information. De Novo Protein Sequencing is a method based on the enzymatically cleaved peptides that exhibit regular fragmentation in mass spectrometry to obtain amino acid information from the mass differences in regular mass spectral peaks. https://www.creative-proteomics.com/services/proteomics-service.htm
Edman Degradation is one of the N-terminal amino acid sequence analysis methods for peptide chains/proteins sequencing. The protein is reacted with PTC under weakly basic conditions and then treated with an acid to free the amino-terminal residue of the peptide chain in the form of PTH-AA for subsequent analysis. Peptide Mapping analysis is an effective method for rapidly localizing protein sequences and is a commonly used strategy in protein identification. The method uses mass spectrometry for peptide analysis and compares the obtained spectra with a protein database to obtain amino acid information. De Novo Protein Sequencing is a method based on the enzymatically cleaved peptides that exhibit regular fragmentation in mass spectrometry to obtain amino acid information from the mass differences in regular mass spectral peaks. https://www.creative-proteomics.com/services/proteomics-service.htm
ShRNA-specific regulation of FMNL2 expression in P19 cellsYousefLayyous
This video encompasses all the steps and data produced for my graduation project in BSc in Biopharmaceutical science. During the course of the project we modified mammalian cells using Short Hairpin RNA to inhibit the correct function of the cytoskelleton. In this way we studied the importance of FMNL2 for the activation and regulation of actin fibers. Among the methods used are Flourescent microscopy, mamallian cell culture, cloning and flow cytometry.
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...Ana Luísa Pinho
Functional Magnetic Resonance Imaging (fMRI) provides means to characterize brain activations in response to behavior. However, cognitive neuroscience has been limited to group-level effects referring to the performance of specific tasks. To obtain the functional profile of elementary cognitive mechanisms, the combination of brain responses to many tasks is required. Yet, to date, both structural atlases and parcellation-based activations do not fully account for cognitive function and still present several limitations. Further, they do not adapt overall to individual characteristics. In this talk, I will give an account of deep-behavioral phenotyping strategies, namely data-driven methods in large task-fMRI datasets, to optimize functional brain-data collection and improve inference of effects-of-interest related to mental processes. Key to this approach is the employment of fast multi-functional paradigms rich on features that can be well parametrized and, consequently, facilitate the creation of psycho-physiological constructs to be modelled with imaging data. Particular emphasis will be given to music stimuli when studying high-order cognitive mechanisms, due to their ecological nature and quality to enable complex behavior compounded by discrete entities. I will also discuss how deep-behavioral phenotyping and individualized models applied to neuroimaging data can better account for the subject-specific organization of domain-general cognitive systems in the human brain. Finally, the accumulation of functional brain signatures brings the possibility to clarify relationships among tasks and create a univocal link between brain systems and mental functions through: (1) the development of ontologies proposing an organization of cognitive processes; and (2) brain-network taxonomies describing functional specialization. To this end, tools to improve commensurability in cognitive science are necessary, such as public repositories, ontology-based platforms and automated meta-analysis tools. I will thus discuss some brain-atlasing resources currently under development, and their applicability in cognitive as well as clinical neuroscience.
The ability to recreate computational results with minimal effort and actionable metrics provides a solid foundation for scientific research and software development. When people can replicate an analysis at the touch of a button using open-source software, open data, and methods to assess and compare proposals, it significantly eases verification of results, engagement with a diverse range of contributors, and progress. However, we have yet to fully achieve this; there are still many sociotechnical frictions.
Inspired by David Donoho's vision, this talk aims to revisit the three crucial pillars of frictionless reproducibility (data sharing, code sharing, and competitive challenges) with the perspective of deep software variability.
Our observation is that multiple layers — hardware, operating systems, third-party libraries, software versions, input data, compile-time options, and parameters — are subject to variability that exacerbates frictions but is also essential for achieving robust, generalizable results and fostering innovation. I will first review the literature, providing evidence of how the complex variability interactions across these layers affect qualitative and quantitative software properties, thereby complicating the reproduction and replication of scientific studies in various fields.
I will then present some software engineering and AI techniques that can support the strategic exploration of variability spaces. These include the use of abstractions and models (e.g., feature models), sampling strategies (e.g., uniform, random), cost-effective measurements (e.g., incremental build of software configurations), and dimensionality reduction methods (e.g., transfer learning, feature selection, software debloating).
I will finally argue that deep variability is both the problem and solution of frictionless reproducibility, calling the software science community to develop new methods and tools to manage variability and foster reproducibility in software systems.
Exposé invité Journées Nationales du GDR GPL 2024
What is greenhouse gasses and how many gasses are there to affect the Earth.moosaasad1975
What are greenhouse gasses how they affect the earth and its environment what is the future of the environment and earth how the weather and the climate effects.
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Sérgio Sacani
We characterize the earliest galaxy population in the JADES Origins Field (JOF), the deepest
imaging field observed with JWST. We make use of the ancillary Hubble optical images (5 filters
spanning 0.4−0.9µm) and novel JWST images with 14 filters spanning 0.8−5µm, including 7 mediumband filters, and reaching total exposure times of up to 46 hours per filter. We combine all our data
at > 2.3µm to construct an ultradeep image, reaching as deep as ≈ 31.4 AB mag in the stack and
30.3-31.0 AB mag (5σ, r = 0.1” circular aperture) in individual filters. We measure photometric
redshifts and use robust selection criteria to identify a sample of eight galaxy candidates at redshifts
z = 11.5 − 15. These objects show compact half-light radii of R1/2 ∼ 50 − 200pc, stellar masses of
M⋆ ∼ 107−108M⊙, and star-formation rates of SFR ∼ 0.1−1 M⊙ yr−1
. Our search finds no candidates
at 15 < z < 20, placing upper limits at these redshifts. We develop a forward modeling approach to
infer the properties of the evolving luminosity function without binning in redshift or luminosity that
marginalizes over the photometric redshift uncertainty of our candidate galaxies and incorporates the
impact of non-detections. We find a z = 12 luminosity function in good agreement with prior results,
and that the luminosity function normalization and UV luminosity density decline by a factor of ∼ 2.5
from z = 12 to z = 14. We discuss the possible implications of our results in the context of theoretical
models for evolution of the dark matter halo mass function.
Nutraceutical market, scope and growth: Herbal drug technologyLokesh Patil
As consumer awareness of health and wellness rises, the nutraceutical market—which includes goods like functional meals, drinks, and dietary supplements that provide health advantages beyond basic nutrition—is growing significantly. As healthcare expenses rise, the population ages, and people want natural and preventative health solutions more and more, this industry is increasing quickly. Further driving market expansion are product formulation innovations and the use of cutting-edge technology for customized nutrition. With its worldwide reach, the nutraceutical industry is expected to keep growing and provide significant chances for research and investment in a number of categories, including vitamins, minerals, probiotics, and herbal supplements.
Salas, V. (2024) "John of St. Thomas (Poinsot) on the Science of Sacred Theol...Studia Poinsotiana
I Introduction
II Subalternation and Theology
III Theology and Dogmatic Declarations
IV The Mixed Principles of Theology
V Virtual Revelation: The Unity of Theology
VI Theology as a Natural Science
VII Theology’s Certitude
VIII Conclusion
Notes
Bibliography
All the contents are fully attributable to the author, Doctor Victor Salas. Should you wish to get this text republished, get in touch with the author or the editorial committee of the Studia Poinsotiana. Insofar as possible, we will be happy to broker your contact.
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
Body fluids_tonicity_dehydration_hypovolemia_hypervolemia.pptx
MS Thesis Presentation on TPMT Gene Polymorphism
1. Genotyping of Thiopurine S-methyltransferase
(TPMT) for its Variant TPMT*3B (G460A) in a
Bangladeshi Population
Presented by
Md. Solayman
Session: 2014-2015
Department of Biochemistry & Molecular Biology
Faculty of Biological Sciences
Jahangirnagar University, Savar, Dhaka-1342
2.
3. Thiopurine S-methyltransferase (TPMT)
TPMT encodes TPMT enzyme that metabolizes thiopurine
drugs.
TPMT is located in the 6p22.3.
6
Figure 1. Location of TPMT gene in the short (p) arm of
chromosome 6 at position 22.3
Subcellular Expression: Human liver, Kidney and RBC.
4. TPMT is a Phase II Enzyme
Figure 2. Fraction of clinically used drugs metabolized by the
major phase II enzymes (left) and 3D structure of TPMT enzyme
(right)
TPMTcatalyzes the S-methylation of thiopurine drugs
5. Thiopurine Drugs
Azathioprine (AZA) 6-Mercaptopurine 6-Thioguanine
Used in the treatment of acute lymphoblastic leukemia,
autoimmune disorders (e.g., Crohn's disease and Rheumatoid
Arthritis) and of organ transplant recipients
Figure 3. Structure of common thiopurine drugs
6. Polymorphism of TPMT
Single Nucleotide Polymorphisms (SNPs) in TPMT gene
influence TPMT activity
To date, 26 genetic variants of TPMT have been identified
TPMT*3B (G460A) is one of the major SNPs found in TPMT
TPMT*3B (G460A) SNP causes the amino acid change as
Ala154Thr
TPMT*3B SNP causes intermediate activity in its heterozygous
variant [TPMT*3B (GA)]
TPMT*3B SNP causes low activity in its homozygous variant
[TPMT*3B (AA)]
7. Although a number of studies have reported on the detection of
TPMT*3B (G460A) variants in several populations, presence or
absence of TPMT*3B (G460A) polymorphisms in any
Bangladeshi population is not yet known.
Hypothesis
8. To examine the biochemical markers of liver and kidney
function status of the recruited subjects
To include the healthy ones based on the status of liver and
kidney function markers
This study was aimed to anticipate possible drug dose-
response relationship among Bangladeshi subjects for drugs
to be metabolized by TPMT as well as to preview the
management of relevant diseases with the selection of
appropriate drug and its dose.
continued
Aims and Objectives
9. To detect G460A mutation in TPMT leading to the
generation of TPMT*3B variants
To estimate the genotype and allelic frequencies of
TPMT*3B variants
To optimize suitable condition for PCR method to detect
TPMT*3B variants at the genomic level
10.
11. Place of Study
The study was conducted in the Research Laboratory for
Biomedical Sciences, Department of Biochemistry and
Molecular Biology, Jahangirnagar University, Savar, Dhaka,
Bangladesh.
Study Design
It was a cross-sectional study.
Study Subjects
A total of symptomatically healthy unrelated 129 male and
female subjects were recruited irrespective of race, religion and
socioeconomic status.
12. Inclusion Criteria
Undergraduate as well as Postgraduate Students of
Jahangirnagar University as study subjects
Subjects representing different Divisions of Bangladesh.
Symptomatically healthy subjects
Subjects having levels of liver and kidney function markers
within the normal ranges
Exclusion Criteria
Subjects unable to provide informed consent
Subjects providing unreliable information
Subjects having abnormal levels of liver and kidney function
markers
13. AST, ALT, ALP,
DBIL, TBIL, TP, Alb
Biochemical Parameters
Creatinine, Urea, TP,
Alb
All of the biochemical parameters were measured by
Spectrophotometric method (QCA mini Biochemistry Auto
Analyzer, Spain)
Glycemic status: Glucose
Haemato-immunological status: ESR
14. Study of TPMT*3B (G460A) Polymorphism
i. DNA extraction from whole blood: Genomic DNA
Purification Kit (Promega, USA)
Quantitative determination of DNA concentration: Nano
Drop Spectrophotometer
Qualitative determination of DNA yield: Agarose gel (0.7%)
electrophoresis
ii. Polymerase chain reaction (PCR)
Qualitative determination of amplified product: Agarose gel
(1.5%) electrophoresis
Primer set:
Forward: 5ˈ- AGGCAGCTAGGGAAAAAGAAAG -3ˈand
Reverse: 5ˈ- CCTTATAGCCTTACACCCAG - 3ˈ
PCR product size was 690 bp
continued
15. iii. RFLP of TPMT*3B (G460A) polymorphic marker in TPMT
gene was analyzed using MwoI restriction enzyme
Recognition site of MwoI restriction enzyme was
5′…GCNNNNN NNGC…3′
3′…CGNN NNNNNCG… 5′
Enzyme digestion product was resolved in agarose gel (2.0%)
electrophoresis.
16. Statistical analysis was performed using Statistical Package
for Social Sciences (SPSS) software.
Data were expressed as mean±SD and number (percentage)
as appropriate.
Quantile- quantile (Q-Q) plot was performed to determine
normal distribution of studied variables.
Chi-square test was performed to calculate the statistical
association.
‘p’ value <0.05 was considered statistically significant.
Statistical analyses
19. Assessment of Biochemical Parameters
Parameters Serum Levels (mean±SD) Normal Range
AST
27.12±6.54 U/L in male
31.97±7.78 U/L in female
≤34.00U/L in male
≤40.00 U/L in female
ALT 24.74±14.22 U/L 20.00-60.00 U/L
ALP 172.92±47.37 U/L 98.00-279.00 U/L
DBIL 0.32±0.50 mg/dL ≤0.40 mg/dL
TBIL 0.68±0.55 mg/dL ≤1.20 mg/dL
Alb 4.57±0.40 g/dL 3.50-5.00 g/dL
TP 7.37±1.60 g/dL 6.60-8.700 g/dL
Creatinine
0.77±1.45 mg/dL in male
0.69±0.17 mg/dL in female
0.60-1.20 mg/dL in male
0.50-1.10 mg/dL in female
Urea 24.25±6.34 mg/dL 10.00-50.00 mg/dL
Glucose 87.75±21.17 mg/dL 75.00-115.00 mg/dL
ESR
9.37±5.12 mm/hr in male
11.26±7.02 mm/hr in female
<15 mm/hr in male
<20 mm/hr in female
Table 1. Serum Levels (mean±SD) of the Biochemical and Haemato-
immunological Markers in the Study Subjects
20. Genomic Analyses of the Study Subjects
Figure 5. Representative agarose gel (0.7%) electrophoresis
image showing extracted gDNA from whole blood
L1
L2
L3
L4
L5
L6
L8
L7
L10
L17
L15
L13
L11
L9
L16
L12
L14
continued
21. Figure 6. Agarose (1.5%) gel image analysis of PCR
products having TPMT*3B (G460A) variant. L2 contains
negative control; L1, L3-L16 contains PCR products; and L17 contains
Molecular Weight Marker (MWM). L represents for Lane.
L1
L2
L3
L4
L5
L6
L8
L7
L10
L17
L15
L13
L11
L9
L16
L12
L14
200 bp
100 bp
1500 bp
600 bp690 bp
continued
22. Figure 7. Representative agarose gel (2%) electrophoresis image of MwoI
digested PCR products showing detection of TPMT*3B (G460A) variants.
Lane L1, L2, L3, L5, L6, L8, L9, L10, L11, L12, L13, L15 and L16 showed samples
detected as homozygous wild genotype (GG) (digested product sizes are 459 bp and
231bp). Lane L4 showed samples detected heterozygous (Ht) variant (GA) (digested
product sizes are 690 bp, 459 bp and 231bp).
Sample in Lane L7 showed homozygous (Hz) variant (AA) (690 bp).
Lane L14 showed a negative control (without any PCR product) and Lane L17 showed
molecular weight markers (MWM) of 100 bp DNA ladder.
200 bp
100 bp
1500 bp
600 bp690 bp
231 bp
459 bp
L1
L2
L3
L4
L5
L6
L8
L7
L10
L17
L15
L13
L11
L9
L16
L12
L14
23. Analysis of the Genotype and Allele Frequencies of
TPMT*3B
Table 2. Distribution of TPMT*3B (G460A) Genotypes in the Study
Subjects
Genotype Frequency (%) (n=129)
Wild type (GG) 96.90 (n=125)
Heterozygous mutant (GA) 0.80 (n=1)
Homozygous mutant (AA) 2.30 (n=3)
Allele Frequency (%) (n=129)
G 97.29 (n=251)
A 2.71 (n=7)
Table 3. Distribution of TPMT*3B (G460A) Alleles
24. Results were expressed as frequency (number). Chi-square test was
performed to calculate the statistical association. p value <0.05 was
considered as statistically significant level.
Gender-wise Association of TPMT*3B (G460A)
Genotypes in the Study Subjects
Table 4. Gender-wise Association of TPMT*3B (G460A) Genotypic
Variants in the Study Subjects
Genotype
Frequency of Genotypes (%)
(n=129) χ2 /p
Male (n=81) Female (n=48)
Wild type (GG) 97.53% (n=79) 95.83% (n=46)
0.015/
0.902
Heterozygous mutant (GA) 0.00 (n=0) 2.08% (n=1)
Homozygous mutant (AA) 2.47% (n=2) 2.08% (n=1)
25. Discussion
Nothing is known about the presence of 26 variants of TPMT
gene polymorphisms in Bangladeshi population, which have
been reported in a number of populations in earlier studies.
In this study, genotypic and allelic variants of TPMT*3B
(G460A) in a Bangladeshi population of healthy adults were
studied, who may require treatment with thiopurine drugs at
any time of their lifetime ahead.
The frequency of the occurrences of TPMT*3B (G460A)
variant genotypes is remarkably higher in the studied
population of Bangladesh (3.10%) compared to that of Indian
(0.61%), American Caucasian (1.3%), Brazilian (0.3%),
French Caucasian (0.5%) populations.
26. Conclusions
1. Overall, 96.90% was wild type and 3.10% was mutants in
the study subjects.
2. Among 3.10% of mutants, 2.30% was homozygous and
0.80% was heterozygous variants.
3. This finding may help to select the dose of thiopurine drugs
Wild genotype: normal dose
Heterozygous mutant: low dose
Homozygous mutant: need to take alternative therapy.
4. Screening of TPMT*3B (G460A) requiring treatment with
thiopurine drugs should be mandatory of the Bangladeshi
patients.