Foldable world

Transparent & Flexible Electronics
Massimo Marrazzo - biodomotica.com 1
Nanotechnology
VOL. I
2011
Transparent & flexible electronics
MASSIMO MARRAZZO - BIODOMOTICA®

2 Massimo Marrazzo - biodomotica.com
IIIIIIIInnnnnnnnddddddddeeeeeeeexxxxxxxx
Nanotechnology pag.3
Graphene 7
Nanotubes 8
Printed electronics 13
Ink for "printed electronics" 19
Printer for "printed electronics" 21
Transparent and Strong Plastic 24
Transparent Electronics 25
Flexible and trasparent displays 30
Electronic paper / E-paper / E-ink 32
Printed battery 33
Charging batteries without wires 45
WiTricity 46
Solar Energy 48
Seebeck effect - Thermoelectric 55
Printed Memory 77
Printed Antennas 79
Wireless technologies 81
Nanotube Radio 84
Sound 87
Lens 94
Bio-Sensors 98
Virtual Muscles 101
Gecko 106
Mems 113
Ecology 115
Link to transparent electronics 116
Applications of transparent or flexible electronics 117
Invisibility Cloak 125
Acronyms 128
Books 130
Journal Papers 133
Links 134
Show/Convention/Exposition 136
Blogs 136
Toolbox 137
iPad & iPhone applications for Nanotech 138
Android applications for read RSS Nanotech 139
2011 Update 140

NNNNNNNNaaaaaaaannnnnnnnooooooootttttttteeeeeeeecccccccchhhhhhhhnnnnnnnnoooooooollllllllooooooooggggggggyyyyyyyy
- http://www.nano.org.uk/whatis.htm
What is Nanotechnology?
Nanotechnology originates from the Greek word “nanos” meaning “dwarf".
A nanometre is one billionth (10-9) of a metre, which is tiny, only the length of ten hydrogen atoms,
or about one hundred thousandth of the width of a hair! Although scientists have manipulated
matter at the nanoscale for centuries, calling it physics or chemistry, it was not until a new
generation of microscopes were invented in the nineteen eighties in IBM, Switzerland that the
world of atoms and molecules could be visualized and managed.
In simple terms, nanotechnology can be defined as 'engineering at a very small scale', and this
term can be applied to many areas of research and development: from medicine to manufacturing
to computing, and even to textiles and cosmetics. It can be difficult to imagine exactly how this
greater understanding of the world of atoms and molecules has and will affect the everyday objects
we see around us, but some of the areas where nanotechnologies are set to make a difference are
described below.
From Micro to Nano
Nanotechnology, in one sense, is the natural continuation of the miniaturization revolution that we
have witnessed over the last decade, where millionth of a metre (10-6 m) tolerances
(microengineering) became commonplace, for example, in the automotive and aerospace
industries enabling the construction of higher quality and safer vehicles and planes. It was the
computer industry that kept on pushing the limits of miniaturization, and many electronic devices
we see today have nano features that owe their origins to the computer industry — such as
cameras, CD and DVD players, car airbag pressure sensors and inkjet printers.
©2008 Institute of Nanotechnology
- http://www.crnano.org/whatis.htm
What is Nanotechnology?
A basic definition: Nanotechnology is the engineering of functional systems at the molecular scale.
This covers both current work and concepts that are more advanced.
In its original sense, 'nanotechnology' refers to the projected ability to construct items from the
bottom up, using techniques and tools being developed today to make complete, high performance
products.
The Meaning of Nanotechnology
When K. Eric Drexler popularized the word 'nanotechnology' in the 1980's, he was talking about
building machines on the scale of molecules, a few nanometers wide motors, robot arms, and even
whole computers, far smaller than a cell. Drexler spent the next ten years describing and analyzing
these incredible devices, and responding to accusations of science fiction. Meanwhile, mundane
technology was developing the ability to build simple structures on a molecular scale. As
nanotechnology became an accepted concept, the meaning of the word shifted to encompass the
simpler kinds of nanometer-scale technology. The U.S. National Nanotechnology Initiative was
created to fund this kind of nanotech: their definition includes anything smaller than 100
nanometers with novel properties.

Four Generations
Mihail (Mike) Roco of the U.S. National Nanotechnology Initiative has described four generations of
nanotechnology development (see chart below). The current era, as Roco depicts it, is that of
passive nanostructures, materials designed to perform one task. The second phase, which we are
just entering, introduces active nanostructures for multitasking; for example, actuators, drug
delivery devices, and sensors. The third generation is expected to begin emerging around 2010
and will feature nanosystems with thousands of interacting components. A few years after that, the
first integrated nanosystems, functioning (according to Roco) much like a mammalian cell with
hierarchical systems within systems, are expected to be developed.
© 2002-2008 Center for Responsible Nanotechnology TM CRN is an affiliate of World Care®, an international, non-profit,
501(c)(3) organization.

- http://en.wikipedia.org/wiki/Nano-
Nano- (symbol n) is a prefix in the metric system denoting a factor of 10−9 or 0.000000001. It is frequently
encountered in science and electronics for prefixing units of time and length, such as 30 nanoseconds
(symbol ns), 100 nanometres (nm) or in the case of electrical capacitance, 100 nanofarads (nF).
The prefix is derived from the Greek νάνος, meaning "dwarf", and was officially confirmed as standard in
1960.
In the United States, the use of the nano prefix for the farad unit of electrical capacitance is uncommon;
capacitors of that size are more often expressed in terms of a small fraction of a microfarad or a large
number of picofarads.
When used as a prefix for something other than a unit of measure, as in "nanoscience", nano means relating
to nanotechnology, or on a scale of nanometres. See nanoscopic scale.
SI prefixes
Prefix Symbol 10n Decimal Short scale Long scale
yotta Y 1024 1000000000000000000000000 Septillion Quadrillion
zetta Z 1021 1000000000000000000000 Sextillion Trilliard
exa E 1018 1000000000000000000 Quintillion Trillion
peta P 1015 1000000000000000 Quadrillion Billiard
tera T 1012 1000000000000 Trillion Billion
giga G 109 1000000000 Billion Milliard
mega M 106 1000000 Million
kilo k 103 1000 Thousand
hecto h 102 100 Hundred
deca da 101 10 Ten
10
0
1 One
deci d 10-1 0.1 Tenth
centi c 10-2 0.01 Hundredth
milli m 10-3 0.001 Thousandth
micro ì 10-6 0.000001 Millionth
nano n 10-9 0.000000001 Billionth Milliardth
pico p 10-12 0.000000000001 Trillionth Billionth
femto f 10-15 0.000000000000001 Quadrillionth Billiardth
atto a 10-18 0.000000000000000001 Quintillionth Trillionth
zepto z 10-21 0.000000000000000000001 Sextillionth Trilliardth
yocto y 10-24 0.000000000000000000000001 Septillionth Quadrillionth
The International System of Units (SI) specifies a set of unit prefixes known as SI prefixes or metric prefixes.
An SI prefix is a name that precedes a basic unit of measure to indicate a decadic multiple or fraction of the
unit. Each prefix has a unique symbol that is prepended to the unit symbol.
Name Abbrev. Decimal Representative objects with this size scale
metre m 100 Height of a 7-year-old child.
deci- dm 10-1 Size of our palm.
centi- cm 10-2 Length of a bee.
milli- mm 10-3 Thickness of ordinary paperclip.
micro- ìm 10-6 Size of typical dust particles.
nano- nm 10-9 The diametre of a C60 molecule is about 1 nm.
pico- pm 10-12 Radius of a Hydrogen Atom is about 23 pm.
femto- fm 10-15 Size of a typical nucleus of an atom is 10 fm.
atto- am 10-18 Estimated size of an electron

http://commons.wikimedia.org/wiki/Commons:Featured_picture_candidates/Image:Biological_and_technological_scales_compared-en.svg

GGGGGGGGrrrrrrrraaaaaaaapppppppphhhhhhhheeeeeeeennnnnnnneeeeeeee
- http://en.wikipedia.org/wiki/Graphene
Graphene is a one-atom-thick planar sheet of sp2-bonded carbon atoms that are densely packed
in a honeycomb crystal lattice. It can be viewed as an atomic-scale chicken wire made of carbon
atoms and their bonds. The name comes from GRAPHITE + ENE; graphite itself consists of many
graphene sheets stacked together.
Graphene is an atomic-scale chicken wire
made of carbon atoms.
Integrated circuits
Graphene has the ideal properties to be an excellent component of integrated circuits. Graphene has a high
carrier mobility, as well as low noise allowing it to be utilized as the channel in a FET. The issue is that single
sheets of graphene are hard to produce, and even harder to make on top of an appropriate substrate.
Researchers are looking into methods of transferring single graphene sheets from their source of origin
(mechanical exfoliation on SiO2 / Si or thermal graphitization of a SiC surface) onto a target substrate of
interest. In 2008, the smallest transistor so far, one atom thick, 10 atoms wide was made of graphene.
Transparent conducting electrodes
Graphene's high electrical conductivity and high optical transparency make it a candidate for transparent
conducting electrodes, required for such applications as touchscreens, liquid crystal displays, organic
photovoltaic cells, and OLEDs. In particular, graphene's mechanical strength and flexibility are advantageous
compared to indium tin oxide, which is brittle, and graphene films may be deposited from solution over large
areas.

NNNNNNNNaaaaaaaannnnnnnnoooooooottttttttuuuuuuuubbbbbbbbeeeeeeeessssssss
- http://en.wikipedia.org/wiki/Carbon_nanotube
3D model of three types of single-walled carbon nanotubes.
Carbon nanotubes (CNTs) are allotropes of carbon with a nanostructure that can have a length-to-diameter
ratio greater than 1,000,000. These cylindrical carbon molecules have novel properties that make them
potentially useful in many applications in nanotechnology, electronics, optics and other fields of materials
science. They exhibit extraordinary strength and unique electrical properties, and are efficient conductors of
heat. Inorganic nanotubes have also been synthesized.
Their name is derived from their size, since the diameter of a nanotube is in the order of a few nanometers
(approximately 1/50,000th of the width of a human hair), while they can be up to several millimeters in length
(as of 2008). Nanotubes are categorized as single-walled nanotubes (SWNTs) and multi-walled nanotubes
(MWNTs).
- http://www.unidym.com/technology/about_carbon.html
What are Carbon Nanotubes?
Carbon nanotubes (CNTs) are tubular cylinders of carbon atoms that have extraordinary electrical,
mechanical, optical, thermal, and chemical properties.

Individual carbon nanotubes can conduct electricity better than copper, possess higher tensile strength than
steel, and conduct heat better than diamond. In electronic applications, carbon nanotubes can possess higher
mobilities than single crystal silicon. All this in a material that is over 10,000 times thinner than a human hair.
There are multiple forms of carbon nanotubes, varying in diameter, length, and in the tendency of the
nanotubes to form ropes and bundles of tubes. Some forms of carbon nanotubes are metallic and highly
conducting; other forms are semiconducting, and can form the basis of electronic switches.
- http://www.unidym.com/technology/about_carbon_more.html
CARBON NANOTUBES
Carbon nanotubes (fullerene nanotubes) are part of the fullerene family of carbon materials discovered by Dr.
Richard E. Smalley and colleagues in 1985. They include single-wall carbon nanotubes (SWNTs), and nested
(endohedral or endotopic) SWNTs, i.e., one, two or more tubular fullerenes nested inside another tubular
fullerene. Each tubular fullerene is a huge carbon molecule, often having millions of carbon atoms bonded
together to form a tiny tube. Carbon nanotube diameters range from about 0.5 to about 10 nanometers (one
nanometer = 10-9 meter) and their lengths are typically between a few nanometers and tens of microns (one
micron = 10-6 meter).
Carbon is a truly remarkable atom. It readily bonds with itself into extended sheets of atoms comprising linked
hexagonal rings shown below. Each carbon atom is covalently bonded to its three nearest neighbors.

This unique sheet structure is called graphene. Solid graphite is made up of layers of graphene stacked as
shown above. No other element in the periodic table bonds to itself in an extended network with the strength of
the carbon-carbon bond, which is among the strongest of chemical bonds. Some of the electrons in the
carbon-carbon bonds are free to move about the entire graphene sheet, rather than stay home with their donor
atoms, giving the structure good electrical conductivity. The tight coupling between atoms in the carbon-
carbon bond provides an intrinsic thermal conductivity that exceeds almost all other materials. As suggested
by the carbon nanotube figure above, the structure of a fullerene nanotube is that of a sheet of graphene,
wrapped into a tube and bonded seamlessly to itself. This is a true molecule with every atom in its place and
very few defects: an example of molecular perfection on a relatively large scale.
The special nature of the bonded carbon sheet, the molecular perfection of carbon nanotubes, and their long
tubular shape endow them with physical and chemical properties that are unlike those of any other material.
These properties include high surface area, excellent electrical and thermal conductivity, and tremendous
tensile strength, stiffness, and toughness.
In a single tube, every atom is on two surfaces - the inside and the outside, and a single gram of nanotubes
has over 2400 m2 of surface area! The nature of the carbon bonding gives the tubes their great tensile
strength and electrical and thermal conductivity. The carbon nanotubes' stiffness and toughness derives from
their molecular perfection. In most materials the actual observed stiffness and toughness are degraded very
substantially by the occurrence of defects in their structure. For example, high strength steel typically fails at
about 1% of its theoretical breaking strength. Carbon nanotubes, however, achieve values very close to their
theoretical limits because of their perfection of structure - there are no structural defects where mechanical
failures can begin! It is, however, the tubular geometry of carbon nanotubes that gives them their most exotic
properties. Depending on the orientation of the graphene sheet forming the tube's wall, the tube can be either
metallic or semiconducting. The metallic tubes conduct electricity just as metals do and the semiconducting
ones have great promise as the basic elements of a new paradigm for electronic circuitry at the molecular
level.
Basic Structure
There are literally hundreds of different carbon nanotube structures. One can identify these structures by
thinking of the carbon nanotube as a sheet of graphene wrapped into a seamless cylinder. As one might
imagine, there are many ways to wrap a graphene cylinder, and the cylinder can have a wide range of
dimensions. Soon after fullerene nanotubes were discovered, a classification scheme was devised to describe
the different conformations of graphene cylinders. This classification scheme uses an ordered pair of numbers,
(n,m), and is based upon the diagram of graphene shown below. Each carbon atom in the graphene sheet is
bonded to three other carbon atoms, forming a Y-shaped vertex of carbon-carbon bonds. In order to make a
seamless graphene tube of a uniform diameter, one must wrap the graphene sheet in a way that permits every
carbon atom in the cylinder to be bonded to three other carbon atoms where the sheet joins to itself. The
number of ways this wrapping can be achieved is countable according to the numbering scheme given in the
figure below. The unit vectors of the 2-dimensional graphene lattice are shown as a1 and a2 below. Each
vertex that could possibly join to the origin during a wrapping operation is labeled with an ordered pair wherein
the first number of the pair is the distance (in lattice repeat units) of the vertex from the origin along a1, and
the second number is the distance of the vertex from the origin along a2.

- http://www.unidym.com/technology/cnt_application_electronics.html
Transparent Conductive Films
One of the more amazing attributes of carbon nanotubes is that they can form films that are highly electrically
conductive, but almost completely transparent. The film is only about 50 nanometers thick, and very porous.
Under an electron microscope, the film is seen to be a just a few layers of endless carbon nanotube ropes.
The films have an ideal conductivity for multiple types of touch screens which have applications including
point-of-sale terminals, games, portable computers, cell phones, personal digital assistants and many others.
The transparent films used initially for touch screens also reach any application that requires a large-area
transparent conductor, including LCD displays, plastic solar cells, and organic LED lighting, and transparent
carbon nanotube films have been demonstrated in the laboratory to be effective in all these areas.
Printable Transistors
The semiconducting properties of carbon nanotubes can be exploited to create printable transistors with
extremely high performance. Specifically, researchers have shown CNT-based transistors employing a sparse
nanotube network to achieve mobilities of 1 cm2/V-s (Schindler et al., Physica E (2006), while those using an
aligned array of single-walled nanotubes can reach as high as 480 cm2/V-s [Kang et al., Nature Nanotech. 2,
230 (2007)]. Nanotubes also prove to be useful additives to polymer-based TFTs and help to overcome some
of the shortcomings of those devices. Beyond their performance, such devices are compatible with solution-
based printing techniques, which enable dramatic cost savings in such devices as LCDs and OLED-based
displays.
Field Emission
Carbon nanotubes are the best field emitters of any known material. This is understandable, given their high
electrical conductivity, and the unbeatable sharpness of their tip. If the tip is placed close to another electrode
and a voltage is applied between the tube and electrode, a large electric field builds up near the tip of the tube.
The magnitude of the electric field is inversely proportional to the radius of curvature of the tip. Thus the
sharper the tip is, the larger the electric field. Even with only a few volts applied to an electrode a few microns
away from the nanotube tip, electric fields in the range of a millions of Volts per centimeter will build up near
the tip. These fields are large enough to pull a substantial number of electrons out of the tip. As "cold cathode"
electron emitters, carbon nanotube films have been shown to be capable of emitting over 4 Amperes per
square centimeter. Furthermore, the current is extremely stable [B.Q. Wei, et al. Appl. Phys. Lett. 79 1172
(2001)]. An immediate application of this behavior receiving considerable interest is in field-emission flat-panel
displays. Instead of a single electron gun, as in a traditional cathode ray tube display, there is a separate
electron gun for each pixel in the display. The high current density, low turn-on and operating voltage, and
steady, long-lived behavior make carbon nanotubes ideal field emitters for this application. Other applications
utilizing the field-emission characteristics of carbon nanotubes include: high-resolution x-ray sources, general
cold-cathode lighting sources, high-performance microwave tubes, lightning arrestors, and electron
microscope cathodes.
Integrated Circuits
Nanotubes might also represent a solution to thermal management problems plaguing the semiconductor
industry. As more and more transistors are packed on chips, microprocessors are getting hotter and noisier.
The industry is searching for new types of heat sinks to control temperatures on chips. Nanotubes have
tremendous thermal conductivity, and a number of firms are developing nanotube-based heat sinks. Due to
the unique conducting and semiconducting properties of nanotubes, devices based on individual carbon
nanotubes may eventually replace existing silicon devices. For example, several prototypes for future memory
devices based on nanotubes have been demonstrated. In light of their high carrying capacity, nanotubes might
replace copper interconnects in integrated circuits. Additionally, individual nanotubes have been shown to be
superior to existing silicon transistors and diodes.
- http://thefutureofthings.com/news/1106/high-speed-carbon-nanotube-based-chips.html
High Speed Carbon Nanotube Based Chips
A team of electrical engineers from Stanford University and Toshiba have developed nanotube wires that can
withstand data transfer speeds comparable to those of commercially available chips. In a paper published in
the _Nano Letters" Journal, the researchers reported they had successfully used nanotubes to wire a silicon
chip operating at the same speeds as today's processors.

Silicon CMOS integrated circuit with Carbon nanotube interconnect.
(Credit: Gael Close Stanford University) - Copyright © 2008 The Future of Things.

PPPPPPPPrrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss
- http://en.wikipedia.org/wiki/Printed_electronics
Printed electronics is a set of printing methods used to create electrical devices. Paper's rough surface and
high water absorption rate has focused attention on materials such as plastic, ceramics and silicon. Printing
typically uses common printing equipment, such as screen printing, flexography, gravure, offset lithography
and inkjet. Electrically functional electronic or optical inks are deposited on the substrate, creating active or
passive devices, such as thin film transistors or resistors. Printed electronics is expected to facilitate
widespread, very low-cost, low-performance electronics for applications such as flexible displays, smart labels,
decorative and animated posters, and active clothing that do not require high performance.
The term printed electronics is related to organic electronics or plastic electronics, in which one or more inks
are composed of carbon-based compounds. These other terms refer to the ink material, which can be
deposited by solution-based, vacuum-based or some other method. Printed electronics, in contrast, specifies
the process, and can utilize any solution-based material, including organic semiconductors, inorganic
semiconductors, metallic conductors, nanoparticles, nanotubes, etc.
- http://alislab.com/research/sub01.html
Printed electronics (also called electronic printing) is the term for a relatively new technology that defines the
printing of electronics on common media such as paper, plastic using standard printing processes. This
printing preferably utilizes common press equipment in the graphics arts industry, such as screen printing,
flexography, gravure, contact printing and offset lithography. Instead of printing graphic arts inks, families of
electrically functional electronic inks (conducting polymer, SWNT, insulator solution, etc) are used to print
active devices, such as thin film transistors, electronic paper, and flexible displays. Printed electronics is
expected to facilitate widespread and very low-cost electronics useful for applications not typically associated
with conventional silicon based electronics, such as flexible displays, RF-ID tags, printing displays, and
functional clothing.
- http://en.wikipedia.org/wiki/Conductive_polymer
Conductive polymers or more precisely intrinsically conducting polymers (ICPs) are organic polymers
that conduct electricity. Such compounds may have metallic conductivity or be semiconductors. The biggest
advantage of conductive polymers is their processability. Conductive polymers are also plastics, which are
organic polymers. Therefore, they can combine the mechanical properties (flexibility, toughness, malleability,
elasticity, etc.) of plastics with high electrical conductivity.
- http://www.nanowerk.com/spotlight/spotid=1814.php

The fabrication of electronic devices on plastic substrates has attracted considerable recent attention owing to
the proliferation of handheld, portable consumer electronics. Plastic substrates possess many attractive
properties including biocompatibility, flexibility, light weight, shock resistance, softness and transparency.
Achieving high performance electronics or sensors on plastic substrates is difficult, because plastics melt at
temperatures above 120 degrees C. Central to continued advances in high-performance plastic electronics is
the development of robust methods for overcoming this temperature restriction. Unfortunately, high quality
semiconductors (such as silicon) require high growth temperatures, so their application to flexible plastics is
prohibited. A group of researchers at the California Institute of Technology now showed that highly ordered
films of silicon nanowires can be literally glued onto pieces of plastic to make flexible sensors with state-of-the-
art sensitivity to a range of toxic chemicals. These nanowires are crystalline wires made out of doped silicon –
the mainstay of the computer industry. By etching nanowires into a wafer of silicon, and then peeling them off
and transferring them to plastic, they developed a general, parallel, and scalable strategy for achieving high
performance electronics on low cost plastic substrates.
Photograph of the flexible sensor chip (Image: Heath Group, Caltech)
By Michael Berger, Copyright 2008 Nanowerk LLC
- http://www.gizmag.com/go/4749/picture/16223/
By Mike Hanlon September 15, 2005
First polymer electronic transistor produced completely by means of continuous mass printing technology. The
finger structure of the source/drain electrodes can be seen, behind them lies the reddish semiconsuctor layer.
The gate electrode lies invisibly behind the white insulator layer.
Source: [pmTUC] Institute for Print- und Media Technology
http://www.tu-chemnitz.de/mb/PrintMedienTech/pminstitut_en/download_en.php
- http://printedelectronics.idtechex.com/printedelectronicsworld/en/aboutus.asp

About Printed Electronics World
Printed Electronics World provides you with a daily update of the latest industry developments. Launched in
May 2007, this free portal covers the progress to printed electronics in all its forms - from transistor circuits to
power, sensors, displays, materials and manufacturing.
Hosted and written by IDTechEx, the leading printed electronics analyst and event organiser, articles provide
commentary, analysis and give a balanced view of the issue.
Copyright © 2008 IDTechEx Ltd.
- http://www.gizmag.com/biocompatible-flexible-led-array/16708/
Flexible, biocompatible LEDs could light the way for next gen biomedicine
By Ben Coxworth October 22, 2010
Researchers from the University of Illinois at Urbana-Champaign have created bio-compatible LED arrays that
can bend, stretch, and even be implanted under the skin. While this might cause some people to immediately
think _glowing tattoos!", the arrays are actually intended for activating drugs, monitoring medical conditions, or
performing other biomedical tasks within the body. Down the road, however, they could also be incorporated
into consumer goods, robotics, or military/industrial applications.
Many groups have been trying to produce flexible electronic circuits, most of those incorporating new materials
such as carbon nanotubes combined with silicon. The U Illinois arrays, by contrast, use the traditional
semiconductor gallium arsenide (GaAs) and conventional metals for diodes and detectors.
An LED array, transfer printed onto the fingertip of a vinyl glove

Bending with a folded piece of paper
Last year, by stamping GaAs-based components onto a plastic film, Prof. John Rogers and his team were able
to create the array's underlying circuit. Recently, they added coiled interconnecting metal wires and electronic
components, to create a mesh-like grid of LEDs and photodetectors. That array was added to a pre-stretched
sheet of rubber, which was then itself encapsulated inside another piece of rubber, this one being bio-
compatible and transparent.
The resulting device can be twisted or stretched in any direction, with the electronics remaining unaffected
after being repeatedly stretched by up to 75 percent. The coiled wires, which spring back and forth like a
telephone cord, are the secret to its flexibility. The research was recently published in the journal Nature
Materials.

- http://blog.targethealth.com/?p=14473
Roll-to-roll Plastic Displays
Oct 22 2010
A new company puts silicon transistors on plastic for flexible displays
This plastic material is used as the backing for Phicot’s amorphous silicon electronics. Credit: Phicot

Organic electronics (see also Printed electronic)
- http://en.wikipedia.org/wiki/Organic_electronics
Organic electronics, or plastic electronics, is a branch of electronics that deals with conductive polymers,
plastics, or small molecules. It is called 'organic' electronics because the polymers and small molecules are
carbon-based, like the molecules of living things. This is as opposed to traditional electronics which relies on
inorganic conductors such as copper or silicon.
Conductive polymers are lighter, more flexible, and less expensive than inorganic conductors. This makes
them a desirable alternative in many applications. It also creates the possibility of new applications that would
be impossible using copper or silicon.
Organic electronics not only includes organic semiconductors, but also organic dielectrics, conductors and
light emitters.
New applications include smart windows and electronic paper. Conductive polymers are expected to play an
important role in the emerging science of molecular computers.
In general organic conductive polymers have a higher resistance and therefore conduct electricity poorly and
inefficiently, as compared to inorganic conductors. Researchers currently are exploring ways of "doping"
organic semiconductors, like melanin, with relatively small amounts of conductive metals to boost conductivity.
However, for many applications, inorganic conductors will remain the only viable option.
Organic electronics can be printed.

IIIIIIIInnnnnnnnkkkkkkkk ffffffffoooooooorrrrrrrr ““““““““pppppppprrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss””””””””
- http://www.printelectronicnews.com/2820/epoxy-ink-for-printed-electronics/
Fine-Line Epoxy Ink Recommended for Printed Electronics Applications
December 2nd, 2010
Creative Materials, Inc., introduces 125-26, an exceptional conductive ink for screen- printing circuits with fine-
line widths and spaces. Creative Materials is expanding its line of products for the printed electronics market.
Our newest product, 125-26A/B119-44 is a flexible two-part epoxy ink that features superior adhesion to ITO-
coated surfaces and other low surface-energy substrates. This product has been used successfully in printed
electronics applications and is recommended where high-performance on coated substrates is necessary.
- http://www.printelectronicnews.com/2732/new-film-technologies/
New film technologies for printed polymer electronics developed
October 22nd, 2010
Conductive nano inks for flexible circuits
Bayer MaterialScience develops conductive and formable nano inks for use in areas such as printed polymer
electronics under the BayInk® name. These can be applied digitally using Depending on the process, it is
possible to apply line widths with a resolution of less than 30 micrometers that are no longer visible to the
human eye. This enables conductor tracks, contacts and electrodes to be applied much more easily and
effectively than with conventional methods, which are mostly more complicated and more energy- and
material-intensive.
The inks ad here to a very wide range of plastic films such as Makrofol® and Bayfol® and other flexible
materials, as well as to rigid substrates. The range of applications is wide – for example, as invisible conductor
tracks they can be used to simplify the complex design of touchscreens.
Customized service along the entire process chain.
- http://www.nanotech-now.com/news.cgi?story_id=36811
Conductive nano inks for printed electronics
Leverkusen | February 17th, 2010
The two conductive inks BayInk® TP S and BayInk® TP CNT from Bayer MaterialScience have been
developed primarily for use in the growing “printed electronics” market. These new inks boast excellent
adhesion to plastic films, other flexible substrates, glass, silicon and indium tin oxide.
- http://www.nanowerk.com/news/newsid=16884.php
Methode's Inkjet Printable Conductive Ink Allows Printing of Circuits on Polyester with No Secondary Curing
June 24, 2010
(Nanowerk News) Methode Development Company, a business unit of Methode Electronics, Inc., announces
that its conductive inkjet printable ink can now print circuits directly onto treated polyesters. The ink,
formulated for thermal and piezo inkjet systems, makes it possible for engineers to print working electrical
circuits, right from their desktops – facilitating product development, prototyping, and manufacturing
processes. With this technology, scale-up for high volume manufacturing can be easily achieved.

- http://www.inktec.com/english/product_info/electronic_tec.asp
Transparent Electronic Conductive
TEC is the acronym of _Transparent Electronic Conductive," and one of the salient features of that TEC ink is
its transparency at liquid phase. It means TEC is non-particle type ink before sintering and specially designed
by InkTec, which is a world-class research and manufacturing company of inkjet applications.
- http://nanotechweb.org/cws/article/tech/33180
Inkjet prints transparent CNT film.
Transparent conductive film for use in displays is one of the headline applications for carbon nanotubes
(CNTs). The interconnected material is seen as being more robust than today's ITO electrodes and could
prove a popular choice for flexible devices, but the challenge is to bring down production costs.
- http://www.epson.co.jp/e/newsroom/news_2004_11_01.htm
Epson Inkjet Technology Used to Fabricate World's First Ultra-Thin Multilayer Circuit Board.
Epson recently succeeded in producing a 20-layer circuit board sample by using an inkjet system to alternately
"draw" patterns and form layers on the board using two types of ink: a conductive ink containing a dispersion
of silver micro-particles measuring from several nanometers to several tens of nanometers in diameter, and a
newly developed insulator ink.
Copyright © 2008 SEIKO EPSON CORP
- https://buffy.eecs.berkeley.edu/PHP/resabs/resabs.php?f_year=2005&f_submit=one&f_absid=100770
High-Performance All-Inkjet-Printed Transistors for Ultra-low-cost RFID Applications
Dec 16, 2010
Alejandro De La Fuente Vornbrock, Steven Edward Molesa, David Howard Redinger and Steven K. Volkman
(Professors Ali Niknejad and Vivek Subramanian)
Semiconductor Research Corporation, Defense Advanced Research Projects Agency and National Science Foundation
Printed electronics will enable the development of ultra-low-cost RFID circuits for use as electronic barcodes,
since it eliminates the need for lithography, vacuum processing, and allows the use of low-cost web
manufacturing. Recently, there have been several demonstrations of printed transistors with mobilities
approaching or exceeding 1 cm2/V-s; however, all such devices have been fabricated using silicon substrates
with thermally grown oxides or using vacuum sublimated materials. In order to achieve ultra low cost,
performance must be maintained without silicon substrates or vacuum processing.
- http://www.laserfocusworld.com/display_article/206960/12/none/none/Feat/Semiconductor-ink-advances-flexible-displays
Semiconductor ink advances flexible displays
The technique being developed fabricates devices using high-volume inkjet printing to replace the
photolithographic techniques used to create the thin-film-transistor backplane circuits used in displays. A
liquid-based organic semiconductor material, developed by Xerox researchers, is used to print the
semiconductor channel layers for large-area transistor arrays.By Beng Ong - Research fellow and manager,
Advanced Materials and Organic Electronics Group, Xerox Research Centre of Canada.
Copyright © 2007: PennWell Corporation, Tulsa, OK

PPPPPPPPrrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeerrrrrrrr ffffffffoooooooorrrrrrrr ““““““““pppppppprrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss””””””””
- http://www.ntera.com/technology/printing_processes.php
Web-Fed (Roll-to-Roll) Printed NCD Displays on Flexible Substrate
Printing Processes
NanoChromics Ink Systems are compatible with existing printing equipment and processes.
Sheet or Web-fed Screen Printing
Flexographic Printing
Inkjet Printing
Leveraging additive print processes, NanoChromics Ink Systems can be combined with other printed
electronic technologies (and traditional graphics inks) on the same substrate. Compatibility with existing,
widely available printing equipment minimizes capital investment for traditional graphics printers looking to
expand into printed electronics and functional media.

- http://www.citala.com/index.php/flexible-display-technology/Roll-To-Roll-Manufacturing.html
Roll To Roll Manufacturing
Citala, US-based roll-to-roll (R2R) manufacturing is state-of-the art with a track record of reliability. Citala was
one of the first companies to offer genuine R2R manufacturing, enabling the production of large, cost-effective
quantities. R2R enables solutions for patterning, coating, cutting, and combining different layers of
customizable displays. Citala can manufacture flexible displays and optical shutters using the same line.
Citala's R2R-schematic diagram - © Copyright 2008 Citala. All Rights Reserved
- http://www.xenoncorp.com/print_mkt.html
PHOTONIC SINTERING OF NANOPARTICLE INKS ON LOW- TEMPERATURE SUBSTRATES:
PULSED LIGHT EXCELS
The world of printed electronics is moving out of R&D and into production, and new developments in
materials—particularly nanoparticle inks and photonic curing from Xenon Corporation—are in the driver’s seat.
Here’s what’s happening:
1.) Functionally conductive inks and coatings now contain nanoparticles that permit the use of low-cost
substrates such as paper, PET and polyethylene films.
2.) New developments allow inkjets and screen printers to use silver, gold and most recently, lower-cost
copper nanoparticle inks. 3.) It is now possible to print at room temperature on flexible substrates such as
printed circuit boards.
Here’s the photonic curing contribution: The challenge has long been heat. How do you sinter or anneal
nanoparticle inks at substrate temperatures, which are typically below 160C? Xenon’s photonic pulsed light
curing answers this challenge. High energy peak pulses, delivered in milliseconds, quickly heat only the inks
and not the substrates. The high energy removes the solvent, leaving only the metal flakes which are sintered
or annealed, while the substrate is unaffected. This speed allows copper inks to be sintered too quickly for a
surface oxide layer to develop, so conductivity is improved.
- http://www.oled-display.net/oled-inkjet-printing
CDT is sole supplier of the Litrex range of Ink Jet. Cambridge Display Technology have also partnered
industry leaders across the globe to offer a fully inclusive ink jet package.
To support the Litrex printer range CDT can offer materials, print heads, know-how and skills development
packages. More about OLED Inkjet Printing and PLED at http://www.cdtltd.co.uk

- http://www.litrex.com/index.asp?sect=5&page=12
The Litrex _ precision inkjet printer is a low-cost, compact system for research and development of
OLED/LEP, LCD, printed electronics, and biomaterial applications.
- http://www.dimatix.com/
Dimatix is driving a revolution in micro-production technology that will deliver a new generation of applications
in imaging, electronics and the biosciences.
- http://www.dea.brunel.ac.uk/cleaner/Electronics_Projects/Handbook_1.htm
Over four years research work at Brunel University has demonstrated the feasibility of manufacturing electrical
circuit interconnect via the established printing technology of offset lithography. It has been shown that offset-
lithography can be used as a process for manufacture of low specification electrical interconnect, leading to
reduced production time and raw material use when compared to conventional thick film printing approaches.
- http://www.dea.brunel.ac.uk/cleaner/Electronics_Projects/Handbook_2.htm
© 2008 Cleaner Electronics Research Group
Conventional and Lithographically printed circuit boards for telephone assembly.
This demonstrator surpassed all others in complexity and processor speed.
- http://www.engr.uiuc.edu/news/index.php?xId=074108960714
'Nanonet' circuits closer to making flexible electronics reality
By Emil Venere, Purdue University
Together, researchers at Illinois and Purdue have overcome a major obstacle in producing transistors from
networks of carbon nanotubes, a technology that could make it possible to print circuits on plastic sheets for
applications including flexible displays and an electronic skin to cover an entire aircraft to monitor crack
formation.

TTTTTTTTrrrrrrrraaaaaaaannnnnnnnssssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt aaaaaaaannnnnnnndddddddd SSSSSSSSttttttttrrrrrrrroooooooonnnnnnnngggggggg PPPPPPPPllllllllaaaaaaaassssssssttttttttiiiiiiiicccccccc
Strong, Light, Transparent Plastic
- http://thefutureofthings.com/news/1060/strong-light-transparent-plastic.html
Researchers from the University of Michigan (UM) have developed a composite plastic, which they say
is strong as steel, but much lighter and transparent.
The scientists name several possible applications for their invention. The composite plastic could be used in
the making of stronger and lighter armor for soldiers and police forces and for protecting their vehicles. The
material could also be used in micro-electromechanical devices, in micro-fluidics and biomedical sensors, in
valves, and in unmanned aircrafts.
Copyright © 2009 The Future of Things. All rights reserved
- http://www.trnmag.com/Photos/2008/033108/Flexible%20silicon%20circuits%20Image.html
Flexible silicon
Stretchable and bendable computer circuits made from ordinarily brittle single-crystal silicon promise flexible
electronic devices that perform at nearly the same level as today's rigid computer chips.
© Copyright Technology Research News, LLC 2000-2008. All rights reserved.
- http://www.news.uiuc.edu/news/08/0327electronics.html
Foldable and stretchable, silicon circuits conform to many shapes
- http://www.wisegeek.com/what-is-the-difference-between-silicon-and-silicone.htm
Difference Between Silicon and Silicone

TTTTTTTTrrrrrrrraaaaaaaannnnnnnnssssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt EEEEEEEElllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss
- http://www.indiastudychannel.com/resources/98936-Transparent-Electronics-or-Invisible-Electronics.aspx
Transparent Electronics -- or Invisible Electronics
Dec 2009 By Pratima
Transparent electronics is a emerging technology, which is satisfying the requirements of everything invisible
or multi-purpose objects.
What is Transparent Electronics?
Its just Technology for next generation of optoelectronic devices and employs wide band-gap semiconductors
for the realization of invisible circuits. Oxide semiconductors are very interesting materials because they
combine simultaneously high/low conductivity with high visual transparency.
How it works?
Transparent oxide semiconductor based transistors have recently been proposed using as active channel
intrinsic zinc oxide (ZnO). The main advantage of using ZnO deals with the fact that it is possible to growth
at/near room temperature high quality polycrystalline ZnO, which is a particular advantage for electronic
drivers, where the response speed is of major importance. Besides that, since ZnO is a wide band gap
material (3.4 eV), it is transparent in the visible region of the spectra and therefore, also less light sensitive.
Applications:
They have been widely used in a variety of applications like:
1.antistatic coatings
2.touch display panels
3.solar cells,
4.flat panel displays
5.heaters
6.defrosters
7.optical coatings etc
- http://kn.theiet.org/magazine/issues/1009/transparent-electronics-1009.cfm
Transparent electronics look to use in smart objects
June 2010 By Chris Edwards
Transparent electronic materials will make it possible to build a new generation of smart objects.
After crash-landing on Mars in the 2000 movie 'Red Planet', Val Kilmer tries to work out where he and his
team have wound up on the surface. So, he unrolls a see-through computer that tries to match the local
landscape with the images collected by scores of unmanned Mars probes over the years.
It was a bomb at the box office. Ten years on, 'Red Planet' is not showing much sign of becoming a cult
classic and ultimately profitable like 'Blade Runner'. But it's still inspiring engineers to work out how to make a
roll-up, see-through map.
Tolis Voutsas, director of the materials and devices applications lab at Sharp Laboratories of America, says:
''Red Planet' was shown in 2000. And we still don't have technology to do this. But thanks to Hollywood we still
have the vision.'
Director Antony Hoffman reckoned it might take a while to realise the transparent map. 'Red Planet' was set in
2056. Engineers such as Chris Bower, principal scientist at Nokia's research centre in Cambridge, are hoping
that they can develop something similar much more quickly.
Working on morph
A couple of years ago, Nokia unveiled what it called the Morph concept. A set of videos showed what the
portable computer and phone of the future might look like. Bower explained the idea at the Printed
Electronics conference in Dresden in April: 'You can take a standard candy-bar phone and transform it.
You can wrap it around your wrist so that it becomes a wearable device.
'We are working hard to enable the Morph concept. We are trying to build a library of functional surface
materials that provide the ability to change colour or haptic feedback. We also need compliancy to reshape

the device, with flexible and even stretchable displays. And transparency is something we require,' says
Bower, showing a Photoshop-assisted mockup of Nokia's take on the transparent navigator.
The roll-up map is not the only applications for see-through electronics. Douglas Keszler of Oregon State
University, a leading researcher into transparent metal oxides, reckons these materials will find uses in car
dashboards and windows to provide extra real estate for computer circuits.
Carbon nanotubes and plastics are vying with metal oxides for a role in transparent electronics, but the metals
have a solid lead historically.
'We believe metal oxides can enable transparent electronics and they have been around for some time,' says
Flora Li, research associate at the University of Cambridge.
In the Second World War, aircraft makers used transparent conductive oxides to deliver heat to windshields to
keep them free of ice. Indium tin oxide (ITO) has become the one material that appears almost everywhere
as a conductive coating for flat-screens and touchscreens. Unfortunately, the key component, indium, is a
very rare and expensive metal, giving researchers a strong incentive to find other options.
Peter Harrop, chairman of analyst firm IDTechEx, says: 'It's a defeat that indium tin oxide is still used for
transparent electronics. There are replacements but they need to gain traction. That is a big opportunity for
a lot of people.'
Li says ITO represents the first generation of transparent electronics, forming just passive conductors on the
surface of screens. 'The phase we are in now, we consider the second generation, allowing us to fabricate
discrete transparent components,' she claims. The coming third generation will put active transparent
components into many more devices.
Thin-film transistors made out of metal oxides date back to the the 1960s but it's only since the late 1990s that
research has shown that it is possible to create a library of standard components that you can see through.
Keszler points to a paper on the creation of a p-type transistor by Hiroshi Kawazoe and colleagues at the
Tokyo Institute of Technology in 1997 as the birth of modern transparent electronics. Up to that point, all
the conductors were n-type. With the two types available, it became feasible to build thin-film diodes and
transistors.
There is a reason why transparent metal oxides are not more widely used in electronics. As with the organic
polymers used in printed electronics, electrons do not move easily through most of them. According to
Keszler, the best materials have a conductivity more than ten times worse than the contact metals used
today in silicon chips.
Li says even with this lower performance, there is still a useful role for these devices. She compares metal
oxides to lower-grade forms of silicon used in flat-panel displays, such as polycrystalline and amorphous,
non-crystalline silicon, often called alpha-silicon.
'Polysilicon gives you great mobility. But you need to use really high temperatures to get this. Alpha-silicon you
can make at much lower temperatures but at the expense of lower mobility. This is where we believe
transparent metal oxides fit in: filling a gap between organic materials and alpha-silicon in terms of cost and
performance,' says Li.
Whereas alpha-silicon generally has a mobility of around 1cm/Vs, researchers have managed to achieve
around 30cm'/Vs for the widely available material zinc oxide, which is still five times lower than the
polysilicon used in high-end displays but is usable.
Mobility is only one of the concerns that researchers have with metal oxides. Sharp worked with startup Inpria,
which Keszler co-founded, on indium gallium zinc oxide transistors. 'However, the current doesn't saturate,'
says Voutsas, in the way that it should for a workable transistor. 'And the threshold voltage is high. That is
why you don't see a product that uses amorphous-oxide TFTs.'
As with the the transistor, researchers are working with a range of metals in the hope of finding combinations
that work. Li says many of these materials are binary oxides that are difficult to produce reliably using
sputtering - the balance between the two metals in the oxide varies, disrupting its ability to conduct
electricity.

Like silicon-based processes, the metals can migrate into other layers, which Li found with indium zinc oxide
and hafnium oxide gates. 'We found the indium migrated into the hafnium layer and destroyed the device.
What we found really works with indium zinc is aluminium,' says Li. On the other hand, zinc oxides seem to
work well with hafnium oxide.
With work continuing on indium-based oxides, materials scientists have yet to find a genuine low-cost, easily
available winner in transparent conductive oxides. 'But we think that this is one of the technologies that will
emerge soon,' Voutsas concludes.
- http://www.technologyreview.com/computing/21964/?a=f
High-quality, clear graphene films are a leap toward bendable OLED displays.
Korean researchers have found a way to make large graphene films that are both strong and stretchy and
have the best electrical properties yet.
Prachi Patel-Predd - © 2009 - .technologyreview.com
© 2009 Ji Hye Hong
- http://www.sciencenews.org/view/access/id/39865/title/Graphene_from_gases_for_new,_bendable_electronics_
Graphene from gases for new, bendable electronics
Flexible, translucent and ultrathin, layers of carbon atoms called graphene are also excellent electrical
conductors that could find use in flexible computer displays, molecular electronics and new wireless
communications. Making high-quality graphene sheets is usually a slow, painstaking process, but now several
research groups have discovered ways to make patterned graphene circuits using techniques borrowed from
microchip manufacturing, which can be scaled up for mass production.
By Patrick Barry - ©2009 - .sciencenews.org
- http://chem.skku.edu/graphene/
SKKU Graphene Research Laboratory
New work at the University of Southern California (USC) has now demonstrated the great potential of
massively aligned single-walled carbon nanotubes for high-performance transparent electronics. "We
fabricated transparent thin-film transistors on both rigid and flexible substrates with transfer printed aligned
carbon nanotubes as the active channel and indium-tin oxide as the source, drain, and gate electrodes,"
Chongwu Zhou, Jack Munushian Associate Professor in USC's Department of Electrical Engineering, tells
Nanowerk. "We have fabricated these transistors through low-temperature processing, which allowed device
fabrication even on flexible substrates."
By Michael Berger. Copyright 2008 Nanowerk LLC

- http://pubs.acs.org/doi/pdf/10.1021/nn800434d
Transparent Electronics Based on Transfer Printed Aligned Carbon Nanotubes on Rigid and Flexible
Substrates
Fumiaki N. Ishikawa, Hsiao-kang Chang, Koungmin Ryu, Po-chiang Chen, Alexander Badmaev, Lewis Gomez De Arco, Guozhen Shen
and Chongwu Zhou*
Department of Electrical Engineering, University of Southern California, Los Angeles, California 90089
ACS Nano, Article ASAP DOI: 10.1021/nn800434d Publication Date (Web): December 10, 2008
Report high-performance fully transparent thin-film transistors (TTFTs) on both rigid and flexible substrates.
- http://www.eurekalert.org/pub_releases/2008-12/uosc-urp121608.php
USC researchers print dense lattice of transparent nanotube transistors on flexible base
It's a clear, colorless disk about 5 inches in diameter that bends and twists like a playing card, with a lattice of
more than 20,000 nanotube transistors capable of high-performance electronics printed upon it using a
potentially inexpensive low-temperature process.
Its University of Southern California creators believe the prototype points the way to such long sought after
applications as affordable "head-up" car windshield displays. The lattices could also be used to create cheap,
ultra thin, low-power "e-paper" displays.
©2008 www.eurekalert.org
Transparent and flexible electronics with nanowire transistors
Thin-film transistors (TFTs) and associated circuits are of great interest for applications including displays,
large-area electronics and printed electronics (e.g. radio-frequency identification tags - RFID). Well-
established TFT technologies such as amorphous silicon and poly-silicon are well-suited for many current
applications - almost all mobile phone color screens use them - but face challenges in extensions to flexible
and transparent applications. In addition, these TFTs have modest carrier mobilities, a measure of the velocity
of electrons within the material at a given electric field. The modest mobility corresponds to a modest
operating speed for this class of TFTs. Organic TFTs are generally better suited for flexible applications, and
can be made transparent. However, mobilities in organic TFTs are generally quite low, restricting the speed of
operation and requiring relatively large device sizes. Researchers at Purdue University, Northwestern
University, and the University of Southern California now have reported nanowire TFTs that have significantly
higher mobilities than other TFT technologies and therefore offer the potential to operate at much higher
speeds. Alternatively, they can be fabricated using much smaller device sizes, which allows higher levels of
integration within a given chip area. They also provide compatibility with a variety of substrates, as well as the
potential for room-temperature processing, which would allow integration of the devices with a number of other
technologies (e.g. for displays). "We have demonstrated fully-transparent thin-film transistors (TFTs) on both
glass and flexible plastic substrates" Dr. David B. Janes tells Nanowerk.
Image of NWTs on a plastic substrate, showing the optical clarity and mechanical flexibility. Arrows point to the
transistor array regions (Image: Dr. Janes)

http://www.innovations-report.com/html/reports/physics_astronomy/clear_future_electronics_transparent_memory_device_124145.html
The Clear Future of Electronics: Transparent Memory Device
A group of scientists at Korea Advanced Institute of Science and Technology (KAIST) has fabricated a working
computer chip that is almost completely clear -- the first of its kind. The new technology, called transparent
resistive random access memory (TRRAM), is described in this week's issue of the journal Applied Physics
Letters, which is published by the American Institute of Physics. 11.12.2008
Electronics can be so transparent
One of the newly emerging areas of semiconductor technology is the field of transparent electronics. These
thin-film materials hold the promise of a new class of flexible and transparent electronic components that
would be more environmentally benign than current electronics.
However, the emerging transparent electronics technology is facing manufacturing problems: current
fabricating processes do not separate the device manufacturing from material synthesis. The transparent
electronic materials, which are largely inorganic oxides. are directly deposited on the device substrate under
harsh conditions which may cause damage to the existing layer or flexible substrate. The etching of small
dimension oxide multilayer is also difficult due to the low selectivity of the etching recipe. New research results
demonstrate that nanofabrication techniques could solve these problems.
A group of researchers from Clarkson University and Pacific Northwest National Laboratory report that clear
nanocrystals can serve as the appropriate electronic materials in the transparent device. "The purpose of our
work is to demonstrate the fabrication of transparent devices using nanofabrication and nanomaterials" Dr.
Feng Hua tells to Nanowerk.
- http://techon.nikkeibp.co.jp/article/HONSHI/20071024/141211/
Transparent Electronic Products Soon a Reality
Since the arrival of low-cost transparent transistors, R&D into transparent electronics has progressed rapidly.
It will soon be possible, for instance, to embed transparent electronic circuits into large areas like windows,
enabling the display of video imagery.
Copyright © 1995-2008 Nikkei Business Publications, Inc.
- http://dx.doi.org/doi:10.1038/nnano.2007.151
- http://nanoarchitecture.net/article/nanotubes-enable-flexible-transparent-electronics
Nanotubes Enable Flexible, Transparent Electronics
Flexible electronics have taken an important leap forward with the development of a new type of flexible,
transparent electrode made using carbon nanotubes (CNTs). Jackson State University researchers made the
electrode by applying boron-doped CNTs to glass and polymer film surfaces. The devices are 89%
transparent to visible light and are robust; they maintain their conducting properties even after being folded
and exposed to harsh environmental conditions.
- http://www.azom.com/News.asp?NewsID=7446
Invisible Electronics
Northwestern University researchers report that by combining organic and inorganic materials they have
produced transparent, high-performance transistors that can be assembled inexpensively on both glass and
plastics.
- http://npl.postech.ac.kr/?mid=Trans_Electronic
Advanced Display Nanodevice
Transparent Thin film transistor(TFT)
- http://oregonstate.edu/dept/ncs/newsarch/2006/Feb06/license2.htm
OSU Licenses New Transparent Electronics to HP
Scientists and engineers at Oregon State University have developed a new class of materials that can be used
to create safe, inexpensive and transparent electronic circuits, and licensed the exclusive rights to develop
and market products based on this technology to HP.

FFFFFFFFlllllllleeeeeeeexxxxxxxxiiiiiiiibbbbbbbblllllllleeeeeeee aaaaaaaannnnnnnndddddddd ttttttttrrrrrrrraaaaaaaassssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt ddddddddiiiiiiiissssssssppppppppllllllllaaaaaaaayyyyyyyyssssssss
For more info about this please see:
Nanotechnology vol.2 Technology for E-books Readers (B/W & colors display)
www.biodomotica.com/public/e-paper_e-book.pdf
Flexible Display
- http://www.crunchgear.com/2010/05/26/video-sonys-new-super-thin-oled-display-wraps-around-a-pencil/
- http://forum.dailymobile.se/index.php?topic=34521.0

Transparent TFT-LCD
- http://techpatio.com/2009/mobiles/sony-ericsson/sony-ericsson-xperia-pureness-600-euro-november-uk-price
Transparent OLED
- http://www.engadget.com/2010/01/07/samsungs-14-inch-transparent-oled-laptop-video/

EEEEEEEElllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiicccccccc ppppppppaaaaaaaappppppppeeeeeeeerrrrrrrr //////// EEEEEEEE--------ppppppppaaaaaaaappppppppeeeeeeeerrrrrrrr //////// EEEEEEEE--------iiiiiiiinnnnnnnnkkkkkkkk®®®®®®®®
For more info about this please see:
Nanotechnology vol.2 Technology for E-books Readers (B/W & colors display)
by Emily Cooper - http://www.cooperhawk.com/contact.htm

PPPPPPPPrrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd bbbbbbbbaaaaaaaatttttttttttttttteeeeeeeerrrrrrrryyyyyyyy
- http://www.gizmag.com/worlds-smallest-battery-created/17237/
World’s smallest battery created
By Darren Quick December 2010
Nano Battery A tin oxide anode contorts in response to ions flowing in as the battery charges. Sandia Labs
http://www.popsci.com/science/article/2010-12/lithium-ion-batteries-swell-and-contort-while-charging-new-study-shows
Because battery technology hasn’t developed as quickly as the electronic devices they power, a greater and
greater percentage of the volume of these devices is taken up by the batteries needed to keep them running.
Now a team of researchers working at the Center for Integrated Nanotechnologies (CINT) is claiming to have
created the world’s smallest battery, and although the tiny battery won’t be powering next year’s mobile
phones, it has already provided insights into how batteries work and should enable the development of smaller
and more efficient batteries in the future.
The tiny rechargeable, lithium-based battery was created by a team led by Sandia National Laboratories
researcher Jianyu Huang. It consists of a bulk lithium cobalt cathode three millimeters long, an ionic liquid
electrolyte, and has as its anode a single tin oxide (Sn02) nanowire 10 nanometers long and 100 nanometers
in diameter – that’s one seven-thousandth the thickness of a human hair.
Because nanowire-based materials in lithium-ion batteries offer the potential for significant improvements in
power and energy density over bulk electrodes the researchers wanted to gain an understanding of the
fundamental mechanisms by which batteries work. They therefore formed the battery inside a transmission
electron microscope (TEM) so they could study the charging and discharging of the battery in real time and at
atomic scale resolution.
By following the progression of the lithium ions as they travel along the nanowire, the researchers found that
during charging the tin oxide nanowire rod nearly doubles in length. This is far more than its diameter
increases and could help avoid short circuits that may shorten battery life. This unexpected finding goes
against the common belief of workers in the field that batteries swell across their diameter, not longitudinally.
“Manufacturers should take account of this elongation in their battery design,” Huang said. “These
observations prove that nanowires can sustain large stress (>10 GPa) induced by lithiation without breaking,
indicating that nanowires are very good candidates for battery electrodes,” he added.
Atomic-scale examination of the charging and discharging process of a single nanowire had not been possible
before because the high vacuum in a TEM made it difficult to use a liquid electrolyte. Huang’s group overcame
this problem by demonstrating that a low-vapor-pressure ionic liquid – essentially molten salt – could function
in the vacuum environment.
This means that although the work was carried out using tin oxide nanowires, Huang says the experiments
could be extended to other materials systems, either for cathode or anode studies.
“The methodology that we developed should stimulate extensive real-time studies of the microscopic
processes in batteries and lead to a more complete understanding of the mechanisms governing battery
performance and reliability,” he said. “Our experiments also lay a foundation for in-situ studies of
electrochemical reactions, and will have broad impact in energy storage, corrosion, electrodeposition and
general chemical synthesis research field.”
The research team’s work is reported in the December 10 issue of the journal Science.

- http://www.energyharvestingjournal.com/articles/printed-lithium-reshaping-battery-00002104.asp
Energy Scavenging, Power Scavenging - Making small electronic and electric devices self-sufficient
Mar 2010 | Japan
Printed lithium reshaping battery
In February 2010, ITSUBO Advanced Materials Innovation Center and Hatanaka Electric in Japan announced
a large area printed lithium polymer battery that can be reshaped as shown in the pictures. This is the
statement from Mie Prefecture Industrial Support Center for the Promotion of Education and Science, Ministry
of Industry-Academia Collaboration Urban Areas (a development in the Mie Ise Bay area).
"This development of advanced materials and innovation creates a new generation all-solid polymer lithium
secondary battery. It is a world first because the all-solid polymer lithium secondary battery employs a printing
process.
This battery, involving new electrode material and electrode interface control technology and a new polymer
electrolyte, plus a separator, avoids the safety and reliability challenges of manufacturing polymer electrolyte
lithium ion secondary batteries. A safe, thin, bendable, large area battery has resulted, which offers ease of
stacking. Such batteries are welcome as the printed electronics sector is expected to grow rapidly.
Development of this cell is continuing at the Principal Research and Development Center for Next Generation Batteries, Mie University,
Mie Prefecture Industrial Research Institute (Kinseimatekku Co., Ltd., Kurehaerasutoma Co., Ltd., Shin-Co., Ltd., Toppan Printing Co.,
Ltd., Myeongseong Chemical Co., Ltd.). It has been jointly conducted by the government and academia."
Photos prototype polymer lithium secondary batteries
Prototype battery performance
"Cell size A6 (external dimension), cell thickness 450µm (external dimension)
Initial charge and discharge efficiency of 99%
Initial capacity of 45mAh (electrode material utilization efficiency of 80%)
Operating voltage 1.8 V (voltage at 50% depth of discharge)
Discharge rate of 0.02C ~ 1.0C of more than 100 cycle times (the current ongoing evaluation)
Operating Temperature 0 ~ 25 C°
In future, we will dramatically improve the performance of the battery cell structure design and optimization of
polymer electrolyte interface control electrode materials."
Second generation lithium batteries that are safer and have better performance are incorporated in the
Lightning Car Company's Lightning sports car, the KleenSpeed Technologies 200mph Formula One car, the
Hawkes Ocean Technologies Deepflight submarines, the PC-Aero pure electric aircraft etc. but even more
powerful batteries will be welcome.
For more read : Energy Harvesting and Storage for Electronic Devices 2009-2019
- http://newenergyandfuel.com/http:/newenergyandfuel/com/2010/01/08/printing-lithium-ion-batteries/
Printing Lithium Ion Batteries
January 2010
The Advanced Materials Innovation Center (AMIC) of MIE Industry and Enterprise Support Center, a Japan-
based foundation, has developed a lithium polymer battery that can be manufactured by printing technology.

Printed Lithium Ion Sheet Battery.
The research group used a normal sheet-shaped flexible substrate but employed a printing technology that
can be applied to roll-to-roll production. When a roll-to-roll production method is used, the thickness of the
flexible substrate can be reduced, enabling the manufacturing of thin batteries.
Printed Lithium Ion Sheet Battery Side View. Quite thin.
There are two battery prototypes. One has an output voltage of about 4V at room temperature while the other
has an output voltage of about 2V. The thickness of the battery is about 500µm, or 500 microns – that’s a half-
millimeter. Its negative and positive electrodes were formed on a flexible substrate by using printing
technology. The AMIC isn’t disclosing the battery capacity. That could be disappointing, but the point is to get
something small and light for something small and light. Such things at this point in time aren’t going to have
huge power demands, yet.
The AMIC says it did not use a printing technology to package the polymer electrolyte for the prototypes. Nor
did they disclose the details of the polymer electrolyte or the negative or positive electrode materials.
But the design and production by using printing technology offers reduced thickness, increased surface areas
and laminated construction. Using a roll-to-roll production, costs can be reduced, and reducing costs for
lithium technology is going to be a paramount concern.
The sheet-shaped battery is being researched to be used with a flexible solar cell and be attached to a curved
surface. If the battery is integrated with a solar cell formed on a flexible substrate, it is possible to build a sheet
that can be used both as a power generator and as power storage.
The effort is a three-year project that will end in March 2011. During the coming year, the research group
plans to improve manufacturing technologies for commercial production, determine potential applications for
the battery and set out the targets such as battery capacity.
Having the construction technology for simply sheets of batteries might open far larger fields of uses. The
capacity issue is of some concern, but 4 volts, using simple printing to construct the battery internal parts has
to have a serious impact over time as the various anode and cathode materials are adapted to the assorted
construction methods.
The lithium polymer battery is being developed in a research project of MIE Industry and Enterprise Support
Center with the partners of Toppan Printing Co Ltd., Shin-Kobe Electric Machinery Co. Ltd, Kureha Elastomer
Co. Ltd., Kinsei Matec Co. Ltd., Meisei Chemical Works Ltd., MIE University, Suzuka National College of
Technology and MIE Prefecture Industrial Research Institute.

One has to think now that seeing something much lower in cost and simpler to manufacture will push research
for thinner and lighter substrates, innovations in the anode and cathode materials and some clever electrolyte
application processes.
This research bodes well for the future of lithium batteries. Still quite expensive, lithium needs to get the
manufacturing costs down. Perhaps printing is the path, and at 4 volts per cell, a compelling one indeed.
- http://news.cnet.com/8301-11128_3-20004170-54.html
by Martin LaMonica May 2010
CAMBRIDGE, Mass.--Scientists at the Massachusetts Institute of Technology have successfully coated paper
with a solar cell, part of a suite of research projects aimed at energy breakthroughs.
Susan Hockfield, MIT's president, and Paolo Scaroni, CEO of Italian oil company Eni, on Tuesday officially
dedicated the Eni-MIT Solar Frontiers Research Center. Eni invested $5 million into the center, which is also
receiving a $2 million National Science Foundation grant, said Vladimir Bulovic, the center's director.
The printed solar cells, which Bulovic showed at a press conference Tuesday, are still in the research phase
and are years from being commercialized.
However, the technique, in which paper is coated with organic semiconductor material using a process similar
to an inkjet printer, is a promising way to lower the weight of solar panels. "If you could use a staple gun to
install a solar panel, there could be a lot of value," Bulovic said.
Vladimir Bulovic, director of the Eni-MIT Solar Frontiers Research Center, holds a solar cell printed onto
a piece of paper to spell MIT. This is the first paper solar cell, according to MIT and Eni.
(Credit: Martin LaMonica/CNET)
The materials MIT researchers used are carbon-based dyes and the cells are about 1.5 percent to 2 percent
efficient at converting sunlight to electricity. But any material could be used if it can be deposited at room
temperature, Bulovic said. "Absolutely, the trick was coming up with ways to use paper," he said.
MIT professor Karen Gleason headed the research and has submitted a paper for scientific review but it has
not yet been published. MIT and Eni said this is the first time a solar cell has been printed on paper.
During the press conference, Scaroni said that Eni is funding the center because the company understands
that hydrocarbons will eventually run out and believes that solar can be a replacement. At the same time, he
said, current technologies are not sufficient.
"We are not very active (in alternative energy) today because we don't believe today's technologies are the
answer of our problems," he said.
Quantum dots
The paper solar cells are one of many avenues being pursued around nanoscale materials at the Eni-MIT
Solar Frontiers Center. Layers of these materials could essentially be sprayed using different manufacturing
techniques to make a thin-film solar cell on a plastic, paper, or metal foils.

Silicon, the predominant material for solar cells, is durable and is made from abundant materials. Many
companies sell or are developing thin-film solar cells, which are less efficient but are cheaper to manufacture.
During a tour, Bulovic showed one of the center's labs, where researchers use a laser to blast light at
nanomaterials for picoseconds. A picosecond is one trillionth of a second. The laser provides data on how the
light excites electrons in the material, which will provide clues as to whether it will make a good solar cell
material, he explained.
MIT is focusing much of its effort on quantum dots, or tiny crystals that are only a few nanometers in size. A
human hair is about 50,000 to 100,000 nanometers thick.
By using different materials and sizes, researchers can fine-tune the colors of light that quantum dots can
absorb, a way of isolating good candidates for quantum dot solar cells.
Researchers at the center are also looking at different molecules or biological elements which can act as solar
cell material. These cheap thin-film materials can be used on their own or added to silicon-based solar panels
to enhance the efficiency, Bulovic said.
If 0.3 percent of the U.S. were covered with photovoltaics with 10 percent efficiency, solar power could
produce three times the country's needs, including a transition to electric vehicles, Bulovic said. For example,
the easement strip on highways could be coated with material that could capture energy from the sun.
But don't expect a revolution in solar power tomorrow.
"I'm giving you a whole bunch of hype," Bulovic said while explaining solar's potential during the tour. "It
usually takes 10 years from the time between when you invent something and you commercialize it." He
estimated that many of the technologies in the labs were in the first three years of a five-to-seven-year
development cycle
- http://laptopreviewshop.com/flexible-li-ion-battery.html
Flexible Li-Ion battery
Mircea / September 2010
Stanford scientists created a new flexible Li-Ion battery that’s as slim as a piece of paper and can easily bend.
Researchers from Stanford invented a very slim rechargeable Lithium-Ion battery (it’s only 300 µm thick) that
can easily bend.
Scientists Liangbing Hu, Hui Wu and Yi Cui managed to transform a simple piece of paper into a functional
flexible battery. The piece of paper was covered on both sides with a layer of nano-tubes and a lithium
compound. The lithium compound works as electrodes, while the nano-tubes collect and store electrical
energy. The piece of paper separates the electrodes and keeps the whole thing together.
Following tests, these batteries endured 300 charges flawlessly. This technology can easily be applied in
paper-based electronics, an area that’s constantly evolving. Also, this technology can be used to store
electrical energy, as Rice University professor Pulickel M. Ajayan states: “Such simple fabrication techniques
could prove useful for integrating other nanomaterials for building the next generation of energy-storage
devices.”

- http://winarco.com/ultra-thin-flexible-secondary-lithium-ion-paper-batteries-by-standford-university-researchers/
Ultra-thin Flexible Secondary Lithium-ion Paper Batteries by Standford University Researchers
by Kevin Xu on September 2010
First we saw Flexible e-ink display and at the middle of this month Sony also introduces Flexible Electronic
Paper display and recently the Department of Materials Science and engineering, Stanford University
researchers has showing their new Innovation of Ultra-thin Flexible Secondary Lithium-ion Paper Batteries.
The Standford University Researcher is using paper as separators and free-standing carbon nanotube thin
films as both current collectors. The current collectors and Li-ion battery materials are integrated onto a single
sheet of paper through a lamination process.
This new prototypes have been tested to be able to recharge up to 300 times without any problems. If the
researcher able to bring their product to the surface, it will be a great contribution for our future batteries.
- http://pubs.acs.org/doi/abs/10.1021/nn1018158
Thin, Flexible Secondary Li-Ion Paper Batteries
Liangbing Hu†, Hui Wu†, Fabio La Mantia, Yuan Yang, and Yi Cui*
Department of Materials Science and Engineering, Stanford University, Stanford, California 94305
ACS Nano, 2010, 4 (10), pp 5843–5848 DOI: 10.1021/nn1018158
Publication Date (Web): September 13, 2010 Copyright © 2010 American Chemical Society
There is a strong interest in thin, flexible energy storage devices to meet modern society needs for
applications such as interactive packaging, radio frequency sensing, and consumer products. In this article, we
report a new structure of thin, flexible Li-ion batteries using paper as separators and free-standing carbon
nanotube thin films as both current collectors. The current collectors and Li-ion battery materials are integrated
onto a single sheet of paper through a lamination process. The paper functions as both a mechanical
substrate and separator membrane with lower impedance than commercial separators. The CNT film functions
as a current collector for both the anode and the cathode with a low sheet resistance (5 Ohm/sq), lightweight
(0.2 mg/cm2), and excellent flexibility. After packaging, the rechargeable Li-ion paper battery, despite being
thin (300 µm), exhibits robust mechanical flexibility (capable of bending down to <6 mm) and a high energy
density (108 mWh/g).

- http://www.powerpaper.com/
Power Paper's printable, environment-friendly battery technology.
Power Paper pioneered the industry's first printable thin and flexible batteries over 10 years ago, and today its
batteries and integration technologies enable a vast range of products for consumer, medical, and industrial
applications.
©2008 Power Paper Ltd.
- http://www.powerpaper.com/?categoryId=33405
Power Paper
Specifications
Power Paper has developed a number of standard clean printed batteries for use in a variety of products and
applications. Currently, the company does not offer its thin batteries as stand-alone products, however,
manufacturers interested in integrating Power Paper's thin printed batteries into their own products, or
engaging in joint development projects, please see partnership opportunities or contact us.
The general specifications for Power Paper’s current generation of batteries are as follows:
Primary cell (multiple cell battery packs are possible) 1.5V
Typical thickness (total) 0.7 mm
Bending radius 2.5cm (1 inch)
Nominal continuous current density (per active area) 0.1 mA/cm 2
Nominal capacity (per active area) 4.5 mAh/cm 2
Nominal internal resistance (1kHz impedance) 50 Ohm max
Shelf life 3 years
Temperature operating range -20°C to +60°C
- http://www.bluesparktechnologies.com/index2.html
Blue Spark UT (Ultra-Thin) Series
The UT Series is the industry’s thinnest printed battery currently in production, with a 30 percent slimmer
laminate profile (as thin as 500 microns ~ 0.020 in). The batteries are extremely flexible and durable, even
under high duty levels, and offer the same “green” advantages as the ST Series.
UT batteries are available in a variety of shapes and sizes. Typical standard form factors are 1.5V, capable of
delivering approximately 12 mAh of energy, with peak drain currents of at least 1 mA. Overall voltage, storage
capacity and thickness can be adjusted according to each customer’s power requirements.
©2010 Blue Spark Technologies.

- http://ozlab1.blogspot.com/2010_01_01_archive.html
Power cells produced T-shirt fashion
By James Sherwood July 2009
Power boffins have developed a prototype battery that’s not only lighter and thinner than existing power cells,
but is produced using a printing process.
Printed Batteries Provide Paper-Thin Power
August 2009
A team of German scientists has invented the world's first printable batteries. Thin, flexible and
environmentally friendly, the batteries can be produced in large quantities for a fraction of what it takes to
produce conventional batteries. The new battery is also different in other ways from conventional batteries.
The printable version weighs less than one gram on the scales, is not even one millimeter thick and can
therefore be integrated into bank cash cards, for example.The battery contains no mercury and is in this
respect environmentally friendly. Its voltage is 1.5 V, which lies within the normal range.
- http://www.elektor.com/news/a-printed-battery.860844.lynkx
A printed battery
March 2009

The printed battery is an innovation developed by the department Printed Functionalities of the Fraunhofer
ENAS in Germany. Series connections of printed batteries are possible for the first time, thus integer multiples
of the nominal voltage of 1.5 V are realized (3 V, 4.5 V, 6 V).
The battery system is zinc manganese which might be regarded as environmentally friendly. Parts of the
batteries’ components may even be composed. By using high efficient printing technologies and the
adaptation of the used materials, the production yield reaches almost 100 %.
The printed batteries are especially suited for thin and flexible products. These might be e.g. intelligent chip
and sensor cards, medical patches and plasters for transdermal medication and vital signs monitoring, as well
as lab on chip analyses. The combination with other flexible or thin modules, at least, has to be accentuated.
Hereby flexible displays and solar cells may be manufactured in the same manner of preparation and
combined where required.
More info Fraunhofer website
- http://gigaom.com/cleantech/mit-researchers-print-tiny-battery-using-viruses/
MIT Researchers Print Tiny Battery Using Viruses
By Craig Rubens August 2008
Using nanorobots to build circuits is so last year’s fantasy. The latest technology of tomorrow uses viruses to
construct everything from transistors to tiny batteries to solar cells. Researchers at MIT published a paper in
the Proceedings of the National Academy of Sciences this week describing how they’ve successfully created
tiny batteries, just four- to eight-millionths of a meter in diameter, using specially designed viruses. The hope is
that these tiny batteries — which could be used in embedded medical sensors — and eventually other
electronics, could be printed easily and cheaply onto surfaces and woven into fabrics.
Viruses are very orderly little critters and in high concentrations organize themselves into patterns, without
high heat, toxic solvents or expensive equipment. By tweaking their DNA, the viruses, called M13, can be
programmed to bind to inorganic materials, like metals and semiconductors. So far, the researchers have
been able to use viruses to assemble the anode and electrolyte, two of the three main components of a
battery. Eventually the work could also be used to make tiny electronics made up of silicon-covered viruses.
Gross and cool.
“It’s not really analogous to anything that’s done now,” lead researcher Angela Belcher told MIT Technology
Review late last year when describing her work. “It’s about giving totally new kinds of functionalities to fibers.”
The idea of thread-like electronics has gotten the interest of the Army, which has been funding Belcher’s
research through the Army Research Office Institute of Collaborative Biotechnologies and the Army Research
Office Institute of Soldier Nanotechnologies. Theoretically, these fibers could be woven into soldiers’ uniforms
allowing clothing to sense biological or chemical agents as well as collect and store energy from the sun to
power any number of devices.
The team still has to create a cathode for the battery, but so far, so good; the researchers note that when a
platinum cathode is attached, “the resulting electrode arrays exhibit full electrochemical functionality.” Belcher
has also successfully created fibers that glow under UV light, tiny cobalt oxide wires and has even developed
viruses that bind to gold. We’re still waiting to see some viral bling.

- http://www.gizmag.com/go/7018/picture/32741/
Flexible see-through battery power
By Mike Hanlon February 2007
Flexible see-through battery power
All is no longer as it seems — the clear flexible plastic in the image is a battery — it is a polymer based
rechargeable battery made by Japanese scientists. Drs Hiroyuki Nishide, Hiroaki Konishi and Takeo Suga at
Waseda University have designed the battery — which consists of a redox-active organic polymer film around
200 nanometres thick. Nitroxide radical groups are attached, which act as charge carriers. Because of its high
radical density, the battery has a high charge/discharge capacity. This is just one of many advantages the
'organic radical' battery has over other organic based materials according to the researchers. The power rate
performance is strikingly high — it only takes one minute to fully charge the battery and it has a long cycle life,
often exceeding 1,000 cycles.
The team made the thin polymer film by a solution-processable method — a soluble polymer with the radical
groups attached is _spin-coated" onto a surface. After UV irradiation, the polymer then becomes crosslinked
with the help of a bisazide crosslinking agent.
A drawback of some organic radical polymers is the fact they are soluble in the electrolyte solution which
results in self-discharging of the battery — but the polymer must be soluble so it can be spin-coated.
However, the photocrosslinking method used by the Japanese team overcomes the problem and makes the
polymer mechanically tough.
Dr Nishide said: This has been a challenging step, since most crosslinking reactions are sensitive to the
nitroxide radical."
Professor Peter Skabara, an expert in electroactive materials at the University of Strathclyde , praised the high
stability and fabrication strategy of the polymer-based battery. The plastic battery plays a part in ensuring that
organic device technologies can function in thin film and flexible form as a complete package." The news is
reported in the edition of The Royal Society of Chemistry journal Chemical Communications.
- http://www.ee-yorkshire.com/yf/services/enquire.asp?id=10%20ES%2027F3%203ISQ&EnquiryType=BBS
Transparent lithium ion secondary battery
An Andalusian University has developed a novel transparent lithium ion secondary battery comprising a first
transparent support, a first transparent electronic conductor and transparent positive and negative electrodes,
a solid lithium ion electrolyte between the negative and positive electrodes, a second transparent conductor
and a second transparent support. Its transparency to sunlight enables the integration of this battery into glass
surfaces of buildings making it suitable for an energy saving and self-sustainable system, including lighting if
combined with solar cells The invention also includes a method of manufacturing the battery.
- http://www.eu-service-
bb.de/data/newsletter/1314/transparent_lithium_ion_secondary_battery.pdf?PHPSESSID=d0c174598bdecb3c53c795480705a8c4
Enterprise Europe Pdf document: transparent_lithium_ion_secondary_battery.pdf

- http://www.oakridgemicro.com/tech/tfb.htm
Thin-film rechargeable lithium batteries
Thin-film rechargeable lithium batteries were developed by Dr. John Bates and his team of scientists and
engineers from more than a decade of research at the Oak Ridge National Laboratory (ORNL). Unlike
conventional batteries, thin film batteries can be deposited directly onto chips or chip packages in any shape
or size, and when fabricated on thin plastics, the batteries are quite flexible.
Miniature thin film lithium battery on a ceramic substrate for use in an implantable medical device.
Some of the unique properties of thin-film batteries that distinguish them from conventional batteries include:
All solid state construction
Can be operated at high and low temperatures (tests have been conducted between -20°C and 140°C)
Can be made in any shape or size
Cost does not increase with reduction in size (constant $/cm2)
Completely safe under all operating conditions.
Copyright © 2008 Oak Ridge Micro-Energy, Inc.
- http://www.excellatron.com/advantage.htm
Thin Film Batteries
A unique packaging technology has also been developed by Excellatron, enabling long-term shelf life of thin
film batteries under harsh environmental conditions, such as high pressure, high temperature, and high
humidity.
Rechargeable thin film solid state batteries manufactured by Excellatron.
The total thickness of the battery is only 0.31mm
©Copyright 2008 Excellatron

- http://www.geomatec.co.jp/eng/product/products_06.html
Thin-film rechargeable batteries
Cooperation development with Iwate University
Film rechargeable battery
An achievement in unparalleled thinness
Thin-film rechargeable batteries are possible with a thickness of a few µm. The thin film is comprised of the
support substrate, collectors, and electrodes, and nevertheless is thinner and more lightweight than even the
thinnest current polymer batteries (several hundred µm thick).
- http://news.rpi.edu/update.do?artcenterkey=2273&setappvar=page(1)
Beyond Batteries: Storing Power in a Sheet of Paper
Troy, N.Y. — Researchers at Rensselaer Polytechnic Institute have developed a new energy storage device
that easily could be mistaken for a simple sheet of black paper.
Copyright © 1996—2008 Rensselaer Polytechnic Institute
- http://www.frontedgetechnology.com/gen.htm
NanoEnergy® is a miniature power source designed for highly space limited micro devices such as smart
card, portable sensors, and RFID tag.
©2000-2008 Front Edge Technology, Inc.
Ultra thin As thin as 0.05 mm (0.002 inch) including package.
Safe & environmentally friendly All solid-state, using ceramic electrolyte LiPON developed by Oak Ridge National Laboratories.
Contains no liquid or environmental hazardous material.
Long cycle life More than 1, 000 cycles at 100% depth discharge.
Flexible form factor Can be made into different shapes and sizes.
Low self-discharge Less than 5% per year.
Bendable Can be bent and twisted without damage.

CCCCCCCChhhhhhhhaaaaaaaarrrrrrrrggggggggiiiiiiiinnnnnnnngggggggg bbbbbbbbaaaaaaaatttttttttttttttteeeeeeeerrrrrrrriiiiiiiieeeeeeeessssssss wwwwwwwwiiiiiiiitttttttthhhhhhhhoooooooouuuuuuuutttttttt wwwwwwwwiiiiiiiirrrrrrrreeeeeeeessssssss
- http://web.mit.edu/newsoffice/2007/wireless-0607.html
MIT team experimentally demonstrates wireless power transfer, potentially useful for powering
laptops, cell phones without cords.
Franklin Hadley, Institute for Soldier Nanotechnologies Massachusetts Institute of Technology
http://web.mit.edu/newsoffice/techtalk-info.html PDF
- http://12degreesoffreedom.blogspot.com/2008/03/wireless-electricity.html
No strings (or wires) attached
Researchers at the Massachusetts Institute of Technology think that transmitting power without wires is not
only possible but within reach.
- http://www.dailymail.co.uk/sciencetech/article-460602/The-end-plug-Scientists-invent-wireless-device-beams-electricity-home.html
Scientists invent wireless device that beams electricity through your home
- http://news.cnet.com/Wireless-power-gets-recharged/2100-1041_3-6147684.html
Wireless power gets recharged
By Erica Ogg Staff Writer, CNET News.com
At the Consumer Electronics Show next week, two companies--Arizona-based start-up WildCharge and
Michigan-based Fulton Innovation--will demonstrate what are expected to be very different ways to give
gadgets juice, sans wires.
The process creates an electromagnetic field, but does not interfere with Wi-Fi or Bluetooth devices and won't
demagnetize credit cards, Baarman said.
© 2008 CBS Interactive Inc
- https://www.wildcharge.com/index.cfm/fuseaction/category.display/category_ID/255/How_It_Works.htm
The WildCharger pad is flat and thin with a conductive surface. Once a cell phone or other electronic device
that is enabled with WildCharge technology is placed on the pad — anywhere on the pad and at any
orientation — it will instantaneously receive power from the pad. It is that simple. And charging speed is the
same as if the device is plugged to the wall!
© 2008 WildCharge_
- http://ecoupled.com/technologyMain.html
eCoupled technology_ is intelligent wireless power. It changes the way that people and devices interact with
power and data.
© 2008 Fulton Innovation , LLC

WWWWWWWWiiiiiiiiTTTTTTTTrrrrrrrriiiiiiiicccccccciiiiiiiittttttttyyyyyyyy
- http://en.wikipedia.org/wiki/WiTricity
WiTricity, a portmanteau for wireless electricity, is a term coined initially by Dave Gerding in 2005 and used
by an MIT research team led by Prof. Marin Soljaèiæ in 2007, to describe the ability to provide electrical
energy to remote objects without wires. WiTricity is based on strong coupling between electromagnetic
resonant objects to transfer energy wirelessly between them. The system consists of WiTricity transmitters
and receivers that contain magnetic loop antennas critically tuned to the same frequency. As WiTricity
operates in the electromagnetic near-field, the receiving devices must be no more than about a quarter
wavelength from the transmitter (which is a few meters at the frequency used by the example system). In their
first paper, the group also simulated GHz dielectric resonators.
- http://12degreesoffreedom.blogspot.com/2008/03/wireless-electricity.html
1 Wall outlet
2 Resonant copper coil attached to frequency converter and
plugged into outlet
3 Electromagnetic field
4 Resonant copper coil attached to light bulb
Wireless Light
Marin Soljaèiæ and colleagues used magnetic resonance coupling to power a 60-watt light bulb. Tuned to the
same frequency, two 60-centimeter copper coils can transmit electricity over a distance of two meters, through
the air and around an obstacle.
- http://www.jcwa.or.jp/eng/knowledge/tech/tech05.html
Non-contact recharging system watches
Watches recharged by using a charger are called rechargeable watches.
For wrist watches, the ordinary contact recharging method is not practical as it could lead to deterioration on a
watch's quality characteristics such as water resistance. In this regard, however, a non-contact recharging
system can be employed, so that the watch can be recharged without opening the case back when it is simply
placed on a charger.
When a watch is placed on a charger, an alternating magnetic field is created, which induces an alternating
voltage in the internal coil of the watch. This induced voltage is rectified and stored in the energy storage unit
to power the quartz watch.
The mechanism of non-contact recharging system watches is explained below.

1. Place the watch on the charger.
2. An alternating current of approximately 20 Hz is applied to the primary coil inside the charger to produce an
alternating magnetic field.
3. Across the secondary coil inside the watch, the induced voltage is generated based on Faraday's law of
electromagnetic induction.
4. The alternating voltage induced across the secondary coil is rectified and stored in the secondary battery.
5. The secondary battery transmits the electrical energy to the driving circuit to run the quartz watch.

SSSSSSSSoooooooollllllllaaaaaaaarrrrrrrr EEEEEEEEnnnnnnnneeeeeeeerrrrrrrrggggggggyyyyyyyy
- http://media.caltech.edu/press_releases/13325
Caltech Researchers Create Highly Absorbing, Flexible Solar Cells with Silicon Wire Arrays
Pasadena, Calif.— Using arrays of long, thin silicon wires embedded in a polymer substrate, a team of
scientists from the California Institute of Technology (Caltech) has created a new type of flexible solar cell that
enhances the absorption of sunlight and efficiently converts its photons into electrons. The solar cell does all
this using only a fraction of the expensive semiconductor materials required by conventional solar cells.
"These solar cells have, for the first time, surpassed the conventional light-trapping limit for absorbing
materials," says Harry Atwater, Howard Hughes Professor, professor of applied physics and materials science,
and director of Caltech's Resnick Institute, which focuses on sustainability research.
This is a photomicrograph of a silicon wire array embedded within a transparent, flexible polymer film.
[Credit: Caltech/Michael Kelzenberg]
The light-trapping limit of a material refers to how much sunlight it is able to absorb. The silicon-wire arrays
absorb up to 96 percent of incident sunlight at a single wavelength and 85 percent of total collectible sunlight.
"We've surpassed previous optical microstructures developed to trap light," he says.
Atwater and his colleagues—including Nathan Lewis, the George L. Argyros Professor and professor of
chemistry at Caltech, and graduate student Michael Kelzenberg—assessed the performance of these arrays in
a paper appearing in the February 14 advance online edition of the journal Nature Materials.
Atwater notes that the solar cells' enhanced absorption is "useful absorption."
"Many materials can absorb light quite well but not generate electricity—like, for instance, black paint," he
explains. "What's most important in a solar cell is whether that absorption leads to the creation of charge
carriers."
The silicon wire arrays created by Atwater and his colleagues are able to convert between 90 and 100 percent
of the photons they absorb into electrons—in technical terms, the wires have a near-perfect internal quantum
efficiency. "High absorption plus good conversion makes for a high-quality solar cell," says Atwater. "It's an
important advance."
The key to the success of these solar cells is their silicon wires, each of which, says Atwater, "is independently
a high-efficiency, high-quality solar cell." When brought together in an array, however, they're even more
effective, because they interact to increase the cell's ability to absorb light.
"Light comes into each wire, and a portion is absorbed and another portion scatters. The collective scattering
interactions between the wires make the array very absorbing," he says.

This is a schematic diagram of the light-trapping elements used to optimize absorption within a polymer-
embedded silicon wire array.
[Credit: Caltech/Michael Kelzenberg]
This effect occurs despite the sparseness of the wires in the array—they cover only between 2 and 10 percent
of the cell's surface area.
"When we first considered silicon wire-array solar cells, we assumed that sunlight would be wasted on the
space between wires," explains Kelzenberg. "So our initial plan was to grow the wires as close together as
possible. But when we started quantifying their absorption, we realized that more light could be absorbed than
predicted by the wire-packing fraction alone. By developing light-trapping techniques for relatively sparse wire
arrays, not only did we achieve suitable absorption, we also demonstrated effective optical concentration—an
exciting prospect for further enhancing the efficiency of silicon-wire-array solar cells."
Each wire measures between 30 and 100 microns in length and only 1 micron in diameter. _The entire
thickness of the array is the length of the wire," notes Atwater. _But in terms of area or volume, just 2 percent
of it is silicon, and 98 percent is polymer."
In other words, while these arrays have the thickness of a conventional crystalline solar cell, their volume is
equivalent to that of a two-micron-thick film.
Since the silicon material is an expensive component of a conventional solar cell, a cell that requires just one-
fiftieth of the amount of this semiconductor will be much cheaper to produce.
The composite nature of these solar cells, Atwater adds, means that they are also flexible. "Having these be
complete flexible sheets of material ends up being important," he says, "because flexible thin films can be
manufactured in a roll-to-roll process, an inherently lower-cost process than one that involves brittle wafers,
like those used to make conventional solar cells."
Atwater, Lewis, and their colleagues had earlier demonstrated that it was possible to create these innovative
solar cells. "They were visually striking," says Atwater. "But it wasn't until now that we could show that they are
both highly efficient at carrier collection and highly absorbing."
The next steps, Atwater says, are to increase the operating voltage and the overall size of the solar cell. "The
structures we've made are square centimeters in size," he explains. "We're now scaling up to make cells that
will be hundreds of square centimeters—the size of a normal cell."
Atwater says that the team is already "on its way" to showing that large-area cells work just as well as these
smaller versions.
In addition to Atwater, Lewis, and Kelzenberg, the all-Caltech coauthors on the Nature Materials paper,
"Enhanced absorption and carrier collection in Si wire arrays for photovoltaic applications," are postdoctoral
scholars Shannon Boettcher and Joshua Spurgeon; undergraduate student Jan Petykiewicz; and graduate
students Daniel Turner-Evans, Morgan Putnam, Emily Warren, and Ryan Briggs.
Their research was supported by BP and the Energy Frontier Research Center program of the Department of
Energy, and made use of facilities supported by the Center for Science and Engineering of Materials, a
National Science Foundation Materials Research Science and Engineering Center at Caltech. In addition,
Boettcher received fellowship support from the Kavli Nanoscience Institute at Caltech.
Lori Oliwenstein (626) 395-3631 lorio@caltech.edu

- http://www.solarisnano.com/coretechnologies.php
Solaris has proprietary and patented approaches for dramatically lowering the cost of solar panels and
improving the efficiency of photovoltaics.
Our proven and validated process for recharging of low manufacturing cost dye sensitized solar cells (DSSC)
eliminates the existing lifetime limitations of these photovoltaics, allowing them to function beyond the lifetime
of current silicon technology. When combined with government subsidies, these solar cells will cost the
consumer less than $3,000 with a five year payback period. This is in comparison to current silicon technology
which requires cash outlays of $12,000 or more with payback periods in excess of twelve years in most US
residential markets.
Furthermore, the Solaris’ non-toxic materials based process for recharging DSSCs allows for future
improvements in the installed base of solar cells through recharging with newly developed, higher-efficiency
dyes. This technology represents the world’s first and only rechargeable photovoltaic with the capability for
post-installation upgrades. Based on conservative market growth and penetration, we believe that this product
can exceed a billion dollars of annual revenue for Solaris within the next decade.
- http://www.solarisnano.com/solarenergy.php
Various colors in a series-connected dye solar cell modules, courtesy of Dr. Winfried Hofmann, RWE-Schott
Dye-sensitized electrochemical photovoltaic cells, also known as Graetzel Cells, offer significantly lower
manufacturing costs because of their simplicity and use of low-cost active materials such as TiO2.
Solaris Nanosciences has demonstrated a completely rechargeable dye sensitized solar cell (DSSC or
Graetzel Cell) creating the lowest manufacturing cost, long-life photovoltaic system in the world. DSSCs which
are based on low cost materials and simple construction, have to date suffered from limited operating lifetimes
due to the degradation of the sensitizer dyes. Solaris' nontoxic chemical process allows the degraded dye in
already installed DSSCs to be removed and replaced with new dye, restoring the performance of the original
solar cell.
DSSC or Graetzel Cell
- http://en.wikipedia.org/wiki/Dye-sensitized_solar_cell
A dye-sensitized solar cell (DSSC, DSC or DYSC[1]) is a class of low-cost solar cell belonging to the group of
thin film solar cells.[2] It is based on a semiconductor formed between a photo-sensitized anode and an
electrolyte; a photoelectrochemical system. This cell was invented by Michael Grätzel and Brian O'Regan at
the École Polytechnique Fédérale de Lausanne in 1991[3] and are also known as Grätzel cells. Michael
Grätzel won the 2010 Millennium Technology Prize for the invention of the Grätzel cell.[4]
Grätzel's cell is composed of a porous layer of titanium dioxide nanoparticles, covered with a molecular dye
that absorbs sunlight, like the chlorophyll in green leaves. The titanium dioxide is immersed under an

electrolyte solution, above which is a platinum-based catalyst. As in a conventional alkaline battery, an anode
(the titanium dioxide) and a cathode (the platinum) are placed on either side of a liquid conductor (the
electrolyte).
Sunlight passes through the transparent electrode into the dye layer where it can excite electrons that then
flow into the titanium dioxide. The electrons flow toward the transparent electrode where they are collected for
powering a load. After flowing through the external circuit, they are re-introduced into the cell on a metal
electrode on the back, flowing into the electrolyte. The electrolyte then transports the electrons back to the dye
molecules.
Dye-sensitized solar cells separate the two functions provided by silicon in a traditional cell design. Normally
the silicon acts as both the source of photoelectrons, as well as providing the electric field to separate the
charges and create a current. In the dye-sensitized solar cell, the bulk of the semiconductor is used solely for
charge transport, the photoelectrons are provided from a separate photosensitive dye. Charge separation
occurs at the surfaces between the dye, semiconductor and electrolyte.
The dye molecules are quite small (nanometer sized), so in order to capture a reasonable amount of the
incoming light the layer of dye molecules needs to be made fairly thick, much thicker than the molecules
themselves. To address this problem, a nanomaterial is used as a scaffold to hold large numbers of the dye
molecules in a 3-D matrix, increasing the number of molecules for any given surface area of cell. In existing
designs, this scaffolding is provided by the semiconductor material, which serves double-duty.
- https://inlportal.inl.gov/portal/server.pt?open=514&objID=1269&mode=2&featurestory=DA_101047
Harvesting the sun's energy with antennas
INL researcher Steven Novack holds a plastic sheet of nanoantenna arrays, created by embossing the
antenna structure and depositing a conductive metal in the pattern. Each square contains roughly 260 million
antennas. Nanotechnology R&D usually occurs on the centimeter scale, but this INL-patented manufacturing
process demonstrates nano-scale features can be produced on a larger scale.
(Credit: U.S. Department of Energy's Idaho National Laboratory)
Researchers at Idaho National Laboratory, along with partners at Microcontinuum Inc. (Cambridge, MA) and
Patrick Pinhero of the University of Missouri, are developing a novel way to collect energy from the sun with a
technology that could potentially cost pennies a yard, be imprinted on flexible materials and still draw energy
after the sun has set.

The new approach, which garnered two 2007 Nano50 awards, uses a special manufacturing process to stamp
tiny loops of conducting metal onto a sheet of plastic. Each "nanoantenna" is as wide as 1/25 the diameter of a
human hair.
Because of their size, the nanoantennas absorb energy in the infrared part of the spectrum, just outside the
range of what is visible to the eye. The sun radiates a lot of infrared energy, some of which is soaked up by
the earth and later released as radiation for hours after sunset. Nanoantennas can take in energy from both
sunlight and the earth's heat, with higher efficiency than conventional solar cells.
An array of loop nanoantennas, imprinted on plastic and imaged with a scanning electron microscope. The
deposited wire is roughly 200 nanometers thick. (Credit: U.S. Department of Energy's Idaho National Laboratory)

Commercial solar panels usually transform less that 20 percent of the usable energy that strikes them into
electricity.
The team estimates individual nanoantennas can absorb close to 80 percent of the available energy. The
circuits themselves can be made of a number of different conducting metals, and the nanoantennas can be
printed on thin, flexible materials like polyethylene, a plastic that's commonly used in bags and plastic wrap. In
fact, the team first printed antennas on plastic bags used to deliver the Wall Street Journal, because they had
just the right thickness
- http://www.guardian.co.uk/environment/2007/dec/29/solarpower.renewableenergy
Solar energy 'revolution' brings green power closer.
Power from light:
Photovoltaic (PV) devices convert light into electrical energy. PV cells are made of semiconductor materials
such as silicon. When light shines on a PV cell, the energy is transferred to electrons in the atoms of the PV
cell. These electrons become part of the electrical flow, or current, in an electrical circuit. First wave
photovoltaic cell used thick silicon-wafer cells but were cumbersome and costly. The second generation of
photovoltaic materials were developed about 10 years ago and use very thin silicon layers. These brought the
price down dramatically but still need expensive vacuum processes in their construction. The third wave of PV,
now being developed by firms such as Nanosolar, can print directly on to other materials and does not use
silicon.
- http://www.sciencedaily.com/releases/2008/04/080410101210.htm
Future Of Solar-powered Houses Is Clear: New Windows Could Halve Carbon Emissions
Professor John Bell said QUT had worked with a Canberra-based company Dyesol, which is developing
transparent solar cells that act as both windows and energy generators in houses or commercial buildings.
"The transparent solar cells have a faint reddish hue but are completely see-through," Professor Bell said.
"The solar cells contain titanium dioxide coated in a dye that increases light absorption.
"The glass captures solar energy which can be used to power the house but can also reduce overheating of
the house, reducing the need for cooling."
Copyright © 1995-2008 ScienceDaily LLC
- http://www.hp.com/hpinfo/newsroom/press/2008/080604a.html
HP Licenses Technology to Xtreme Energetics for Creation of Super-efficient Solar Energy System
HP and Xtreme Energetics (XE), a solar energy system developer based in Livermore, Calif., today
announced they have entered into an agreement for the development of a solar energy system designed to
generate electricity at twice the efficiency and half the cost of traditional solar panels.
Under the technology collaboration and licensing agreement, HP will license its transparent transistor
technology to XE in return for royalty payments.
The transparent transistor technology that will be used in XE's solar energy device was co-developed by HP
and Oregon State University. The technology includes thin film transparent transistors, which are made from
low-cost, readily available materials such as zinc and tin. The materials raise no environmental concerns and
allow for higher mobility, better chemical stability and easier manufacture.
© 2008 Hewlett-Packard Development Company, L.P
- http://www.xyhd.tv/2007/09/technical/nanosolar-the-solar-cell-you-print-on-your-computer/
Nano Solar uses an inkjet to create solar cells that are extremely thin, and cheap to manufacture. The
Technology is interesting. Because it is printed the cells are amazingly thin, transparent even. So it can be
applied to windows, or other surfaces. Using copper indium gallium diselenide (CIGS) an inorganic
photovoltaic compound literally used as an ink a film, or sheet can be printed to what ever size and shape is
needed and then nanocomponents in the ink align themselves properly via molecular self-assembly.
XYHD.TV © 2007
- http://www.nanosolar.com/products.htm
Nanosolar SolarPly_.
Light-weight solar-electric cell foil which can be cut to any size. Non-fragile. No soldering required for
electrical contact.
Copyright © 2002 - 2008, Nanosolar, Inc.

- http://www.octillioncorp.com/nano-power.php
NanoPower Windows (nanosilicon photovoltaic solar cells)
The technological potential of adapting existing glass windows into ones capable of generating electricity from
the sun's solar energy has been made possible through a ground breaking discovery of an electrochemical
and ultrasound process that produces identically sized (1 to 4 nanometers in diameter) nanoparticles of silicon
that provide varying wavelengths of photoluminescence and high quantum efficiency (50% to 60%).
Octillion Corp. © 2008
- http://www.nextenergynews.com/news1/next-energy-news1.7d.html
Scientists Invent Solar Cell Sheet That Collects Energy at Night
Researchers at Idaho National Laboratory, along with partners at Microcontinuum Inc. (Cambridge, MA) and
Patrick Pinhero of the University of Missouri, are developing a novel way to collect energy from the sun with a
technology that could potentially cost pennies a yard, be imprinted on flexible materials and still draw energy
after the sun has set.
Copyright © 2008, Next Energy News.
'Major Discovery' Primed To Unleash Solar Revolution: Scientists Mimic Essence Of Plants' Energy
Storage System
In a revolutionary leap that could transform solar power from a marginal, boutique alternative into a
mainstream energy source, MIT researchers have overcome a major barrier to large-scale solar power: storing
energy for use when the sun doesn't shine.
- http://www.openecosource.org/energy-systems/promising-and-innovative-konarka-photovoltaics
Konarka builds Power Plastic® that converts light to energy — anywhere. The company develops and
manufactures light-activated Power Plastic® that is inexpensive, lightweight, flexible and versatile. This
material makes it possible for devices, systems and structures to have their own low cost embedded sources
of renewable power. By integrating energy generation functionality into everyday devices, Konarka allows
manufacturers to offer truly wireless applications.
- http://www.konarka.com/index.php/site/tech_power_plastic/
Konarka builds products that convert light to energy anywhere.
Download PDF file
- http://science.howstuffworks.com/solar-cell.htm
In this article, they will examine solar cells to learn how they convert the sun's energy directly into electricity.
- http://www.rug.nl/edrec/nieuws/nieuwsberichten/ontwikkelingDoorzichtigeZonnecellen?lang=en
Researcher from Groningen developes transparent solar cells
- http://greenmonk.net/hp-teaming-with-xtreme-energetics-to-produce-cheaper-more-efficient-cheaper-solar/
HP teaming with Xtreme Energetics to produce cheaper, more efficient cheaper solar
- http://venturebeat.com/2008/06/16/xtreme-energetics-ultra-efficient-pretty-solar-systems-catch-hps-eye/
Xtreme Energetics' ultra-efficient, pretty solar systems catch HP's eye.

SSSSSSSSeeeeeeeeeeeeeeeebbbbbbbbeeeeeeeecccccccckkkkkkkk eeeeeeeeffffffffffffffffeeeeeeeecccccccctttttttt -------- TTTTTTTThhhhhhhheeeeeeeerrrrrrrrmmmmmmmmooooooooeeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrriiiiiiiicccccccc
Electricity from the body heat
http://www.eetimes.com/design/smart-energy-design/4011571/Energy-harvesting-chips-and-the-quest-for-everlasting-life
Energy-harvesting chips and the quest for everlasting life
Erick O. Torres, Student Member, IEEE, and Gabriel A. Rincón-Mora, Senior Member, IEEE Georgia Tech Analog and Power IC Design
Lab
Modern electronics continue to push past boundaries of integration and functional density, towards the elusive
completely autonomous self-powered microchip. As systems continue to shrink, however, less energy is
available on-board, leading to short device lifetime (runtime or battery life). Research continues to develop
higher energy-density batteries but the amount of energy available is not only finite but also low, limiting the
system's lifespan, which is paramount in portable electronics. Extended life is also particularly advantageous
in systems with limited accessibility, such as biomedical implants and structure-embedded micro-sensors. The
ultimate long-lasting solution should therefore be independent of the limited energy available during start-up,
which is where a self-renewing energy source comes in, continually replenishing the energy consumed by the
micro-system.
State-of-the-art micro-electromechanical system (MEMS) generators and transducers can be such self-
renewing sources, extracting energy from vibrations, thermal gradients, and light. The energy extracted from
these sources is stored in chip-compatible, rechargeable batteries such as thin-film lithium ion, which powers
the loading application (e.g., sensor, etc.) via a regulator circuit. Since harvested energy manifests itself in
irregular, random, low energy "bursts," a power-efficient, discontinuous, intermittent charger is required to
transfer the energy from the sourcing devices to the battery. Energy that is typically lost or dissipated in the
environment is therefore recovered and used to power the system, significantly extending the operational
lifetime of the device.
Harvesting Energy
Energy harvesting is defined as the conversion of ambient energy into usable electrical energy. When
compared with the energy stored in common storage elements, like batteries and the like, the environment
represents a relatively inexhaustible source of energy. Consequently, energy harvesting (i.e., scavenging)
methods must be characterized by their power density, rather than energy density. Table 1 compares the
estimated power and challenges of various ambient energy sources. Light, for instance, can be a significant
source of energy, but it is highly dependant on the application and the exposure to which the device is
subjected. Thermal energy, on the other hand, is limited because the temperature differentials across a chip
are typically low. Vibration energy is a moderate source, but again dependent on the particular application.
Energy Source Challenge
Estimated Power
(in 1 cm3 or 1 cm2)
Light Conform to small surface area
10 µW - 15 mW
(Outdoors: 0.15 - 15 mW)
(Indoors: <10 µW)
Vibrations Variability of vibration
1 - 200 µW
(Piezoelectric: ~ 200 µW)
(Electrostatic: 50 - 100 µW)
(Electromagnetic: < 1µW)
Thermal Small thermal gradients
15 µW
(10°C gradient)
Comparison between different ambient energy sources
Vibration Energy
Energy extraction from vibrations is based on the movement of a "spring-mounted" mass relative to its support
frame. Mechanical acceleration is produced by vibrations that in turn cause the mass component to move and
oscillate (kinetic energy). This relative displacement causes opposing frictional and damping forces to be
exerted against the mass, thereby reducing and eventually extinguishing the oscillations. The damping forces
literally absorb the kinetic energy of the initial vibration. This energy can be converted into electrical energy via
an electric field (electrostatic), magnetic field (electromagnetic), or strain on a piezoelectric material. These
energy-conversion schemes amount to harvesting energy from vibrations.

Electromagnetic vibration energy harvester
Electromagnetic energy harvesting uses a magnetic field to convert mechanical energy to electrical. A coil
attached to the oscillating mass traverses through a magnetic field that is established by a stationary magnet.
The coil travels through a varying amount of magnetic flux, inducing a voltage according to Faraday's law. The
induced voltage is inherently small and must therefore be increased to viably source energy. Methods to
increase the induced voltage include using a transformer, increasing the number of turns of the coil, and/or
increasing the permanent magnetic field. However, each is limited by the size constraints of a microchip.
Piezoelectric energy harvesting converts mechanical energy to electrical by straining a piezoelectric material.
Strain, or deformation, in a piezoelectric material causes charge separation across the device, producing an
electric field and consequently a voltage drop proportional to the stress applied. The oscillating system is
typically a cantilever beam structure with a mass at the unattached end of the lever, since it provides higher
strain for a given input force (a). The voltage produced varies with time and strain, effectively producing an
irregular ac signal. Piezoelectric energy conversion produces relatively higher voltage and power density
levels than the electromagnetic system.
(a) Piezoelectric energy harvesting beam and (b) MEMS varactors (c) in an energy-harvesting circuit
Electrostatic (capacitive) energy harvesting relies on the changing capacitance of vibration-dependant
varactors [3, 8-9]. A varactor, or variable capacitor, is initially charged and, as its plates separate because of
vibrations, mechanical energy is transformed into electrical energy (Figures 3b and 3c). The most attractive
feature of this method is its IC-compatible nature, given that MEMS variable capacitors are fabricated through
relatively mature silicon micro-machining techniques. This scheme produces higher and more practical output
voltage levels than the electromagnetic method, with moderate power density.
Thermal Energy
Thermal gradients in the environment are directly converted to electrical energy through the Seebeck
(thermoelectric) effect. Temperature differentials between opposite segments of a conducting material result in
heat flow and consequently charge flow, since mobile, high-energy carriers diffuse from high to low
concentration regions. Thermopiles consisting of n- and p-type materials electrically joined at the high-
temperature junction are therefore constructed, allowing heat flow to carry the dominant charge carriers of
each material to the low temperature end, establishing in the process a voltage difference across the base
electrodes. The generated voltage and power is proportional to the temperature differential and the Seebeck
coefficient of the thermoelectric materials. Large thermal gradients are essential to produce practical voltage
and power levels. Nevertheless, temperature differences greater than 10°C are rare in a micro-system,
consequently producing low voltage and power levels.

Thermoelectrics
- http://en.wikipedia.org/wiki/Energy_harvesting
Energy harvesting (also known as power harvesting or energy scavenging) is the process by which
energy is derived from external sources (e.g., solar power, thermal energy, wind energy, salinity gradients,
and kinetic energy), captured, and stored. Frequently, this term is applied when speaking about small, wireless
autonomous devices, like those used in wearable electronics and wireless sensor networks.
Thermoelectrics
In 1821, Thomas Johann Seebeck discovered that a thermal gradient formed between two dissimilar
conductors produces a voltage. At the heart of the thermoelectric effect is the fact that a temperature gradient
in a conducting material results in heat flow; this results in the diffusion of charge carriers. The flow of charge
carriers between the hot and cold regions in turn creates a voltage difference. In 1834, Jean Charles Athanase
Peltier discovered that running an electric current through the junction of two dissimilar conductors could,
depending on the direction of the current, cause it to act as a heater or cooler. The heat absorbed or produced
is proportional to the current, and the proportionality constant is known as the Peltier coefficient. Today, due to
knowledge of the Seebeck and Peltier effects, thermoelectric materials can be used as heaters, coolers and
generators (TEGs).
Ideal thermoelectric materials have a high Seebeck coefficient, high electrical conductivity, and low thermal
conductivity. Low thermal conductivity is necessary to maintain a high thermal gradient at the junction.
Standard thermoelectric modules manufactured today consist of P- and N-doped bismuth-telluride
semiconductors sandwiched between two metallized ceramic plates. The ceramic plates add rigidity and
electrical insulation to the system. The semiconductors are connected electrically in series and thermally in
parallel.
Miniature thermocouples have been developed that convert body heat into electricity and generate 40µW at
3V with a 5 degree temperature gradient, while on the other end of the scale, large thermocouples are used in
nuclear RTG batteries.
Practical examples are the finger-heartratemeter by the Holst Centre and the thermogenerators by the
Fraunhofer Gesellschaft.
Advantages to thermoelectrics:
No moving parts allow continuous operation for many years. Tellurex Corporation (a thermoelectric production
company) claims that thermoelectrics are capable of over 100,000 hours of steady state operation.
Thermoelectrics contain no materials that must be replenished.
Heating and cooling can be reversed.
One downside to thermoelectric energy conversion is low efficiency (currently less than 10%). The
development of materials that are able to operate in higher temperature gradients, and that can conduct
electricity well without also conducting heat (something that was until recently thought impossible), will result in
increased efficiency.
Future work in thermoelectrics could be to convert wasted heat, such as in automobile engine combustion, into
electricity.
- http://en.wikipedia.org/wiki/Thermoelectric_effect
Thermoelectric effect
The thermoelectric effect is the direct conversion of temperature differences to electric voltage and vice
versa. A thermoelectric device creates a voltage when there is a different temperature on each side.
Conversely when a voltage is applied to it, it creates a temperature difference (known as the Peltier effect). At
atomic scale (specifically, charge carriers), an applied temperature gradient causes charged carriers in the
material, whether they are electrons or electron holes, to diffuse from the hot side to the cold side, similar to a
classical gas that expands when heated; hence, the thermally induced current.
This effect can be used to generate electricity, to measure temperature, to cool objects, or to heat them or
cook them. Because the direction of heating and cooling is determined by the polarity of the applied voltage,
thermoelectric devices make very convenient temperature controllers.
Traditionally, the term thermoelectric effect or thermoelectricity encompasses three separately identified
effects, the Seebeck effect, the Peltier effect, and the Thomson effect. In many textbooks, thermoelectric
effect may also be called the Peltier–Seebeck effect. This separation derives from the independent
discoveries of French physicist Jean Charles Athanase Peltier and Estonian-German physicist Thomas
Johann Seebeck. Joule heating, the heat that is generated whenever a voltage is applied across a resistive
material, is somewhat related, though it is not generally termed a thermoelectric effect (and it is usually
regarded as being a loss mechanism due to non-ideality in thermoelectric devices). The Peltier–Seebeck and
Thomson effects can in principle be thermodynamically reversible, whereas Joule heating is not.

Seebeck discovered that a compass needle would be deflected when a closed loop was formed of two metals
joined in two places with a temperature difference between the junctions. This is because the metals respond
differently to the temperature difference, which creates a current loop, which produces a magnetic field.
Seebeck, however, at this time did not recognize there was an electric current involved, so he called the
phenomenon the thermomagnetic effect, thinking that the two metals became magnetically polarized by the
temperature gradient. The Danish physicist Hans Christian Ørsted played a vital role in explaining and
conceiving the term "thermoelectricity".
The effect is that a voltage, the thermoelectric EMF, is created in the presence of a temperature difference
between two different metals or semiconductors. This causes a continuous current in the conductors if they
form a complete loop. The voltage created is of the order of several microvolts per kelvin difference. One such
combination, copper-constantan, has a Seebeck coefficient of 41 microvolts per kelvin at room temperature.
□ □ □ □ □
- http://www.ecofan.co.uk/technical-information.html
The Seebeck Effect
The generator module is a unique semiconductor device that relies upon the Seebeck effect to generate
electricity. When two dissimilar semiconductors (p-type and n-type) at the same temperature are connected
together they establish a static electric potential difference. With the introduction of a temperature difference
heat flows across the joined semiconductors which in turn permits electrons to flow. With the electron flow or
current comes the ability to power electrical devices such as the fan's motor.

Seebeck-Thermoelectric
- http://www.artechhouse.com/GetBlob.aspx?strName=Beeby-718_CH05.pdf
Thermoelectric Energy Harvesting
Gao Min - Cardiff University, United Kingdom
Thermoelectric module. (a) Schematic diagram of a thermoelectric module. (b) Crosssectional
view of a thermoelectric module which consists of a number of n- and p-type thermocouples
connected electrically in series but thermally in parallel and sandwiched between two ceramic
plates.
Low Power Systems
Advance in modern microelectronics has led to a significant reduction in the power level requirement.
Modern-day remote wireless sensors can operate at a power level of about 130 µW. A quartz digital
wristwatch requires merely 20 to 40 µW.
At such a power level, it is possible to use thermoelectric devices to harvest ambient heat for powering
remote sensor networks or mobile devices. This eliminates the needs for replacing batteries or for
lengthy cabling from central power sources. A particularly attractive feature of thermoelectric devices is
their ability to generate electricity from body heat that could power medical implants, personal wireless
devices, or other consumer electronics. A successful example in this attempt is the thermoelectric
wristwatch developed by Seiko and Citizen.
Figure below shows a schematic cross-section of a thermoelectric watch. A miniature thermoelectric
converter that consists of 2,268 pairs of Bi2Te3 thermocouples is mounted on the bottom case of the
watch. It produces on average 25 µW of electricity from a temperature difference of 2–3K generated by
body heat. The conversion efficiency is about 0.1% (compared with the corresponding Carnot efficiency
of 0.66%).
Although it is technologically successful, its commercialization has been restricted mainly due to the cost
of the thermoelectric converter employed. In a normal environment, the temperature difference between
human body and ambient is around 5–10K. The rate of heat generation for an average human body is
typically around 100W. Using such data, the power output that can be harvested using a thermoelectric
device is estimated to be 20–50 µW/cm2.
This indicates that the power of about 2–5 mW may be obtained with a realistic surface area of 0.1 m2
(equivalent to an area of 40 cm × 25 cm) that enables heat extraction from a body without causing
significant inconvenience or discomfort. Such a power level is sufficient for some low-power applications.

A schematic diagram of thermoelectric wristwatch. A miniature thermoelectric converter
is placed on the bottom case of the watch.
- http://www.jcwa.or.jp/eng/knowledge/tech/tech04.html
Thermal generating system watches
- http://www.media.mit.edu/resenv/pubs/books/Starner-Paradiso-CRC.1.452.pdf
Human Generated Power for Mobile Electronics
Thad Starner Joseph A. Paradiso
GVU Center, College of Computing Responsive Environments Group, Media Laboratory
Georgia Tech MIT
Atlanta, GA 30332-0280 Cambridge, MA 02139
Power from Body Heat
Activity Kilocal/hr Watts
sleeping 70 81
lying quietly 80 93
sitting 100 116
standing at ease 110 128
conversation 110 128
eating meal 110 128
strolling 140 163
driving car 140 163
playing violin or piano 140 163
housekeeping 150 175
carpentry 230 268
hiking, 4 mph 350 407
swimming 500 582
mountain climbing 600 698
long distance run 900 1,048
sprinting 1,400 1,630
Human energy expenditures for selected activities.
Derived from: D. Morton. Human Locomotion and Body Form. The Williams & Wilkins Co., Baltimore, MD, 1952.
Table indicates that while sitting, a total of 116W of power is available. Using a Carnot engine to model the
recoverable energy yields 3.7-6.4Wof power. In more extreme temperature differences, higher efficiencies
may be achieved, but robbing the user of heat in adverse environmental temperatures is not practical.
Evaporative heat loss from humans account for 25% of their total heat dissipation (basal, non-sweating) even
under the best of conditions. This “insensible perspiration” consists of water diffusing through the skin, sweat
glands keeping the skin of the palms and soles pliable, and the expulsion of water-saturated air from the

lungs. Thus, the maximum power available without trying to reclaim heat expended by the latent heat of
vaporization drops to 2.8-4.8W.
The above efficiencies assume that all of the heat radiated by the body is captured and perfectly transformed
into power.
However, such a system would encapsulate the user in something similar to a wetsuit. The reduced
temperature at the location of the heat exchanger would cause the body to restrict blood flow to that area.
When the skin surface encounters cold air, a rapid constriction of the blood vessels in the skin allows the skin
temperature to approach the temperature of the interface so that heat exchange is reduced. This self-
regulation causes the location of the heat pump to become the coolest part of the body, further diminishing the
returns of the Carnot engine unless a wetsuit is employed as part of the design.
While a full wetsuit or even a torso body suit is unsuitable for many applications, the neck offers a good
location for a tight seal, access to major centers of blood flow, and easy removal by the user. The neck is
approximately 1/15 of the surface area of the “core” region (those parts that the body tries to keep warm at all
times). As a rough estimate, assuming even heat dissipation over the body, a maximum of 0.20-0.32W could
be recovered conveniently by such a neck brace. The head may also be a convenient heat source for some
applications where protective hoods are already in place - the head is also a very convenient spot for coupling
sensory input to the user. The surface area of the head is approximately three times that of the neck and could
provide 0.60-0.96W of power given optimal conversion. Even so, the practicality, comfort, and efficacy of such
a system are relatively limited.
Even given all the limitations mentioned above, practical body-worn, thermally-powered systems have been
created.
The Seiko Thermic wristwatch uses 10 thermoelectric modules to generate sufficient simbolo mu microW to
run its mechanical clock movement from the small thermal gradient provided by body heat over ambient
temperature.
Possible power recovery from body-centered sources.
Total power for each action is included in parentheses.
□ □ □ □ □

Fraunhofer Institute
- http://www.fraunhofer.de/EN/press/pi/2007/08/Researchnews82007Topic1.jsp
Electricity from body heat
In collaboration with colleagues from the Fraunhofer Institute for Physical Measurement Techniques IPM and
the Fraunhofer Institute for Manufacturing Engineering and Applied Materials Research IFAM, research
scientists at the Fraunhofer Institute for Integrated Circuits IIS in Erlangen have developed a way of
harnessing natural body heat to generate electricity. It works on the principle of thermoelectric generators,
TEG for short, made from semiconductor elements.
© 4/2008 Fraunhofer-Gesellschaft
- http://bme240.eng.uci.edu/students/08s/rogers/Heat.html
Thermoelectrics
Introduction:
Scientists of the Fraunhofer Society, as well as the company Biophan, are exploring devices and
semiconductor materials for the generation of electricity from small temperature gradients in the body. Up to
5°C of difference can be found across certain parts of the body, such as between the skin and the
environment. As far back as 1998, the feasibility of scavenging power from this source was proven for non-
biomedical applications by Japanese watch company Seiko, which introduced a "Thermic" wristwatch that ran
on heat from the skin.
Device Design:
In the medical field, Biophan hopes to extend the operating life of small implants by continuously recharging
them with a bismuth telluride semiconductor-based thermoelectric energy-scavenger. Pacemakers, for
example, might have their lives extended from one decade to three by this method once the device is
perfected, and lower-power devices might even run indefinitely. The company's goal is to produce a device
that will be able to generate 100 µW at 4 V in a slim package about 1 inch squared, comparable in size to
current Li-ion pacemaker batteries.

□ □ □ □ □
Fujitsu
- http://www.fujitsu.com/global/news/pr/archives/month/2010/20101209-01.html
Fujitsu Develops Hybrid Energy Harvesting Device for Generating Electricity from Heat and Light
Kawasaki, Japan, December 9, 2010 — Fujitsu Laboratories Ltd. today announced that it has developed a new hybrid
energy harvesting device that generates electricity from either heat or light. With this single device, it is
possible to derive energy from two separate sources, which previously could only be handled by combining
individual devices. Furthermore, because the cost of the hybrid device is economical, this technology paves
the way to the widespread use of highly efficient energy harvesting devices. The new technology has great
potential in the area of energy harvesting, which converts energy from the surrounding environment to
electricity. Since there is no need for electrical wiring or battery replacements, this development could enable
the use of sensors in previously unserved applications and regions. It also has great potential for powering a
variety of sensor networks and medical-sensing technologies.
About Energy Harvesting
Energy harvesting is the process for collecting energy from the surrounding environment and converting it to
electricity, and is gaining interest as a future next-generation energy source. Conventionally, electricity is
supplied by either a power plant or a battery, requiring electrical wiring and replacement batteries. In recent
years, the idea of using ambient energy in the forms of light, vibration, heat, radio waves, etc. has become
increasingly attractive, and a number of methods to produce electricity from these different kinds of energy
sources have been developed. Energy harvesting technology would eliminate the need for replacing batteries
and power cords.

Overview of energy harvesting
Technological Challenges
Since the amount of power available by energy harvesting is quite limited, there has been interest in utilizing
multiple forms of external energy simultaneously - such as light and heat, or light and vibrations - in order to
collect a sufficient amount for practical use. In the past, this has been achieved by combining different kinds of
devices, which leads to higher costs.
Newly-developed Technology
Fujitsu Laboratories has developed a new hybrid harvesting device that captures energy from either light or
heat, which are the most typical forms of ambient energy available for wide-scope application. This makes it
possible for a single device to capture energy from either heat or light without combining two harvesting
devices. In addition, as it can be manufactured from inexpensive organic materials, device production costs
can remain low
Details of the new technology are as follows.
1. New structure for hybrid generating devices
By changing the electrical circuits connecting two types of semiconductor materials - P-type and N-type
semiconductors - the device can function as a photovoltaic cell or thermoelectric generator (Figure below).
2. Development of an organic material for hybrid generating devices
Fujitsu Laboratories successfully developed an organic material that is suitable for a generator in both
photovoltaic and thermoelectric modes. The organic material features a high generating efficiency that can
produce power from even indoor lighting in photovoltaic mode, and it can also generate power from heat in
thermoelectric mode. Since the organic material and its process cost are inexpensive, production costs can be
greatly reduced.
Single device featuring operation in both photovoltaic mode (left) and thermoelectric mode (right)

Results
Until now, photovoltaic cells - which generate electricity from light, and thermoelectric devices - which
generate electricity from temperature differentials, have only been available as separate devices. This new
technology from Fujitsu Laboratories doubles the energy-capture potential through the use of both ambient
heat and light in a single device. In medical fields, for example, the technology could be used in sensors that
monitor conditions such as body temperature, blood pressure, and heartbeats - without batteries and electrical
wiring. If either the ambient light or heat is not sufficient to power the sensor, this technology can supply power
with both sources, by augmenting one source with the other. In addition, the technology can also be used for
environmental sensing in remote areas for weather forecasting, where it would be problematic to replace
batteries or run electric lines.
Prototype hybrid generating device manufactured on flexible substrate
□ □ □ □ □
- http://www.forbes.com/2010/06/07/nanotech-body-heat-technology-breakthroughs-devices.html
Turning Body Heat Into Electricity
Osman Can Ozcanli, August 2010
Developments in nano-engineering could unleash new body-powered devices.
The idea of converting the human body's energy into electricity has tantalized scientists for years. A resting
male can put out between 100 and 120 watts of energy, in theory enough to power many of the electronics
you use, such as your Nintendo Wii (14 watts), your cellphone (about 1 watt) and your laptop (45 watts).
Eighty percent of body power is given off as excess heat. But only in sci-fi fantasies such as the Matrix film
series do you see complete capture of this reliable power source.
Current technology for converting body heat into electricity is capable of producing only a few milliwatts (one
thousandth of a Watt), which is enough for small things such as heart rate monitors and watches. Some
people fondly remember Seiko's Thermic watch, which runs continuously off body heat on 1 microwatt (one-
millionth of a watt). It debuted in 1998 to rave reviews, but Seiko produced only 500 units before discontinuing
it. If you own a Seiko Thermic, you never have to worry about changing batteries as long as your environment
is cooler than your body.
Recent developments in nanotechnology engineering promise to usher in lots more body-powered devices.
The basic technology behind the concept of turning body heat into electricity is a thermoelectric device. It is
usually a thin conductive material that exploits the temperature difference between its two sides to generate
electricity, known as the Seebeck effect. Such devices can work in reverse, meaning if you were to apply
electricity to the device, one side would get extremely cold and the other extremely hot. If you own a USB-
powered drink chiller, you probably own a thermoelectric generator--only working in reverse. The same idea is
also used in cooling some computers.

A thermoelectric device placed on skin will generate power as long as the ambient air is at a lower
temperature than the body. A patch of material one square centimeter in area can produce up to 30
microwatts. Place these generators side by side to multiply the amount of power being harvested.
In 2006 Vladimir Leonov and Ruud J.M. Vullers from Belgium built a working prototype of a blood oxygen
sensor, or pulse oxymeter, powered with body heat. It was about the size of a watch and was successfully
tested on patients. It generated about 100 microwatts while the patient was asleep and up to 600 microwatts
when awake and active. The group had to design the device so it could work with a record low power of 62
microwatts vs. commercially available 10-milliwatt pulse oxymeters.
In 2007 the duo built a body-heat powered electroencephalograph device that monitored brain activity. Leonov
and Vullers started by redesigning the EEG device so it consumed less power. The EEG had to wirelessly
transmit real-time data to a computer, too, so it had to consume a lot more power than their first prototype.
The 50-square-centimeter prototype was placed on the forehead of a person and harvested 3,500 microwatts,
which was great, but came with a side effect: With so much area covered with thermoelectric devices sucking
the heat, the sensation of cold became overwhelming to the patient.
The following year, the duo added photovoltaic cells to the top of the device to harvest solar power to offset
some of the thermoelectric generation and make the device less chilly for the patient.
Next, they built a body-heat powered electrocardiograph device (EKG) that monitored heart activity. This time,
they built the system as a washable shirt. In previous prototypes they used a super capacitor, which worked
well. But when the capacitor was charged, it would waste any extra energy available from the thermoelectric
device. In the shirt prototype they used a secondary battery as a storage device that constantly recharged
using body heat. That cut out the waste and enabled them to shrink the device even more. Combining other
forms of generation with smart storage systems will likely be the ways that body-heat- powered devices
become practical.
At MIT, researchers are working on improving the efficiency of the circuitry that harnesses the minute amounts
of power generated by standard thermoelectric generators. Scientists Anantha Chandrakasan, director of
MIT's Microsystems Technology Laboratories, and his colleague Yogesh Ramadass have created extremely
efficient circuitry in an EKG sensor with a built-in processor and wireless radio.

There's even greater potential in improving the efficiency of thermoelectric generators. Currently, a
thermoelectric generator currently can only convert 0.4% of the heat energy into usable electrical power. With
this efficiency, if you were to cover all of your body with thermoelectric generators you could produce 0.5
Watts of energy. This would feel extremely cold and would hardly be enough to power a cellphone. There is
research being done by the U.S. Department of Energy and the University of California-Berkeley on
developing more efficient thermoelectric generators.
MIT Professor Peter Hagelstein published a paper in November that showed a way to improve the efficiency of
thermoelectric generators by up to 4 times in practice and up to 9 times in theory. Devices with that kind of
efficiency could be used anywhere there is wasted heat--on the walls of power plants or lining the hoods of
automobiles. A company that is closely related to MIT, MTPV, is starting to work on commercializing
Hagelstein's ideas.
- http://medgadget.com/archives/2007/10/wireless_eeg_powered_by_body_heat.html
October 2007
Wireless EEG Powered by Body Heat
This autonomous electroencephalogram system, powered by body heat, is another interesting device
developed by the IMEC, a Belgium/Netherlands nanotechnologies research center.
Here's more about this prototype's technology:

The entire system is wearable and integrated into a headband. The small size, low power consumption of
only 0.8mW and autonomous operation increase the patient's autonomy and quality of life. Potential
applications are detection of imbalance between the two halves of the brain, detection of certain kinds of
brain trauma and monitoring of brain activity.
The EEG system uses IMEC's proprietary ultra-low power biopotential readout ASIC to extract high-quality
EEG signals with micro-power consumption. A low-power digital signal-processing block encodes the
extracted EEG data which is sent to a PC via a 2.4GHz wireless radio. The whole system consumes only
0.8mW.
The thermoelectric generator is mounted on the forehead and converts the heat flow between the skin and
air into electrical power. The generator is composed of 10 thermoelectric units interconnected in a flexible
way. At room temperature, the generated power is about 2-2.5mW or 0.03mW/cm2 which is the theoretical
limit of power generation on human skin. Higher power generation would cause an uncomfortable sense of
cold. The EEG system is operational in less than one minute after switching on the device.
Future research targets further reduction of the power consumption of the different system components
including the radio and processor. Also, a semiconductor process for manufacturing thermopiles is under
development. This will allow a significant reduction of the production cost.
- http://www.research.a-star.edu.sg/research/6218
Microfabrication: The power of heat
Published online September 2010

- http://technicalstudies.youngester.com/2010/06/paper-electricity-generated-by-human.html
Electricity Generated by Human Body
A resting male can put out between 100 and 120 watts of energy, in theory enough to power many of the
electronics you use, such as your Nintendo Wii (14 watts), your cellphone (about 1 watt) and your laptop (45
watts). Eighty percent of body power is given off as excess heat.
…. A thermoelectric device placed on skin will generate power as long as the ambient air is at a lower
temperature than the body. A patch of material one square centimeter in area can produce up to 30
microwatts. Place these generators side by side to multiply the amount of power being harvested.
…. A human body constantly generates heat as a useful side effect of metabolism. However, only a part of this
heat is dissipated into the ambient as a heat flow and infrared radiation, the rest of it is rejected in a form of
water vapor. Furthermore, only a small fraction of the heat flow can be used in a wearer’s friendly and
unobtrusive energy scavenger. (For example, nobody would accept a large device on his/her face. Therefore,
the heat flow from it practically cannot be used.) At last, due to the laws of thermodynamics, the heat flow
cannot be effectively converted it into electricity. However, a human being generates more than 100 W of heat;
therefore, a quite useful electrical power still can be obtained using a person as a heat generator. The tool for
converting heat flow into electricity is a thermoelectric generator (TEG), the heart of which is a thermopile.
Typically, only a few watts of heat flow can be harvested unobtrusively on a person and thermoelectrically
converted into several milliwatts in a form of electricity. If we recall that watches consume 1000 times less, it is
fairly good power. Moreover, PV cells of the same area typically generate much less power because not much
light is available indoors, where the authors and the reader of this paper are resting now.
The human body is not a perfect heat generator as a heat supply for a wearable TEG. The body has high
thermal resistance; therefore, the heat flow is quite limited. This is explained by the fact that warm-blooded
animals have received in the process of evolution a very effective thermal management. This includes a very
high thermal resistance of the body at ambient temperatures below 20–25 °C if the skin temperature
decreases below thermal comfort.1,2 As a result, not much heat is dissipated from the skin and only about 3–5
mW/cm2 is available indoors, on average.

Wireless EEG System Self-Powered By Body Heat And Light
ScienceDaily (April 2008)
- http://www.ecofriend.org/entry/texas-instruments-to-manufacture-chips-powered-by-body-heat
Texas Instruments to manufacture chips powered by body heat
Arpita Mukherjee | Feb 2008
Imagine the day that will come when in order to recharge the batteries of your mobile phone you only have to
hold it in your grasp for a few minutes saving a bit of your electricity bill. This is exactly what will be achieved
by a new concept chip designed by Texas Instruments. The energy efficient chip is capable of functioning at
0.3 volts of energy that can be provided by any small heat source; even by body heat. This chip is expected to
lengthen the life span of batteries in mobile phones, implantable medical devices and sensors.
The energy efficient chip is the handiwork of Joyce Kwong, a graduate student of MIT and Professor Anantha
Chandrakasan of MIT, will be ready for commercial application within the next five years. To enable the chip to
work at 0.3V energy the memory and logic circuits currently prevalent with the existing 1V chips need to be
redesigned. Instead of using a separate converter, there will be an inbuilt DC-to-DC converter that would help
to reduce the voltage. It is a challenge to researchers to develop chips capable of functioning at low power as
at very low power levels the imperfections in the silicon become more apparent.
- http://www.gizmowatch.com/entry/electricity-from-body-heat-ultimate-solution-for-power-hungry-gizmos/
Electricity from body heat - Ultimate solution for power-hungry gizmos
Bharat | August 2007

Piezoelectric
- http://www.memsinvestorjournal.com/2010/04/microstructured-piezoelectric-shoe-power-generator-outperforms-batteries.html
Microstructured piezoelectric shoe power generator outperforms batteries
by Ville Kaajakari, Ph.D. Assistant Professor, Louisiana Tech University
Energy harvesting is an attractive way to power MEMS sensors and locator devices such as GPS; however,
the power harvesting technologies often fall short in terms of power output. For example, vibratory MEMS
generators might give out only microwatts of electrical power. While this may be sufficient for emerging ultra
low power sensors, many current applications require milliwatt power levels. As an example, commercially
available running sensors for shoes consume over 100 uW of electrical power and requirements for GPS
locators are even higher.
Piezoelectric transducers generate electrical charge when compressed. This makes piezoelectric materials
especially advantageous for power harvesting as they do not require bias voltage for operation. In principle, a
piezoelectric transducer together with two rectifying diodes is sufficient for generating dc output voltage.
The shoe power generator that our group has developed is based on a low-cost polymer transducer that has
metallized surfaces for electrical contact. Unlike the conventional ceramic transducers, the plastic-based
generator is soft and robust matching the properties of regular shoe fillings. The transducer can therefore
replace the regular heel shock absorber with no loss in user experience.
A significant challenge in harvesting piezoelectric energy is that piezoelectic materials are optimal for
generating high voltages but provide only a low current output. The polymer used in the shoe transducer
provides over 5 mJ of energy per step but at voltages too large (>50 V) to be directly used in low power
sensors. A breakthrough in piezoelectric power generation is the new voltage regulation circuits that we
developed at Louisiana Tech University that efficiently converts the piezoelectric charge into a usable voltage.
A conversion circuit coverts the high voltage to a regulated 3 V output for charging batteries or for directly
powering electronics at better than 70% conversion efficiency. Combined with the polymer transducer, the
regulation circuit gives time-averaged power of 2 mW per shoe during a regular walk.
The generated power output can be compared to typical storage capacity of 30 mAh for lithium coin/button
cells -- with an average current consumption 0.5 mA, a miniature coin cell is depleted in less than three days
whereas the shoe power generator gives power output as long as the user keeps walking. The total energy
output can therefore easily surpass conventional batteries. In addition to running sensors and inertial
navigation, the show power generator can be used to power RF transponders, GPS receivers, and locator
tags that require a milliwatt power source.
- http://www.explainthatstuff.com/piezoelectricity.html
Text copyright © Chris Woodford 2009. All rights reserved.
Piezoelectricity
You've probably used piezoelectricity (pronounced "pee-ay-zo-electricity") quite a few times today. If you've
got a quartz watch, piezoelectricity is what helps it keep regular time. If you've been writing a letter or an essay
on your computer with the help of voice recognition software, the microphone you spoke into probably used
piezoelectricity to turn the sound energy in your voice into electrical signals your computer could interpret. If
you're a bit of an audiophile and like listening to music on vinyl, your gramophone would have been using
piezoelectricity to "read" the sounds from your LP records. Piezoelectricity (literally, "pressing electricity") is
much simpler than it sounds: it just means using crystals to convert mechanical energy into electricity or vice-
versa. Let's take a closer look at how it works and why it's so useful!

What is piezoelectricity?
Squeeze certain crystals (such as quartz) and you can make electricity flow through them. The reverse is
usually true as well: if you pass electricity through the same crystals, they "squeeze themselves" by vibrating
back and forth. That's pretty much piezoelectricity in a nutshell but, for the sake of science, let's have a formal
definition:
Piezoelectricity (also called the piezoelectric effect) is the appearance of an electrical potential (a voltage, in
other words) across the sides of a crystal when you subject it to mechanical stress (by squeezing it).
In practice, the crystal becomes a kind of tiny battery with a positive charge on one face and a negative charge
on the opposite face; current flows if we connect the two faces together to make a circuit. In the reverse
piezoelectric electric, a crystal becomes mechanically stressed (deformed in shape) when a voltage is applied
across its opposite faces.
What causes piezoelectricity?
What scientists mean by a crystal: the regular, repeating arrangement of atoms in a solid. The atoms are essentially fixed in place but can
vibrate slightly.
Think of a crystal and you probably picture balls (atoms) mounted on bars (the bonds that hold them together),
a bit like a climbing frame. Now, by crystals, scientists don't necessarily mean intriguing bits of rock you find in
gift shops: a crystal is the scientific name for any solid whose atoms or molecules are arranged in a very
orderly way based on endless repetitions of the same basic atomic building block (called the unit cell). So a
lump of iron is just as much of a crystal as a piece of quartz. In a crystal, what we have is actually less like a
climbing frame (which doesn't necessarily have an orderly, repeating structure) and more like three-
dimensional, patterned wallpaper.
Quartz—probably the best known piezoelectric material. Photo by courtesy of US Geological Survey.
In most crystals (such as metals), the unit cell (the basic repeating unit) is symmetrical; in piezoelectric
crystals, it isn't. Normally, piezoelectric crystals are electrically neutral: the atoms inside them may not be
symmetrically arranged, but their electrical charges are perfectly balanced: a positive charge in one place
cancels out a negative charge nearby. However, if you squeeze or stretch a piezoelectric crystal, you deform
the structure, pushing some of the atoms closer together or further apart, upsetting the balance of positive and
negative, and causing net electrical charges to appear. This effect carries through the whole structure so net
positive and negative charges appear on opposite, outer faces of the crystal.
The reverse-piezoelectric effect occurs in the opposite way. Put a voltage across a piezoelectric crystal and
you're subjecting the atoms inside it to "electrical pressure." They have to move to rebalance themselves—and

that's what causes piezoelectric crystals to deform (slightly change shape) when you put a voltage across
them.
How piezoelectricity works
1. Normally, the charges in a piezoelectric crystal are exactly balanced, even if they're not symmetrically
arranged.
2. The effects of the charges exactly cancel out, leaving no net charge on the crystal faces. (More
specifically, the electric dipole moments—vector lines separating opposite charges—exactly cancel
one another out.)
3. If you squeeze the crystal you force the charges out of balance.
4. Now the effects of the charges (their dipole moments) no longer cancel one another out and net
positive and negative charges appear on opposite crystal faces. By squeezing the crystal, you've
produced a voltage across its opposite faces—and that's piezoelectricity!

Nanowires
- http://www.nature.com/nature/journal/v451/n7175/abs/nature06381.html
Enhanced thermoelectric performance of rough silicon nanowires
Nature 451, 163-167 (10 January 2008) | doi:10.1038/nature06381; Received 7 June 2007; Accepted 9 October 2007
Allon I. Hochbaum1,5
, Renkun Chen2,5
, Raul Diaz Delgado1
, Wenjie Liang1
, Erik C. Garnett1
, Mark Najarian3
, Arun Majumdar2,3,4
& Peidong
Yang1,3,4
5. Department of Chemistry,
6. Department of Mechanical Engineering,
7. Department of Materials Science and Engineering, University of California, Berkeley, California 94720, USA
8. Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720, USA
9. These authors contributed equally to this work.
Correspondence to: Arun Majumdar2,3,4
Peidong Yang1,3,4
Correspondence and requests for materials should be addressed to A.M. (Email:
majumdar@me.berkeley.edu) and P.Y. (Email: p_yang@berkeley.edu).
Approximately 90 per cent of the world's power is generated by heat engines that use fossil fuel combustion as
a heat source and typically operate at 30–40 per cent efficiency, such that roughly 15 terawatts of heat is lost
to the environment. Thermoelectric modules could potentially convert part of this low-grade waste heat to
electricity. Their efficiency depends on the thermoelectric figure of merit ZT of their material components,
which is a function of the Seebeck coefficient, electrical resistivity, thermal conductivity and absolute
temperature. Over the past five decades it has been challenging to increase ZT > 1, since the parameters of
ZT are generally interdependent
1
. While nanostructured thermoelectric materials can increase ZT >, the
materials (Bi, Te, Pb, Sb, and Ag) and processes used are not often easy to scale to practically useful
dimensions. Here we report the electrochemical synthesis of large-area, wafer-scale arrays of rough Si
nanowires that are 20–300 nm in diameter. These nanowires have Seebeck coefficient and electrical resistivity
values that are the same as doped bulk Si, but those with diameters of about 50 nm exhibit 100-fold reduction
in thermal conductivity, yielding ZT = 0.6 at room temperature. For such nanowires, the lattice contribution to
thermal conductivity approaches the amorphous limit for Si, which cannot be explained by current theories.
Although bulk Si is a poor thermoelectric material, by greatly reducing thermal conductivity without much
affecting the Seebeck coefficient and electrical resistivity, Si nanowire arrays show promise as high-
performance, scalable thermoelectric materials.
Body Heat To Power Cell Phones? Nanowires Enable Recovery Of Waste Heat Energy
Energy now lost as heat during the production of electricity could be harnessed through the use of silicon
nanowires synthesized via a technique developed by researchers with the U.S. Department of Energy's (DOE)
Lawrence Berkeley National Laboratory (Berkeley Lab) and the University of California (UC) at Berkeley.
- http://spie.org/x20171.xml
Energy harvesting for self-powered nanosystems
Zhong Lin (Z.L.) Wang
Energy from sources such as body movement or blood flow is converted to electrical energy by
deforming piezoelectric semiconducting nanowires.
25 March 2008, SPIE Newsroom. DOI: 10.1117/2.1200801.1040
Developing novel technologies for wireless nanodevices and nanosystems is of critical importance for in situ,
real-time and implantable biosensing and defense applications, and even wearable personal electronics. A
nanodevice requires a power source, which may be provided directly or indirectly by a battery. But it is highly
desirable for wireless devices to be self-powered. That requires exploring innovative nanotechnologies for
converting mechanical, vibration, and hydraulic energy into electric energy for battery-free nanodevices.

We have demonstrated an innovative approach for converting mechanical energy into electricity using
piezoelectric zinc oxide (ZnO) nanowires that can be grown on any substrate (e.g., metals, ceramics,
polymers, and textile fibers) of any shape.
Schematic diagram showing the DC nanogenerator built using aligned ZnO nanowire arrays with a zigzag top
electrode. The nanogenerator is driven by an external ultrasonic wave or mechanical vibration, and the output
current is continuous. The lower plot is the output from a nanogenerator with the ultrasonic wave on and off.
The output current reached 600nA for a 3mm
2
nanogenerator.
The principle and technology demonstrated here have the potential to convert energy from mechanical
movement (such as body motion, muscle stretching, and blood pressure), vibrations (such as acoustic and
ultrasonic waves), and hydraulic movement (such as flow of body fluid and blood, or contraction of blood
vessels) into electrical energy to power nanodevices and nanosystems. Relevant applications include
implantable biosensing, wireless and remote sensing, nanorobotics, microelectromechanical systems, and
sonic wave detection.
This research was supported by the National Science Foundation, NASA, the Defense Research Projects
Agency, and the National Institutes of Health. Thanks to Xudong Wang, Jinhui Song, and Jin Liu for their
contribution.

- http://gtresearchnews.gatech.edu/self-powered-nanosensors/
Self-Powered Nanosensors: Researchers Use Improved Nanogenerators to Power Sensors Based on
Zinc Oxide Nanowires
Writer: John Toon - Georgia Institute of Technology
By combining a new generation of piezoelectric nanogenerators with two types of nanowire sensors,
researchers have created what are believed to be the first self-powered nanometer-scale sensing devices that
draw power from the conversion of mechanical energy. The new devices can measure the pH of liquids or
detect the presence of ultraviolet light using electrical current produced from mechanical energy in the
environment.
Figure shows (a) Fabrication of a vertical-nanowire integrated nanogenerator (VING), (b) Design of a lateral-
nannowire integrated nanogenerator (LING) array, (c) Scanning electron microscope image of a row of
laterally-grown zinc oxide nanowire arrays, and (d) Image of the LING structure. (Click image for high-
resolution version. Credit: Zhong Lin Wang)
The alternating current output of the nanogenerators depends on the amount of strain applied. “At a strain
rate of less than two percent per second, we can produce output voltage of 1.2 volts,” said Wang. “The power
output is matched with the external load.”
Lateral nanogenerators integrating 700 rows of zinc oxide nanowires produced a peak voltage of 1.26 volts at
a strain of 0.19 percent. In a separate nanogenerator, vertical integration of three layers of zinc oxide
nanowire arrays produced a peak power density of 2.7 milliwatts per cubic centimeter.

PPrriinntteedd MMeemmoorryy
http://www.thinfilm.se/news/38-press-releases/220-thinfilm-works-with-parc-to-develop-next-generation-printed-memory-solutions
Thinfilm Works with PARC to Develop Next-Generation Printed Memory Solutions
November 4th, 2010
Thinfilm (Thin Film Electronics ASA), a provider of advanced printed memory technology, and PARC (Palo
Alto Research Center Incorporated), a premier center for commercial innovation, today announced that they
are working together to provide next-generation memory technology enabled through printed electronics.
- http://www.thinfilm.se/about-us/technology-overview
Thinfilm’s technology is based on using a ferroelectric polymer as the functional memory material sandwiched
between two sets of electrodes in a passive matrix – each crossing of metal lines defines a memory cell.
The memory function is based on an intrinsic mechanism related to orientation of the polymer chains. The
polymer chains can be oriented in two different ways representing “0” and “1”. Each state is stable without
application of an external field which means that information in the memory will not be lost when the power is
turned off. This is referred to as a non-volatile memory. The intrinsic character of the polymer means that the
technology is extremely scalable. Thinfilm has demonstrated 110 nm cells and shown that no lower limits

could be found. An additional important characteristic of the technology is that it is based on non-toxic
materials. This is very important in realizing our Memory Everywhere
TM
vision
The Thinfilm-patented passive matrix is the “Holy grail” of memory architectures that dispenses with the need
of active circuitry within the memory cell. This enables ultimate packing for high density memories as well as
the possibility to stack memory layers on top of each other. The passive array memory architecture allows the
memory portion to be separate from the read/write electronics enabling stand alone application without
integration with printed logic.
- http://www.thinprofiletech.com/?p=46
Custom Printed Circuits with Embedded Power
The TPT Advantage
Why design the circuit to fit the battery? With the Embedded Power Platform® and TPT’s customizable battery
technology, we design the battery to fit the circuit and its product form factor requirements. By printing the
battery in-line with the circuit, we deliver a more robust solution that delivers more capacity at lower price.
Custom Design and Manufacture
With manual sheet-fed, automatic sheet-fed, and web roll-to-roll presses, TPT can tailor the size of each run to
the opportunity or substrate used, and easily scale up when demand rises. We handle a large variety of
substrates and conductive materials in both sheet and web format. Best of all, as pioneers in the field of
printed electronics, we can put our knowledge and experience to work for you.
Battery Specifications
Property Specification
Battery Chemistry Carbon Zinc
Cathode Manganese Dioxide
Anode Zinc
Voltage 1.5 V, 3.0 V, 4.5 V, 6.0 V
Capacity Up to 2.5 mAh/cm2, depending on formulation and thickness
Self-Discharge <1% per month
Durability and Flexibility ISO 7810 Compliant
Operating Temperature -10°C (15°F) to 60°C (140°F)
Storage Temperature -20°C (-5°F) to 40°C (105°F)
Thickness 0.1 mm (100 microns; 4 mils) to 1.0 mm (1000 microns; 40 mils)
Battery Tab Connection Anisotropic conductive film (ACF) or ultrasonic weld
Form Factor Virtually unlimited
Production Status Mass production

PPPPPPPPrrrrrrrriiiiiiiinnnnnnnntttttttteeeeeeeedddddddd AAAAAAAAnnnnnnnntttttttteeeeeeeennnnnnnnnnnnnnnnaaaaaaaassssssss
- http://www.media.rice.edu/media/NewsBot.asp?MODE=VIEW&ID=13899
Nano-based RFID tag, you're it
Rice, Korean collaboration produces printable tag that could replace bar codes
3/18/2010
RFID tags printed through a new roll-to-roll process could replace bar codes
CREDIT: GYOU-JIN CHO/SUNCHON NATIONAL UNIVERSITY
Rice researchers, in collaboration with a team led by Gyou-jin Cho at Sunchon National University in Korea,
have come up with an inexpensive, printable transmitter that can be invisibly embedded in packaging. It would
allow a customer to walk a cart full of groceries or other goods past a scanner on the way to the car; the
scanner would read all items in the cart at once, total them up and charge the customer's account while
adjusting the store's inventory.
The technology reported in the March issue of the journal IEEE Transactions on Electron Devices is based on
a carbon-nanotube-infused ink for ink-jet printers first developed in the Rice lab of James Tour, the T.T. and
W.F. Chao Chair in Chemistry as well as a professor of mechanical engineering and materials science and of

computer science. The ink is used to make thin-film transistors, a key element in radio-frequency identification
(RFID) tags that can be printed on paper or plastic.
"We are going to a society where RFID is a key player," said Cho, a professor of printed electronics
engineering at Sunchon, who expects the technology to mature in five years. Cho and his team are developing
the electronics as well as the roll-to-roll printing process that, he said, will bring the cost of printing the tags
down to a penny apiece and make them ubiquitous.
Printable RFIDs are practical because they're passive. The tags power up when hit by radio waves at the right
frequency and return the information they contain. "If there's no power source, there's no lifetime limit. When
they receive the RF signal, they emit," Tour said.
Tour allayed concerns about the fate of nanotubes in packaging. _The amount of nanotubes in an RFID tag is
probably less than a picogram. That means you can produce one trillion of them from a gram of nanotubes —
a miniscule amount. Our HiPco reactor produces a gram of nanotubes an hour, and that would be enough to
handle every item in every Walmart.
"In fact, more nanotubes occur naturally in the environment, so it's not even fair to say the risk is minimal. It's
infinitesimal."
- http://www.electroscience.com/smartcardappnotes.html
New Flexible Polymer Silver from ESL ElectroScience
The rapid growth in the use of these devices has necessitated the search for a fast, cost-efficient, seamless
manufacturing route. Reel to reel technology, such as is used in the newspaper industry, is considered to be
faster than traditional methods of handling substrate material. Institutes like Fraunhofer IZM are preparing
smart cards/labels using continuous production lines.
Central to the success of this manufacturing route is the use of polymer based thick-film pastes that can be
screen-printed using specially adapted printers that accept a reel to reel process.
Smart label from the Fraunhofer Institut Zuverlässigkeit und
Mikrointegration (IZM) in Munich, Germany
Fraunhofer IZM reel to reel process
The choice of substrate material allows for relatively high processing temperatures (up to 150 °C for the few
minutes it takes to cure the paste). Line/space resolutions of 200 µm have been achieved quite easily and the
spread in resistance values of tracks printed at this thickness are good. The resistivity of ESL1901-S is 15-20
mΩ/square at a thickness of 25 µm when cured at 80 °C for two hours. The substrate chosen is thee plastic
that is used for credit cards. It may well be that this resistivity is too high for some applications and ESL is
working on a lower-resistivity polymer silver. While silver is the metal that has been chosen to produce the
pioneer product, other metals are being considered for inclusion in a polymer matrix to make a screen-
printable conductor for antennas.
Copyright © 2004-2008 ESL ElectroScience. All rights reserved

WWWWWWWWiiiiiiiirrrrrrrreeeeeeeelllllllleeeeeeeessssssssssssssss tttttttteeeeeeeecccccccchhhhhhhhnnnnnnnnoooooooollllllllooooooooggggggggiiiiiiiieeeeeeeessssssss
Wi-Fi
- http://en.wikipedia.org/wiki/Wi-Fi
Wi-Fi is the trade name for a popular wireless technology used in home networks, mobile phones, video
games and more.
Wi-Fi networks have limited range. A typical Wi-Fi home router using 802.11b or 802.11g with a stock antenna
might have a range of 32 m (120 ft) indoors and 95 m (300 ft) outdoors. Range also varies with frequency
band. Wi-Fi in the 2.4 GHz frequency block has slightly better range than Wi-Fi in the 5 GHz frequency block.
Outdoor range with improved (directional) antennas can be several kilometres or more with line-of-sight.
Wi-Fi performance decreases roughly quadratically as the range increases at constant radiation levels.
802.11 network standards
Approximate indoor
range
Approximate Outdoor
range
802.11
Protoco
l
Freq.
(GHz)
Bandwidth
(MHz)
Data rate per stream
(Mbit/s)
Modulation
(m) (ft) (m) (ft)
– 2.4 20 1, 2 DSSS, FHSS 20 66 100 330
5 35 115 120 390
a
3.7[y]
20
6, 9, 12, 18, 24, 36, 48,
54
OFDM
-- -- 5,000 16,000
b 2.4 20 5.5, 11 DSSS 38 125 140 460
g 2.4 20
6, 9, 12, 18, 24, 36, 48,
54
OFDM, DSSS 38 125 140 460
20
7.2, 14.4, 21.7, 28.9,
43.3, 57.8, 65, 72.2[z]
70 230 250 820
n 2.4/5
40
15, 30, 45, 60, 90, 120,
135, 150[z]
OFDM
70 230 250 820
• y
IEEE 802.11y-2008 extended operation of 802.11a to the licensed 3.7 GHz band. Increased power limits allow a range up
to 5000m. As of 2009[update], it is only being licensed in the United States by the FCC.
• z
Assumes Short Guard interval (SGI) enabled, otherwise reduce each data rate by 10%.
WiMAX
- http://en.wikipedia.org/wiki/WiMax
WiMAX, the Worldwide Interoperability for Microwave Access, is a telecommunications technology that
provides wireless data in a variety of ways, from point-to-point links to full mobile cellular type access. It is
based on the IEEE 802.16 standard, which is also called WirelessMAN.
WiMAX is a term coined to describe standard, interoperable implementations of IEEE 802.16 wireless
networks, similar to the way the term Wi-Fi is used for interoperable implementations of the IEEE 802.11
Wireless LAN standard. However, WiMAX is very different from Wi-Fi in the way it works.
A commonly-held misconception is that WiMAX will deliver 70 Mbit/s over 50 kilometers. In reality, WiMAX can
do one or the other — operating over maximum range (50 km) increases bit error rate and thus must use a
lower bitrate. Lowering the range allows a device to operate at higher bitrates.
Typically, fixed WiMAX networks have a higher-gain directional antenna installed near the client (customer)
which results in greatly increased range and throughput. Mobile WiMAX networks are usually made of indoor
"customer premises equipment" (CPE) such as desktop modems, laptops with integrated Mobile WiMAX or
other Mobile WiMAX devices. Mobile WiMAX devices typically have an omni-directional antenna which is of
lower-gain compared to directional antennas but are more portable. In practice, this means that in a line-of-
sight environment with a portable Mobile WiMAX CPE, speeds of 10 Mbit/s at 10 km could be delivered.
However, in urban environments they may not have line-of-sight and therefore users may only receive 10
Mbit/s over 2 km. In current deployments, throughputs are often closer to 2 Mbit/s symmetric at 10 km with
fixed WiMAX and a high gain antenna. It is also important to consider that a throughput of 2 Mbit/s can mean 2

Mbit/s, symmetric simultaneously, 1 Mbit/s symmetric or some asymmetric mix (e.g. 0.5 Mbit/s downlink and
1.5 Mbit/s uplink or 1.5 Mbit/s downlink and 0.5 Mbit/s uplink, each of which required slightly different network
equipment and configurations. Higher-gain directional antennas can be used with a Mobile WiMAX network
with range and throughput benefits but the obvious loss of practical mobility.
Comparison with Wi-Fi
Comparisons and confusion between WiMAX and Wi-Fi are frequent, possibly because both begin with the
same two letters, are based upon IEEE standards beginning with "802.", and both have a connection to
wireless connectivity and the Internet. Despite this, the two standards are aimed at different applications.
· WiMAX is a long-range system, covering many kilometers that typically uses licensed spectrum
(although it is possible to use unlicensed spectrum) to deliver a point-to-point connection to the
Internet from an ISP to an end user. Different 802.16 standards provide different types of access, from
mobile (similar to data access via a cellphone) to fixed (an alternative to wired access, where the end
user's wireless termination point is fixed in location.)
· Wi-Fi is a shorter range system, typically tens of meters, that uses unlicensed spectrum to provide
access to a network, typically covering only the network operator's own property. Typically Wi-Fi is
used by an end user to access their own network, which may or may not be connected to the Internet.
If WiMAX provides services analogous to a cellphone, Wi-Fi is more analogous to a cordless phone.
It's important to note, however, that free community wi-fi networks have shown that with proper
antennas, wi-fi can have very long ranges.
· WiMAX and Wi-Fi have quite different Quality of Service (QoS) mechanisms. WiMAX uses a
mechanism based on setting up connections between the Base Station and the user device. Each
connection is based on specific scheduling algorithms, which means that QoS parameters can be
guaranteed for each flow. Wi-Fi has introduced a QoS mechanism similar to fixed Ethernet, where
packets can receive different priorities based on their tags. This means that QoS is relative between
packets/flows, as opposed to guaranteed.
· WiMAX is highly scalable from what are called "femto"-scale remote stations to multi-sector 'maxi'
scale base that handle complex tasks of management and mobile handoff functions and include
MIMO-AAS smart antenna subsystems.
Due to the ease and low cost with which Wi-Fi can be deployed, it is sometimes used to provide Internet
access to third parties within a single room or building available to the provider, often informally, and
sometimes as part of a business relationship. For example, many coffee shops, hotels, and transportation
hubs contain Wi-Fi access points providing access to the Internet for customers.
Bluetooth™
- http://en.wikipedia.org/wiki/Bluetooth
Bluetooth is a wireless protocol utilizing short-range communications technology facilitating data transmission
over short distances from fixed and/or mobile devices, creating wireless personal area networks (PANs).
Maximum Permitted Power
mW(dBm)
Range (approximate)
Class 1 100 mW (20 dBm) ~100 meters
Class 2 2.5 mW (4 dBm) ~10 meters
Class 3 1 mW (0 dBm) ~1 meter
In most cases the effective range of class 2 devices is extended if they connect to a class 1 transceiver,
compared to pure class 2 network. This is accomplished by the higher sensitivity and transmission power of
Class 1 devices.
Version Data Rate
Version 1.2 1 Mbit/s
Version 2.0 + EDR 3 Mbit/s
WiMedia Alliance
(proposed)
53 - 480 Mbit/s

RFID
- http://en.wikipedia.org/wiki/RFID
Radio-frequency identification (RFID) is an automatic identification method, relying on storing and remotely
retrieving data using devices called RFID tags or transponders.
An RFID tag is an object that can be applied to or incorporated into a product, animal, or person for the
purpose of identification using radio waves. Some tags can be read from several meters away and beyond the
line of sight of the reader.
Most RFID tags contain at least two parts. One is an integrated circuit for storing and processing information,
modulating and demodulating a (RF) signal, and other specialized functions. The second is an antenna for
receiving and transmitting the signal. Chipless RFID allows for discrete identification of tags without an
integrated circuit, thereby allowing tags to be printed directly onto assets at a lower cost than traditional tags.
RFID tags come in three general varieties:- passive, active, or semi-passive (also known as battery-assisted).
Passive tags require no internal power source, thus being pure passive devices (they are only active when a
reader is nearby to power them), whereas semi-passive and active tags require a power source, usually a
small battery.
Passive tags have practical read distances ranging from about 10 cm (4 in.) (ISO 14443) up to a few
meters (Electronic Product Code (EPC) and ISO 18000-6), depending on the chosen radio frequency and
antenna design/size. But thanks to deep-space technology, that distance is now 600 feet[6]. Due to their
simplicity in design they are also suitable for manufacture with a printing process for the antennas. The lack of
an onboard power supply means that the device can be quite small: commercially available products exist that
can be embedded in a sticker, or under the skin in the case of low frequency (LowFID) RFID tags.
Many active tags today have operational ranges of hundreds of meters, and a battery life of up to 10
years. Active tags may include larger memories than passive tags, and may include the ability to store
additional information received from the reader.
Special active RFID tags may include temperature sensors. Temperature logging is used to monitor the
temperature profile during transportation and storage of perishable goods as fresh produce or certain
pharmaceutical products. Other sensor types are combined with active RFID tags, including humidity,
shock/vibration, light, radiation, temperature, pressure and concentrations of gases like ethylene.
Semi-passive tags are similar to active tags in that they have their own power source, but the battery
only powers the microchip and does not power the broadcasting of a signal. The response is usually powered
by means of backscattering the RF energy from the reader, where energy is reflected back to the reader as
with passive tags. An additional application for the battery is to power data storage.
If energy from the reader is collected and stored to emit a response in the future, the tag is operating active
Whereas in passive tags the power level to power up the circuitry must be 100 times stronger than with active
or semi-active tags, also the time consumption for collecting the energy is omitted and the response comes
with shorter latency time. The battery-assisted reception circuitry of semi-passive tags leads to greater
sensitivity than passive tags, typically 100 times more. The enhanced sensitivity can be leveraged as
increased range (by one magnitude) and/or as enhanced read reliability (by reducing bit error rate at least one
magnitude).
The enhanced sensitivity of semi-passive tags place higher demands on the reader concerning separation in
more dense population of tags. Because an already weak signal is backscattered to the reader from a larger
number of tags and from longer distances, the separation requires more sophisticated anti-collision concepts,
better signal processing and some more intelligent assessment which tag might be where. For passive tags,
the reader-to-tag link usually fails first. For semi-passive tags, the reverse (tag-to-reader) link usually collides
first.
Semi-passive tags have three main advantages 1) Greater sensitivity than passive tags 2) Longer battery
powered life cycle than active tags. 3) Can perform active functions (such as temperature logging) under its
own power, even when no reader is present for powering the circuitry.
- http://www.gentag.com/technology.html
A particular focus area for Gentag using RFID cell phones are diagnostic applications. RFID sensors can be
integrated into low cost, non-invasive, disposable diagnostic devices such as _smart" disposable wireless skin
patches or personal drug delivery systems and read directly with a cell
phone under existing Gentag/Altivera patents.
Copyright © 2008 Gentag, Inc

NNNNNNNNaaaaaaaannnnnnnnoooooooottttttttuuuuuuuubbbbbbbbeeeeeeee RRRRRRRRaaaaaaaaddddddddiiiiiiiioooooooo
- http://www.lbl.gov/Tech-Transfer/techs/lbnl2431.html
Nanotube Radio for Communications and Medical Applications
Alex Zettl and his team at Berkeley Lab have invented and constructed a fully functional, integrated radio
receiver based on a single carbon nanotube (CNT). The nanotube serves simultaneously as all essential
components of a radio -- antenna, tunable band-pass filter, amplifier, and demodulator—to convert an
electromagnetic signal into a mechanical signal and then into an electrical signal amplified and demodulated to
produce audible sound. The radio is several orders of magnitude smaller than previous radios due to the use
of the nanotube's electro-mechanical movement instead of a conventional radio's electrical components.
Berkeley Lab's nanotube radio promises smaller, less complex, and lower power-requirement wireless
communication devices. The radio can be configured to be either a receiver or a transmitter. Because its scale
is compatible with biological systems, the radio also offers unique opportunities for radio controlled devices to
be placed in the body for various diagnostic, therapeutic, monitoring, and sensory (auditory and visual)
functions.
In addition, the nanotube may be altered by contact with particles at the atomic scale that change the
resonance frequency of the nanotube. This change may be used to detect the impingement of particles,
whether solid or gaseous, to create a highly sensitive, inexpensive mass spectrometer or gas sensor. A mass
spectrometer constructed using this technology can detect the mass of less than a single hydrogen atom. The
nanotube application could also measure the masses of large molecules or those that are difficult to ionize,
e.g., DNA, proteins, because it does not rely on ionizing a particle to make measurements, as in traditional
mass spectrometers.
(a) Schematic of the nanotube radio. Radio transmissions tuned to the nanotube's resonance frequency force
the charged nanotube to vibrate. Field emission of electrons from the tip of the nanotube is used to detect the
vibrations and also amplify and demodulate the signal. A current measuring device, such as a sensitive
speaker, monitors the output of the radio.
(b) Transmissionelectron micrographs of a nanotube radio off resonance (top) and on resonance (bottom)
during a radio transmission.
APPLICATIONS OF TECHNOLOGY:
· All-in-one radio receiver for cell phones/wireless networks/GPS and other electronic devices
· Radio controlled devices that can exist inside the body, e.g. used as drug release triggers, diagnostic
instrumentation, interfacing with muscle or brain function
· Ultra small hearing aid
· RF antenna, tunable pass filter, amplifier, or demodulator
· Mass spectrometer
· Chemical sensor
FOR MORE INFORMATION:
Jensen, K., Weldon, J., Garcia, H., Zettl, A., Nanotube Radio, Nano Letters, Vol. 0, No. 0, A-D

- http://www.lbl.gov/Science-Articles/Archive/MSD-nanoradio.html
Published patent application WO/2009/048695 available at http://www.wipo.int/. Available for licensing.
- http://www.technologyreview.com/printer_friendly_article.aspx?id=20244
Copyright Technology Review 2011
- http://www.lbl.gov/Science-Articles/Archive/MSD-nanoradio.html
Berkeley Researchers Create First Fully Functional Nanotube Radio
Block diagram for a traditional radio. All four essential components of a radio, antenna, tuner, amplifier, and
demodulator may be implemented with a single carbon nanotube.

Video
- http://www.lbl.gov/Science-Articles/Archive/assets/images/2007/Oct/30-Tue/nanoradio-starwars.mov
This QuickTime video was recorded on the nanotube radio using a Transmission Electron Microscope. At the
beginning of the video, the nanotube radio is tuned to a different frequency than that of the transmitted radio
signal so the nanotube does not vibrate and only static noise can be heard. As the radio is brought into tune
with the transmitted signal, the nanotube begins to vibrate, which blurs its image in the video but allows the
music to become audible. The song is the theme music to Star Wars by John Williams.
- http://thefutureofthings.com/news/1185/nanoradio-smallest-radio-receiver-in-the-world.html
Smallest Radio Receiver in the World
Radio evolution - the nanoradio is nineteen orders-of-magnitude smaller than the Philco vacuum tube radio
from the 1930s (Credit: Berkeley / A. Zettl and K. Jensen)
Copyright © 2008 The Future of Things. All rights reserved

SSSSSSSSoooooooouuuuuuuunnnnnnnndddddddd
Ultrathin loudspeakers made from transparent and flexible carbon nanotube films, don't require any
of the bulky magnets and sound cones of conventional speakers.
- http://pubs.acs.org/doi/abs/10.1021/nl802750z
Flexible, Stretchable, Transparent Carbon Nanotube Thin Film Loudspeakers
Lin Xiao, Zhuo Chen, Chen Feng, Liang Liu, Zai-Qiao Bai, Yang Wang, Li Qian, Yuying Zhang, Qunqing Li, Kaili Jiang, Shoushan Fan
Department of Physics & Tsinghua-Foxconn Nanotechnology Research Centre, Tsinghua University, Beijing 100084, People's Republic of
China, and Department of Physics, Beijing Normal University, Beijing 100875, People's Republic of China
Nano Lett., 2008, 8 (12), pp 4539—4545
DOI: 10.1021/nl802750z
Publication Date (Web): October 29, 2008
We found that very thin carbon nanotube films, once fed by sound frequency electric currents, could emit loud
sounds. This phenomenon could be attributed to a thermoacoustic effect (see page 92). The ultra small heat
capacity per unit area of carbon nanotube thin films leads to a wide frequency response range and a high
sound pressure level. On the basis of this finding, we made practical carbon nanotube thin film loudspeakers,
which possess the merits of nanometer thickness and are transparent, flexible, stretchable, and magnet-free.
Such a single-element thin film loudspeaker can be tailored into any shape and size, freestanding or on any
insulating surfaces, which could open up new applications of and approaches to manufacturing loudspeakers
and other acoustic devices.
Copyright © 2008 American Chemical Society
- http://pubs.acs.org/cen/news/86/i45/8645notw9.html
Video Nanotube-based speaker plays music from an iPod beneath it.
- http://www.natureasia.com/asia-materials/highlight.php?id=340
Carbon nanotubes: Loud and clear
To make a loudspeaker from the films was extremely simple. _All that was needed were two electrodes
attached to the carbon nanotube films through which the audio frequency voltage is applied," says Kaili Jiang
from the research team. The sound output from the loudspeaker was clear and the acoustic performance
relatively constant across the audible frequency spectrum.
A carbon nanotubes loudspeaker placed in front of an iPod to demonstrate the possible integration with
display devices
Xiao, L. et al. Flexible, stretchable, transparent carbon nanotubes thin film loudspeakers. Nano Lett. Doi:10.1021/nl802750z (2008).
© 2008 Tokyo Institute of Technology
- http://www.newscientist.com/article/dn15098

by Colin Barras © Copyright 2008 Reed Business Information Ltd.
Hot nanotube sheets produce music on demand
Sheets made of carbon nanotubes behave like a loudspeaker when zapped with a varying electric current, say
Chinese researchers. The discovery could lead to new generation of cheap, flat speakers.
Video
- http://thefutureofthings.com/news/5967/flexible-transparent-nanotube-based-loudspeakers.html
Flexible, Transparent Nanotube-Based Loudspeakers
Researchers from Tsinghua University and Beijing University have recently developed a thin film based on
carbon nanotubes (CNT) that could replace conventional magnetic loudspeakers. By applying an audio
frequency current through the CNT, the loudspeaker can generate sound with wide frequency range, high
sound pressure levels (SPL), and low total harmonic distortion (THD). The uniqueness of this advancement is
that the films are flexible, stretchable, transparent, and can be tailored into many shapes and sizes,
freestanding or placed on a variety of rigid or flexible insulating surfaces.
Flat flexible speakers
- http://www2.warwick.ac.uk/newsandevents/pressreleases/new_flat_flexible
A groundbreaking new loudspeaker, less than 0.25mm thick, has been developed by University of Warwick
engineers, it's flat, flexible, could be hung on a wall like a picture, and its particular method of sound
generation could make public announcements in places like passenger terminals clearer, crisper, and easier
to hear.
Lightweight and inexpensive to manufacture, the speakers are slim and flexible: they could be concealed
inside ceiling tiles or car interiors, or printed with a design and hung on the wall like a picture.
All speakers work by converting an electric signal into sound. Usually, the signal is used to generate a varying
magnetic field, which in turn vibrates a mechanical cone, so producing the sound.
Warwick Audio Technology's FFL technology is a carefully designed assembly of thin, conducting and
insulating, materials resulting in the development of a flexible laminate, which when excited by an electrical
signal will vibrate and produce sound.
The speaker laminate operates as a perfect piston resonator. The entire diaphragm therefore radiates in
phase, forming an area source. The wave front emitted by the vibrating surface is phase coherent, producing a
plane wave with very high directivity and very accurate sound imaging.
□ □ □ □ □

- http://blogs.discovermagazine.com/80beats/2008/11/05/paper-thin-nanotube-speakers-can-turn-up-the-volume/
Paper-Thin Nanotube Speakers Can Turn Up the Volume
by Nina Bai November 5th, 2008
Next-generation loudspeakers could be as thin as paper, as clear as glass, and as stretchable as rubber.
Chinese researchers have discovered that sheets of carbon nanotubes can amplify sound as loud as
conventional speakers can. These nanotube speakers could eventually be used to add audio capabilities to
windows, video screens, and clothing. "It is so wonderfully simple, that it brings up a strong wave of ‘Duh, why
didn’t I think of that!’," says physical chemist Howard Schmidt at Rice University [Nature News].
The researchers made the speaker by aligning carbon nanotubes, each about 10 nanometers in diameters,
into thin flexible sheets. When they applied an electric current with an audio frequency to the sheets, the
sheets broadcast the sounds loud and clear. The researcher describe their device in Nano Letters. The
physics behind the nanotube speakers is different from that of conventional speakers. Unlike standard
loudspeakers that generate sound by vibrations in the surrounding air molecules, the nanotube speaker
doesn’t emit vibrations. The team used a laser vibrometer to detect vibrations in the sheet, but found nothing
[Physorg.com].
Instead, it generates sound much as lightning produces thunder. When an electric current is applied to the
nanotubes, they heat and expand the air near them, creating sound waves. "The difference is that thunder is
not a controlled discharge. With carbon nanotubes, you can control the sound and play music," [researcher
Kaili] Jiang says [Nature News]. The phenomenon is known as the thermoacoustic effect. The thermally
induced pressure oscillations can heat the speakers up to 80 °C but the researchers say temperatures s lightly
above room temperature would be adequate for consumer applications.
The basic idea of using the thermoacoustic effect to make speakers isn’t new. In the late 19th century,
researchers built a "thermophone" out of thin sheets of metal, but it could only produce a whisper of a sound.
The new nanotube speakers can produce sounds 20 to 30 decibels louder than the thermophone, thanks to
the low heat capacity of the nanotubes. "A key parameter that determines the sound generation efficiency is
the heat capacity per unit area," [explains Jiang]. Put simply, that’s a measure of how much heat energy must
be applied to a material to raise its temperature. The heat capacity per unit area of a carbon nanotube sheet is
260 times smaller than that of a platinum foil sheet [New Scientist].
©2008 discovermagazine.com
□ □ □ □ □
Carbon Nanotubes Speaker
- http://www.physorg.com/news144939492.html
Carbon nanotubes could act as an efficient music speaker
November 3, 2008 by Lisa Zyga
Video
Excerpt from a video of Lin Xiao´s nanotube music speaker. The speaker produces sound when a current
passes through, due to a thermoacoustic effect. Credit: Lin Xiao, et al.
(PhysOrg.com) -- While carbon nanotubes are widely praised for their strength and electrical properties, no
one has thoroughly investigated their acoustic properties, until now. A team of Chinese researchers has found
that zapping sheets of carbon nanotubes with an electric current causes the nanotubes to emit sound.
The team, which consists of scientists Shoushan Fan and colleagues at Tsinghua University in Beijing, China,
and Beijing Normal University, hope that the discovery could lead to the development of cheap, flat
loudspeakers. Examples of carbon nanotubes´ musical abilities can be heard here and here.

To create the nanotube speaker, the researchers sent an audio frequency current through a thin sheet of
carbon nanotubes, generating a sound. Unlike standard loudspeakers that generate sound by vibrations in the
surrounding air molecules, the nanotube speaker doesn´t emit vibrations. The team used a laser vibrometer to
detect vibrations in the sheet, but found nothing.
Instead, the nanotube speaker likely works as a thermoacoustic device: when an alternating current passes
through the sheet, the sheet experiences rapid temperature oscillations alternating between room temperature
and 80 °C (176 °F). These temperature oscillations cause pressure oscillations in the surrounding air,
producing the sound, while the nanotube sheet remains static. One advantage of this method is that, even if
part of the nanotube sheet breaks, it should continue to emit sound, unlike conventional speakers.
This thermoacoustic phenomenon was actually discovered in the late nineteenth century, when scientists
passed a current through a thin foil to produce sound, leading to the invention of the "thermophone." Although
the principle is the same, however, the nanotube sheet acts much more efficiently than foil because it doesn´t
require nearly as much applied heat to increase its temperature. Specifically, the nanotube sheet´s heat
capacity is 260 times smaller than platinum foil, making nanotubes 260 times more efficient and able to
produce a louder sound.
The Chinese researchers envision several interesting applications for the nanotube speakers. Because the
nanotube sheets can be stretched to be visually transparent and still produce sound, they might be fitted over
the front of an LCD screen to replace conventional speakers. Another possibility is incorporating the nanotube
speakers into textiles to create musical clothes.
More information: Xiao, Lin, et al. "Flexible, Stretchable, Transparent Carbon Nanotube Thin Film Loudspeakers." ASAP Nano Lett., ASAP
Article, 10.1021/nl802750z.
© 2009 PhysOrg.com
- http://www.gizmag.com/nanotube-sheets-for-stealthy-submarines/16231/
Nanotube sheets could lead to stealthier submarines
By Ben Coxworth September 2, 2010
One of the sound-generating carbon nanotube sheets
Two years ago, Chinese scientists coated one side of a flag with a thin sheet of nanotubes, then played a
song using the flapping sheet-coated flag as a speaker. It was a demonstration of flexible speaker technology,
in which nanotubes can be made to generate sound waves via a thermoacoustic effect – every time an
electrical pulse is sent through the microscopic layer of nanotubes, it causes the air around them to heat up,
which in turn creates a sound wave. Now, an American scientist has taken that technology underwater, where
he claims it could allow submariners to detect other submarines, and to remain hidden themselves.
Research scientist Ali Aliev, of the University of Texas at Dallas, has determined that the low-frequency sound
waves created by carbon nanotube sheets can be used by sonar systems to determine the location, depth,
and speed of underwater objects. Aliev and his team also determined that the sheets could be tuned to
transmit specific frequencies that would cancel out certain noises... noises such as those that a submarine
makes while passing through the water, for instance.

One obstacle that Aliev had to overcome was the fact that the sheets do not do well in direct contact with
water. The sheets can oxidize when in contact with water at high temperatures, the high surface tension and
vibrational frequency of water causes the nanotubes to bundle into acoustically-poor ropes, and ocean water
can cause the sheets to short circuit. On the plus side, however, the hydrophobic (water-repellent) nature of
the sheets causes an air envelope to form around the nanotubes, which in turn acts as a kind of resonating
chamber for the sound waves, boosting their strength.
Be that as it may, the sheets still needed to be protected from the water. In order to do so, Aliev encapsulated
them in thin, flat gas-filled containers with acoustically-transparent windows. As with the air envelopes, the
resonance that resulted from the sound waves being generated in such an enclosed space proved to be a
benefit – the encapsulated sheets were actually ten times more effective at transmitting low-frequency sound
underwater than non-encapsulated sheets.
The researchers also experimented with stacking the sheets several deep, but found that this negatively
affected the desired thermoacoustics. The optimum arrangement turned out to be a layer of just two separated
sheets, which received their electrical pulses alternately instead of simultaneously.
The research has just been published in the journal Nano Letters.
- http://www.physorg.com/news195720997.html
Nanotech Speakers Hold Promise for Sonar Uses
June 14, 2010
Thin, almost transparent sheets of multi-walled (MWNT) nanotubes are connected to an electrical source,
which rapidly heats the nanotubes causing a pressure wave in the surrounding air to produce sound.
Led by Dr. Ali Aliev, a research scientist at the NanoTech Institute, the team discovered that nanotubes excel
at producing low frequency sound waves, which are ideal for probing the depths of the ocean with sonar. The
team also confirmed previous studies noting the ability of nanoscience speakers to cancel noise when tuned to
the correct frequency — say, the rumble of a submarine.
“Nanotube sheets can easily be deployed on curved surfaces, like the hull of a sub,” Aliev said. “They’re very
light, about 20 microns thick, and they’re 99 percent porous. Layers of nanotube sheets can be built up, each
with a different function, for sonar projector applications or for control of the boundary layer losses for marine
vehicles. Meaning, periodically heating the skin of a sub—or even an airplane—warms the thin pocket of air
around the vehicle and reduces friction and turbulence. Or, these underwater sound generators could cancel
out the sonar signal being sent out by another sub, leaving the friendly sub undetected.”
More information: Journal paper: http://dx.doi.org/ … 21/nl100235n
□ □ □ □ □

Thermoacoustic effect
- http://www.five-shades-of-green-energy.com/thermoacoustics.html
Thermoacoustics work both ways. Simply put, heat makes sound, sound makes heat.
Thermoacoustics is heat that makes noise and noise that makes heat. More specifically sound oscillations that
transport heat or cold, both of which can be used to generate sound oscillations. A definition is in order – it’s
the study of phenomena influenced by thermodynamics and acoustics.
□ □ □ □ □
Resonance
- http://www.phys.unsw.edu.au/jw/musFAQ.html
How can a resonating chamber amplify sounds?
Let's compare a string on immoveable mountings (an unplugged electric guitar approaches this) with a string
on an acoustic guitar. In the former, the bridge (almost) doesn't move, so no work is done by the string. The
string itself is inefficient at moving air because it is thin and slips through the air easily, making almost no
sound. So nearly all the energy of the pluck remains in the string, where it is gradually lost by internal friction.
In contrast, the string on the acoustic guitar moves the belly of the instrument slightly. Even though the motion
is slight, the belly is large enough to move air substantially and make a sound. So the string converts some of
its energy to sound in the air. Consequently, its vibration decreases more rapidly than does that of a similar
string on an electric guitar. (Internal losses in the string are still very important, however.)
So there is no extra energy: the energy for the sound comes from the string. Which raises an obvious
question: if there is no amplification, how does such a little vibration make such a lot of sound? The answer is
that our ears are rather sensitive (see our page on decibels and hearing). Consequently, even a small energy
(even less than a millijoule) over several seconds makes a reasonably loud sound.
Copyright © 2008 Joe Wolfe
- http://en.wikipedia.org/wiki/Sound_box
A sound box or sounding box, (sometimes written soundbox), is an open chamber in the body of a musical
instrument which alters the instrument's tone quality by modifying the way the instrument resonates.
The purpose of the sound box is to amplify the volume of the instrument.
- http://en.wikipedia.org/wiki/Resonance_chamber
A resonance chamber uses resonance to amplify sound. The chamber has interior surfaces which reflect an
acoustic wave. When a wave enters the chamber, it bounces back and forth within the chamber with low loss
(See standing wave). As more wave energy enters the chamber, it combines with and reinforces the standing
wave, increasing its intensity (volume).
- http://www.glenbrook.k12.il.us/gbssci/Phys/Class/sound/u11l4b.html
Resonance and Standing Waves
□ □ □ □ □
- http://www.murata-northamerica.com/murata/murata.nsf/pages/08032010
Ultra-Thin Waterproof Piezoelectric Speaker
Smyrna, GA, August 3, 2010 - Murata Electronics North America today announced the launch of the world's
first ultra-thin waterproof piezoelectric speaker. With a thickness of only 0.9mm, this 19.5mm x 14.1mm
speaker enables greater design freedom for the rapidly growing and evolving mobile market. The speaker
achieves IPX7 grade waterproof protection without the need of a costly water proof acoustic membrane.
Using just ordinary acoustic mesh and double sided tape to seal the speaker to the front cavity, this waterproof
speaker application allows for decreased application costs, thin size, and good sound performance. The high
torque nature of the speaker's piezoelectric motor also makes it idea for operation in very small and thin back
cavities where dynamic speakers struggle to operate. As such, these features make the speaker ideal for
mobile phones, music players, digital still cameras, digital video cameras, IC recorders, e-books and other
mobile equipment.
There have been numerous indicators that demonstrate the growing trend towards waterproofing mobile
equipment. For example, of the 50 new Japanese mobile phone models announced in late 2010, almost one

in four were waterproof. This trend is aided by Murata's speaker ability to overcome the above mentioned
technical and cost challenges. Specific speaker characteristics include an average sound pressure level of
92.0±3.0dB (1400Hz±20%, 5Vrms sine wave, 10cm) and a capacitance of 0.9µF±30%.
“We developed this waterproof speaker based on feedback from our customers and market trends," said Peter
Tiller, senior group product manager, Murata Electronics North America. “Too often we hear of consumers
losing a phone or camera due to accidental submersion in water. We hope our new speaker will allow more
mobile consumer products to be waterproof and survive life's little accidents."
Sample pricing of Murata's waterproof piezoelectric speaker is approximately $2.90 in small quantities and the
lead-time is 11 weeks. Further information can be found on-line at http://www.murata-northamerica.com
- http://www.murata.com/new/news_release/2010/0608/index.html

LLLLLLLLeeeeeeeennnnnnnnssssssss
- http://www.optoiq.com/index/machine-vision-imaging-processing/display/vsd-article-display/articles/optoiq2/machine-
vision___image/technologies-__products/optics-__lenses_/2010/7/Tunable_Optics.html
Disparate technologies are being employed in the development of miniaturized autofocus lenses
Andrew Wilson, Editor - Jul 1, 2010
Many of the optical systems used in machine-vision and image-processing systems are based on glass or
plastic lenses. While some of these systems employ fixed-focal-length lenses, others require lenses where the
focal length must be changed. In traditional mechanically based lens systems, this is accomplished by
translating the optical elements within the lens against each other.
As the predominant method of focusing images for over a century, mechanical lens motion sharply contradicts
the biological methods found in nature. By leveraging principles based on these methods, manufacturers are
now developing different types of small deformable lenses that can be tuned over various focal distances.
Because these lens systems can be miniaturized relatively easily, they are finding applications in smart
machine-vision cameras, endoscopy systems, and cell phones.
Electrowetting technology
First demonstrated more than five years ago by both Philips Research and Varioptic, liquid lenses that use
electrowetting technology perform autofocusing by employing a lens comprising two immiscible fluids of
different refractive indexes. In both the Philips and Varioptic designs, these consist of an electrically
conducting water solution and electrically nonconducting oil (see figure below). The interface between these
liquids then forms a natural diopter, due to the index difference of the two liquids.
By employing an electrically conducting water solution and electrically nonconducting oil, an interface that
forms a natural diopter is created due to the index difference of the two liquids. To control the shape of the
lens, an electric field is applied across the hydrophobic coating and the aqueous solution wets the sidewalls of
the tube, altering the radius of curvature of the meniscus between the two fluids and thus the lens' focal length.
To control the shape of the lens, an electric field is applied across the hydrophobic coating so that it becomes
less hydrophobic—a process called electrowetting that results from an electrically induced change in surface
tension. As a result, the aqueous solution begins to wet the sidewalls of the tube, altering the radius of
curvature of the meniscus between the two fluids and thus the lens' focal length. By increasing the electric
field, the surface of the initially convex lens can be made completely flat or even concave. As a result it is
possible to implement lenses that transition smoothly from being convergent to divergent and vice versa.

Liquid crystals
Liquid crystals are also being employed in other types of electro-optical adaptive lens designs to perform
autofocusing. In the technique used by LensVector, for example, a control voltage is applied to dynamically
change the rotation of molecules in a liquid-crystal cell to achieve a change in refractive index. In applying this
voltage, the differential rotation of the liquid-crystal molecules from the center to the periphery of the element
is changed, focusing light at the desired focal distance (see figure below). By tuning this voltage, the
differential rotation of molecules in the element results in a lens that can be focused from infinity to 10 cm.
Liquid crystals are also being employed in other types of electro-optical adaptive lens designs to perform
autofocusing. Here, a control voltage is applied to dynamically change the rotation of molecules in a liquid-
crystal cell to achieve a change in refractive index. By tuning this voltage, the differential rotation of molecules
in the element results in a lens that can be focused from infinity to 10 cm.
While such autofocus lenses have for a number of years been the subject of much research, they are now
being deployed by companies developing smart cameras for machine vision. Indeed, autofocus lenses based
on Varioptic's electrowetting technology have already been employed in both the DataMan 100 and 200 series
of image-based ID readers from Cognex and the QX Hawk barcode imager from Microscan. In future, it
appears that, whichever technology is adopted, such self-adaptive lenses will be used in other applications,
most notably cell phones and endoscopy systems where miniaturization is an important design consideration.
□ □ □ □ □

- http://www.varioptic.com/en/tech/technology01.php
Liquid lens for Autofocus
The liquid lenses that we develop are based on the electrowetting phenomenon described below : a water
drop is deposited on a substrate made of metal, covered by a thin insulating layer. The voltage applied to the
substrate modifies the contact angle of the liquid drop. The liquid lens uses two isodensity liquids, one is an
insulator while the other is a conductor. The variation of voltage leads to a change of curvature of the liquid-
liquid interface, which in turn leads to a change of the focal length of the lens.
□ □ □ □ □
- http://www.opticsinfobase.org/abstract.cfm?uri=oe-16-11-8084
Liquid micro-lens array activated by selective electrowetting on lithium niobate substrates
S. Grilli, L. Miccio, V. Vespini, A. Finizio, S. De Nicola, and Pietro Ferraro
Optics Express, Vol. 16, Issue 11, pp. 8084-8093 (2008) doi:10.1364/OE.16.008084
Lens effect was obtained in an open microfluidic system by using a thin layer of liquid on a polar electric
crystal like LiNbO3. An array of liquid micro-lenses was generated by electrowetting effect in pyroelectric
periodically poled crystals. Compared to conventional electrowetting devices, the pyroelectric effect allowed to
have an electrode-less and circuit-less configuration. An interferometric technique was used to characterize
the curvature of the micro-lenses and the corresponding results are presented and discussed. The preliminary
results concerning the imaging capability of the micro-lens array are also reported.
2nd article
- http://www.opticsinfobase.org/abstract.cfm?uri=OPN-19-12-34
□ □ □ □ □

- http://www.spectrum.ieee.org/dec04/4172
Through a Lens Sharply
FluidFocus lens, uses electrostatic forces to alter the shape of a drop of slightly salty water inside a glass
cylinder 3 millimeters in diameter and 2.2 mm long.
By Benno Hendriks and Stein © Copyright 2009 IEEE
Illustration: Bryan Christie

BBBBBBBBiiiiiiiioooooooo--------SSSSSSSSeeeeeeeennnnnnnnssssssssoooooooorrrrrrrrssssssss
- http://www.upenn.edu/pennnews/news/penn-researchers-provide-first-step-towards-electronic-dna-
sequencing-translocation-through-gra
Researchers at the University of Pennsylvania have developed a new, carbon-based nanoscale
platform to electrically detect single DNA molecules.
Jordan Reese July 2010
Using electric fields, the tiny DNA strands are pushed through nanoscale-sized, atomically thin pores in a
graphene nanopore platform that ultimately may be important for fast electronic sequencing of the four
chemical bases of DNA based on their unique electrical signature.
The pores, burned into graphene membranes using electron beam technology, provide Penn physicists with
electronic measurements of the translocation of DNA.
Graphene nanopore devices developed by the Penn team work in a simple manner. The pore divides two
chambers of electrolyte solution and researchers apply voltage, which drives ions through the pores. Ion
transport is measured as a current flowing from the voltage source. DNA molecules, inserted into the
electrolyte, can be driven single file through such nanopores.
As the molecules translocate, they block the flow of ions and are detected as a drop in the measured current.
Because the four DNA bases block the current differently, graphene nanopores with sub-nanometer thickness
may provide a way to distinguish among bases, realizing a low-cost, high-throughput DNA sequencing
technique.
In addition, to increase the robustness of graphene nanopore devices, Penn researchers also deposited an
ultrathin layer, only a few atomic layers thick, of titanium oxide on the membrane which further generated a
cleaner, more easily wettable surface that allows the DNA to go through it more easily. Although graphene-
only nanopores can be used for translocating DNA, coating the graphene membranes with a layer of oxide
consistently reduced the nanopore noise level and at the same time improved the robustness of the device.
Because of the ultrathin nature of the graphene pores, researchers were able to detect an increase in the
magnitude of the translocation signals relative to previous solid state nanopores made in silicon nitride, for
similar applied voltages.
Research was conducted by Merchant, Healy, Wanunu, Ray, Neil Peterman, John Bartel, Michael D.
Fischbein, Kimberly Venta, Luo, Johnson and Drndiæ of Penn's Department of Physics and Astronomy.
The research was supported by a National Institutes of Health grant and also grants from the U.S. Department
of Defense, Army Research Office, Penn Genome Frontiers Institute, Nano-Bio Interface Center at Penn,
Nanotechnology Institute of the Commonwealth of Pennsylvania and Pennsylvania Department of Health. The
Department of Health specifically disclaims responsibility for any analyses, interpretations or conclusions.

- http://www.physics.upenn.edu/~drndic/group/graphene-nanopore.html
Graphene nanopore devices. (a) Device schematic. Few-layer graphene (1-5 nm thick) is suspended over a 1
ìm hole in a 40 nm thick silicon nitride (SiN) membrane. The SiN membrane is suspended over an approx. 50
x 50 ìm2 aperture in a silicon chip coated with a 5 ìm SiO2 layer. The device is inserted into a PDMS
measurement cell with microfluidic channels that form reservoirs in contact with either side of the chip. A bias
voltage, VB, is applied between the reservoirs to drive DNA through the nanopore. (b) TEM image of a
nanopore in a graphene membrane. Scale bar is 10 nm. (c) Ionic current-voltage measurement for this 10-nm
graphene nanopore device in 1M KCl, pH 9.
Biosensing mechanism with carbon nanotubes explained
Transistors are the key elements of many types of electronic (bio)sensors. Since the discovery that individual
carbon nanotubes (CNTs) can be used as nanoscale transistors, researchers have recognized their
outstanding potential for electronic detection of biomolecules in solution, possibly down to single-molecule
sensitivity. To detect biologically derived electronic signals, CNTs are often - but not always - functionalized
with (conductive) linkers such as proteins and peptides to interface with soluble biologically relevant targets
(linkers need not be conductive as long as they are capable of localizing the target molecule in close vicinity of
the tube). Although CNT transistors have been used as biosensors for some years now, the ultimate single-
molecule sensitivity, which is theoretically possible, has not been reached yet. One of the reasons that
hampers the full exploitation of these promising nanosensors is that the sensing mechanism is still not well
understood. Although a variety of different sensing mechanisms has been suggested previously, various
studies contradict one another, and the sensing mechanism remained under debate. Researchers in The
Netherlands - through modeling and specific control experiments - now have succeeded in identifying the
sensing mechanism. They found that the majority of their experiments can be explained by a combination of
electrostatic gating and Schottky barrier effects. Because these two mechanisms have different gate-potential
dependence, the choice of gate potential can strongly affect the outcome of real-time biosensing experiments.

- http://en.wikipedia.org/wiki/Schottky_barrier
Schottky barrier
A Schottky barrier, named after Walter H. Schottky, is a potential barrier formed at a metal—semiconductor
junction which has rectifying characteristics, suitable for use as a diode. The largest differences between a
Schottky barrier and a p—n junction are its typically lower junction voltage, and decreased (almost
nonexistent) depletion width in the metal.
Not all metal—semiconductor junctions form Schottky barriers. A metal—semiconductor junction that does not
rectify current is called an ohmic contact. Rectifying properties depend on the metal's work function, the band
gap of the intrinsic semiconductor, the type and concentration of dopants in the semiconductor, and other
factors. Design of semiconductor devices requires familiarity with the Schottky effect to ensure Schottky
barriers are not created accidentally where an ohmic connection is desired.
Reliably detecting foodborne pathogens with nanotechnology and encoding/decoding techniques.
"With embedded forward error-correction function in biosensors, with the result that our multi-array biosensor
not only can detect multiple pathogens simultaneously, but also could correct for errors induced by artifacts in
biosensors and environment, thus increasing the accuracy and reliability of biosensors" Shantanu
Chakrabartty explains to Nanowerk. "In our recent work we have demonstrated that we can successfully
construct basic logic circuits (AND and OR) using computational primitives inherent in antigen-antibody
interaction. The operation of these logic gates relies on selective conjugation of polyaniline (PANI) nanowires
with an antigen-antibody complex. We have also developed corresponding electrical models for these logic
gates which can be now be used in computer-aided design of biosensors. d;0";3.0";Visualization of the final
multii-array biosensor prototype (Reprinted with permission from IOP Publishing) Chakrabartty, an Assistant
Professor and Director of the Adaptive Integrated Microsystems Laboratory at Michigan State University, led
the work that has been reported in a recent paper in Nanotechnology ("Fundamental building blocks for
molecular biowire based forward error-correcting biosensors") where he, together with first author Yang Liu
and Associate Professor Evangelyn C. Alocilja describes the fabrication, characterization and modeling of
fundamental logic gates that can be used for designing biosensors with FEC.
- http://www.nano.org.uk/news/may2008/latest1395.htm
NASA Nano-Biosensor Helps Detect Biohazards
NASA has developed a revolutionary nanotechnology-based biosensor that can detect trace amounts of
specific bacteria, viruses and parasites. This biosensor will be used to help prevent the spread of potentially
deadly biohazards in water, food and other contaminated sources.
This NASA developed nanotechnology-based biosensor, designed to detect
trace amounts of specific bacteria, viruses and parasites, has now been tested
and licensed for commercialization by biosensor technology company Early
Warning Inc., from Troy , N.Y. 23rd May 2008 NASA - ©2008 Institute of
Nanotechnology
- http://www.patentstorm.us/patents/7303875.html
Nano-chem-FET based biosensors

VVVVVVVViiiiiiiirrrrrrrrttttttttuuuuuuuuaaaaaaaallllllll MMMMMMMMuuuuuuuusssssssscccccccclllllllleeeeeeeessssssss
almost invisible muscles to animate new elecronic devices
- http://www.unwiredview.com/2008/01/25/foldable-rollable-phone-from-motorola/
By Staska on 25 Jan 08
Foldable/ rollable phone from Motorola
The design of the mobile phones is always a fight between two opposite objectives - portability and usability.
The more small and portable the device becomes, the less usable the user interface can be.
You can make the phone screen only that small, until the information displayed on it becomes unreadable.
The same goes for the input devices. Make the keyboard small enough, and the user will have a really hard
time pressing the correct keys.
Well. Motorola has an interesting idea what to do about that. In a patent application “User Interface System” it
describes a concept of mobile phone with rollable display and/or keyboard.
Of course, the idea of flexible/rollable screens and keyboards is nothing new. The are quite a few of these
gadgets on the market or at least in late prototype stage. The problem with these devices is that
flexible/rollable is by definition not rigid. And using the phone with a keypad or display flapping in the wind, is
not such a good idea.
But Motorola has found the way around this little problem, by using a reservoir with electrorheological fluid
beneath the foldable display or keypad. This fluid becomes a solid material when electric current is applied to
it, and then reverts again to fluid state when the electric current disappears.
The phone with either rollable display or keypad will have all it’s working electronics in a solid part, with an
enclosure for the flexible part located here as well. In inactive state the flexible part rests in an enclosure.
Whenever the call comes in, or you want to make one, press a button. Electric current is applied, the display
rolls out and springs into a solid state, and you use the device as any other mobile phone. Press the button
again, and display folds back-in.
To take it even further, both display and keypad can be made flexible. You just put all the necessary
electronics into a solid container, with the enclosures for flexible display and keypad. This way you could make
matchbox sized mobile mobile phone, which will be as easy to use as any other clamshell.
Looks like an interesting, if pretty far fetched idea, which probably won’t come to life anytime soon.

- http://www.newscientist.com/blog/invention/2006/06/origami-gadgets.html
June 06, 2006
Sony patents fold-up origami gadgetry
At Sony Tokyo labs are working on a clever way to get bulky electronic devices into small pockets. Their plan
is to create handheld computers, phones and portable games consoles that fold up for carrying and then
become rigid for use.
The body and screen of folding gadgets would be made from a flexible polymer containing conductive rubber
bracing struts filled with a gel of aluminosilicate particles suspended in silicone oil.
When a current is passed through the struts, the particles clump together and harden the gel, making the
gadget solid enough to use. Sony has found that it would take very little power to make such a folding device
harden, so the drain on its battery should be low. The company's patent adds that the transition from soft to
hard takes just milliseconds. It suggests that the same technique could even be used in a video game
controller to make it jolt or change shape in response to on-screen action.
□ □ □ □ □
Electrorheological (ER) fluids
- http://en.wikipedia.org/wiki/Electrorheological_fluid
Electrorheological (ER) fluids are suspensions of extremely fine non-conducting particles (up to 50
micrometres diameter) in an electrically insulating fluid. The apparent viscosity of these fluids changes
reversibly by an order of up to 100,000 in response to an electric field. For example, a typical ER fluid can go
from the consistency of a liquid to that of a gel, and back, with response times on the order of milliseconds.
The effect is sometimes called the Winslow effect, after its discoverer the American inventor Willis Winslow,
who obtained a US patent on the effect in 1947 and wrote an article published in 1949
Applications
The normal application of ER fluids is in fast acting hydraulic valves and clutches, with the separation
between plates being in the order of 1 mm and the applied potential being in the order of 1 kV. In simple
terms, when the electric field is applied, an ER hydraulic valve is shut or the plates of an ER clutch are locked
together, when the electric field is removed the ER hydraulic valve is open or the clutch plates are disengaged.
Other common applications are in ER brakes (think of a brake as a clutch with one side fixed) and shock
absorbers (which can be thought of as closed hydraulic systems consisting of a valve with no external pump).
There are many novel uses for these fluids, including use in the US army's planned future force warrior
project. They plan to create bulletproof vests using an ER fluid because the ability to soak the fluid into cloth
creates the potential for a very light vest that can change from a normal cloth into a hard covering almost
instantaneously. Other potential uses are in accurate abrasive polishing and as haptic controllers and tactile
displays.

ER fluid has also been proposed to have potential applications in flexible electronics, with the fluid
incorporated in elements such as rollable screens and keypads, in which the viscosity-changing qualities of
the fluid allowing the rollable elements to become rigid for use, and flexible to roll and retract for storing when
not in use. Motorola filed a patent application for mobile device applications in 2006
The change in apparent viscosity is dependent on the applied electric field, i.e. the potential divided by the
distance between the plates. The change is not a simple change in viscosity, hence these fluids are now
known as ER fluids, rather than by the older term Electro Viscous fluids. The effect is better described as an
electric field dependent shear yield stress. When activated an ER fluid behaves as a Bingham plastic (a type
of viscoelastic material), with a yield point which is determined by the electric field strength. After the yield
point is reached, the fluid shears as a fluid, i.e. the incremental shear stress is proportional to the rate of shear
(in a Newtonian fluid there is no yield point and stress is directly proportional to shear). Hence the resistance
to motion of the fluid can be controlled by adjusting the applied electric field.
- http://web.phys.ust.hk/index.php?option=com_content&task=view&id=88&Itemid=79
Electrorheological (ER) fluids denote a class of materials consisting of nanometer to micrometer sized solid
particles dispersed in a liquid, whose rheological (i.e., deformation and flow) properties are controllable by an
external electric field. In particular, they can reversibly transform from a liquid to a solid within one hundredth
of a second. While in the solid state (with the electric field applied), the strength of that solid, measured by the
yield stress, is the critical parameter that governs the application potential of the ER fluid.
Composition of ER fluids
Structural transition of ER fluid under electric field

At HKUST, eight years of research work on ER fluids led to a breakthrough last year in the synthesis of a
novel type of ER fluid that consists of 70-nanometer-sized coated nanoparticles dispersed in insulating oil.
These new fluids, which harness the extremely high electric field that exists in Debye double layers, exhibit
yield stress one order of magnitude higher than the best commercially available ER particles. The significance
of this breakthrough is that the yield stress has broken the theoretical upper bound predicted on the basis of
linear response of the component materials, thereby signifying a new mechanism. This new class of ER fluids
is thus denoted as having a 'Giant Electrorheological' (GER) Effect, surpassing the threshold that the General
Motors study has set for automotive applications. It is envisioned that HKUST's GER fluids can be used not
only in those classical applications, but also in micro-electromechanical systems (MEMS) or nano-EMS as
replacements for microgears, reducing cost and increasing reliability and simplicity of controlled mechanical
motion in the micro- to nanoscale. After its publication in Nature Materials, this new breakthrough has been
reported around the world in the Washington Post, Science News, New Scientist, NanoToday, Nanotech,
Technology Review News (TRN), and thirty other media outlets.
□ □ □ □ □
Magnetorheological fluid
- http://en.wikipedia.org/wiki/Magnetorheological_fluid
A magnetorheological fluid (MR fluid) is a type of smart fluid. It is a suspension of micrometer-sized
magnetic particles in a carrier fluid, usually a type of oil. When subjected to a magnetic field, the fluid greatly
increases its apparent viscosity, to the point of becoming a viscoelastic solid. Importantly, the yield stress of
the fluid when in its active ("on") state can be controlled very accurately by varying the magnetic field intensity.
How it works
The magnetic particles, which are typically micrometer or nanometer scale spheres or ellipsoids, are
suspended within the carrier oil are distributed randomly and in suspension under normal circumstances, as
below.
When a magnetic field is applied, however, the microscopic particles (usually in the 0.1-10 µm range) align
themselves along the lines of magnetic flux, see below. When the fluid is contained between two poles
(typically of separation 0.5-2 mm in the majority of devices), the resulting chains of particles restrict the
movement of the fluid, perpendicular to the direction of flux, effectively increasing its viscosity. Importantly,
mechanical properties of the fluid in its _on" state are anisotropic. Thus in designing a magnetorheological (or
MR) device, it is crucial to ensure that the lines of flux are perpendicular to the direction of the motion to be
restricted.

- http://science.howstuffworks.com/smart-structure1.htm
What is MR Fluid
Looking at it in a beaker, MR fluid doesn't seem like such a revolutionary substance. It's a gray, oily liquid
that's about three times denser than water. It's not too exciting at first glance, but MR fluid is actually quite
amazing to watch in action.
A simple demonstration by David Carlson, a physicist at the North Carolina lab, shows the liquid's ability to
transform to solid in milliseconds. He pours the liquid into the cup and stirs it around with a pencil to show it's
liquid. He then places a magnet to the bottom of the cup, and the liquid instantly turns to a near-solid. To
further demonstrate that it's turned to a solid, he holds the cup upside down, and none of the MR fluid drops
out.
by David Carlson, a physicist at the North Carolina lab
Above, MR fluid prior to magnetization. Below, the fluid turned into a solid after it was magnetized. Notice the
shiny surface of the liquid in the top photo and the dull surface in the bottom photo.
by David Carlson, a physicist at the North Carolina lab
Typical MR fluid consists of these three parts:
· Carbonyl Iron Particles -- 20 to 40 percent of the fluid is made of these soft iron particles that are just
3 to 5 micrometers in diameter. A package of dry carbonyl iron particles looks like black flour because
the particles are so fine.
· A Carrier Liquid -- The iron particles are suspended in a liquid, usually hydrocarbon oil. Water is often
used in demonstrating the fluid.
· Proprietary Additives -- The third component of MR fluid is a secret, but Lord says these additives
are put in to inhibit gravitational settling of the iron particles, promote particle suspension, enhance
lubricity, modify viscosity and inhibit wear.
So, what is it that gives MR fluid its unique ability to transform from liquid to solid and from solid to liquid
quicker than you can blink an eye? The carbonyl iron particles. When a magnet is applied to the liquid, these
tiny particles line up to make the fluid stiffen into a solid. This is caused by the dc magnetic field, making the
particles lock into a uniform polarity. How hard the substance becomes depends on the strength of the
magnetic field. Take away the magnet, and the particles unlock immediately.
© 1998-2008 HowStuffWorks, Inc.

GGGGGGGGeeeeeeeecccccccckkkkkkkkoooooooo
(new adhesive)
For super-strong nanotechnology dry adhesives look no further than the gecko
Animals that cling to walls and walk on ceilings owe this ability to micro- and nanoscale attachment elements.
The highest adhesion forces are encountered in geckos. For centuries, the ability of geckos to climb any
vertical surface or hang from ceilings with one toe has always generated considerable interest. A gecko is the
heaviest animal that can 'stand' on a ceiling, with its feet over its head. This is why scientists are intensely
researching the adhesive system of the tiny hairs on its feet. On the sole of a gecko's toes there are some one
billion tiny adhesive hairs called setae (3-130 micrometers in length), splitting into even smaller spatulae
(about 200 nanometers in both width and length) at the end. It was found that these elastic hairs induce strong
van der Waals forces. This finding has prompted many researchers to use synthetic microarrays to mimic
gecko feet. Recentwork, mainly from A. Dhinojwala, P.M. Ajayan, M. Meyyappan, and L. Dai groups, as well
as the Max Planck Institute for Metals Research in Germany has indicated that aligned carbon nanotubes
(CNTs) sticking out of substrate surfaces showed strong nanometer-scale adhesion forces.
Although carbon nanotubes are thousands of times thinner than a human hair, they can be stronger than steel,
lighter than plastic, more conductive than copper for electricity and diamond for heat.
Applications of such bio-inspired development of artificial dry adhesive systems with aligned carbon nanotubes
could range from low-tech fridge magnets to holding together electronics or even
airplane parts.
a) photo showing a stainless steel adapter of 473 g hanging on a SiO2/Si-wafer supported vertically aligned
SWCNT dry adhesive film (4mm x 4mm)
b) pre-pressed (2 kg) from the Si side onto a horizontally-placed glass surface
c) a comparison of the maximum achievable adhesion forces for:
(i) microfabricated polymer hairs
(ii) vertically aligned MWCNT
(iii) the as-grown aligned vertically aligned SWCNT.
The dashed line represents the adhesion force for gecko feet
d) a side-top view SEM image of the vertically aligned SWCNT film under a high magnification.
Copyright Wiley-VCH Verlag GmbH & Co. KGaA. Reproduced with permission.
- http://dx.doi.org/doi:10.1002/adma.200700023

- http://nanolab.me.cmu.edu/projects/geckohair/
Nature can be an inspiration for innovations in science. One such inspiration is comes from the gecko lizard
which can climb on walls and ceilings of almost any surface texture. Rather than using it's claws or sticky
substances, the gecko is able to stick to smooth surfaces through dry adhesion which requires no energy to
hold it to the surface and leaves no residue. The dry adhesion force comes from surface contact forces such
as van der Waals forces which act between all materials in contact.
Copyright © 2008 Mike Murphy & Yigit Menguc.
- http://www.lclark.edu/~autumn/dept/geckostory.html
How Geckos Stick to Walls
Nature v. 405: 681-685.
- http://polypedal.berkeley.edu/twiki/pub/PolyPEDAL/PolypedalPublications/57_adhesive_force.pdf
©Nature — from http://www.lclark.edu/~autumn/private/u38j47a0t/

- http://www.nsf.gov/discoveries/disc_summ.jsp?org=OIG&cntn_id=116297&preview=false
Researchers move one step closer to nature with the development of polymers and directional
adhesion that follow the workings of a gecko's foot.
February 9, 2010
Video on Stickybot
- http://www.nsf.gov/discoveries/disc_videos.jsp?org=OIG&cntn_id=116297&media_id=66263
Stickybot employs the same principles as a gecko through the use of dry adhesion to climb walls.
Credit: Mark R. Cutkosky, Stanford University and Sangbae Kim, MIT
- http://www.nsf.gov/news/news_summ.jsp?org=NSF&cntn_id=112445&preview=false
As Sticky as a Gecko ... but Ten Times Stronger!
By Zina Deretsky, NSF October 14, 2008
The secret behind the gecko's ability to stick so well is a forest of pillars at the micro-/nano-scale on the
underside of the gecko's foot. Because there are so many pillars so close together, they are held tightly to the
surface the gecko is walking on by a molecular force called the Van der Waals force. This relatively weak force
causes uncharged molecules to attract each other.
In an unprecedented feat, Liming Dai, at the University of Dayton, and colleagues report in the October 10th
issue of Science successful construction of a gecko-inspired adhesive that is ten times stronger than a gecko,
at about 100 newtons per square centimeter.
The researchers constructed their adhesive out of two slightly different layers of multi-walled carbon
nanotubes. The lower layer is composed of vertically-aligned carbon nanotubes, while the upper segment--
which comes into contact with the surface it is sticking to--is curly, like a mess of spaghetti.
As shown in the figure, the adhesive sticks best when it is pulled down parallel to the surface it is sticking to--
this is called shear adhesion. This action arranges the tips of the curly nanotubes so they have maximum
contact with the substrate, thereby maximizing the Van der Waals force. Pulling the adhesive off in a motion
perpendicular to the substrate is much easier--at this angle the sticking force is ten times weaker.
In this way, the adhesive has strong shear adhesion for firm attachment and relatively weak adhesion for
detachment perpendicularly to the substrate. Just like a gecko, the adhesive can stick to a wall when needed,
and then lift off easily to take the next step. This breakthrough, supported by the National Science Foundation,
will have many technological applications.

- http://www.nsf.gov/news/news_images.jsp?cntn_id=112445&org=NSF
Researchers have created a gecko-inspired adhesive with ten times the stickiness of a gecko's foot,
by combining vertically aligned nanotubes with curly spaghetti-like nanotubes.
Credit: Zina Deretsky, National Science Foundation after Liangti Qu et al., Science 10/10/2008
□ □ □ □ □

Eecs.berkeley research
- http://robotics.eecs.berkeley.edu/%7Eronf/Gecko/index.html
Biologically Inspired Synthetic Gecko Adhesives
Langmuir, Oct 2009
Combined Lamellar Nanofibrillar Array
Lamellar structures act as base support planes for high-aspect ratio HDPE fiber arrays. Nanofiber arrays on
lamella can adhere to a smooth grating with 5 times greater shear strength than flat nanofiber array
□ □ □ □ □
Gecko Tire for Model Car (Nov. 2008) Microfiber array wrapped on model car tire demonstates high friction.
(Note: so far, tire only works on smooth surfaces.)
- High friction from a stiff polymer using micro-fiber arrays, Phys. Rev. Letters, 2006

□ □ □ □ □
Directional Adhesion of Angled Microfibers (Nov. 2008)
Angled polypropylene microfibers show strong directional adhesion effects, with shear strength in direction of
fibers 45 times larger than sliding against fiber directions. A 1 sq. cm. patch supported a load of 450 grams in
shear. - Directional adhesion of gecko inspired angled microfiber arrays, Applied Physics Letters, 2008.
□ □ □ □ □
Self Cleaning Gecko Adhesive (Sep. 2008)
First synthetic gecko adhesive which cleans itself during use, as the natural gecko does. After contamination
by microspheres, the microfiber array loses all adhesion strength. After repeated contacts with clean glass, the
microspheres are shed, and the fibers recover 30% of their original adhesion. The fibers have a non-adhesive
default state, which encourages particle removal during contact.
- Contact Self-Cleaning of Synthetic Gecko Adhesive, Langmuir 2008

□ □ □ □ □
- http://robotics.eecs.berkeley.edu/~ronf/Gecko/gecko-facts.html
Gecko Adhesion Frequently Asked Questions
- http://robotics.eecs.berkeley.edu/~ronf/Gecko/gecko-compare.html
Comparison of Fibrillar Adhesives (to glass)
- http://robotics.eecs.berkeley.edu/~ronf/Gecko/prl-friction.html
High Friction from a Stiff Polymer using Micro-Fiber Arrays

MMMMMMMMeeeeeeeemmmmmmmmssssssss
- http://www.memsnet.org/mems/what_is.html
Micro-Electro-Mechanical Systems, or MEMS, is a technology that in its most general form can be defined as
miniaturized mechanical and electro-mechanical elements (i.e., devices and structures) that are made using
the techniques of microfabrication. The critical physical dimensions of MEMS devices can vary from well below
one micron on the lower end of the dimensional spectrum, all the way to several millimeters. Likewise, the
types of MEMS devices can vary from relatively simple structures having no moving elements, to extremely
complex electromechanical systems with multiple moving elements under the control of integrated
microelectronics. The one main criterion of MEMS is that there are at least some elements having some sort
of mechanical functionality whether or not these elements can move. The term used to define MEMS varies in
different parts of the world. In the United States they are predominantly called MEMS, while in some other
parts of the world they are called “Microsystems Technology” or “micromachined devices”.
While the functional elements of MEMS are miniaturized structures, sensors, actuators, and microelectronics,
the most notable (and perhaps most interesting) elements are the microsensors and microactuators.
Microsensors and microactuators are appropriately categorized as “transducers”, which are defined as devices
that convert energy from one form to another. In the case of microsensors, the device typically converts a
measured mechanical signal into an electrical signal.
A surface micromachined electro-statically-actuated micromotor fabricated by the MNX. This device is an
example of a MEMS-based microactuator.

A surface micromachined resonator fabricated by the MNX. This device can be used as both a microsensor as
well as a microactuator.
- http://www.memx.com/
This site is dedicated to providing educational material on this fascinating new technology.

EEEEEEEEccccccccoooooooollllllllooooooooggggggggyyyyyyyy
- http://community.safenano.org/blogs/andrew_maynard/archive/2008/05/21/carbon-nanotubes-the-new-
asbestos-not-if-we-act-fast.aspx
Carbon nanotubes: the new asbestos? Not if we act fast.
Carbon nanotubes have great potential as a unique material that can be used in many unique and beneficial
ways—from reducing our environmental impact to curing diseases. But mis-steps now could easily undermine
trust in this nascent industry, and prevent the material's potential from being realized.
© 2009 Andrew Maynard - http://community.safenano.org/
- http://en.wikipedia.org/wiki/Wi-Fi
Wi-Fi Pollution
Standardization is a process driven by market forces. Interoperability issues between non-Wi-Fi brands or
proprietary deviations from the standard can still disrupt connections or lower throughput speeds on all user's
devices that are within range, to include the non-Wi-Fi or proprietary product. Moreover, the usage of the ISM
band in the 2.45 GHz range is also common to Bluetooth, WPAN-CSS, ZigBee and any new system will take
its share.
Wi-Fi pollution, or an excessive number of access points in the area, especially on the same or neighboring
channel, can prevent access and interfere with the use of other access points by others, caused by
overlapping channels in the 802.11g/b spectrum, as well as with decreased signal-to-noise ratio (SNR)
between access points. This can be a problem in high-density areas, such as large apartment complexes or
office buildings with many Wi-Fi access points. Additionally, other devices use the 2.4 GHz band: microwave
ovens, security cameras, Bluetooth devices and (in some countries) Amateur radio, video senders, cordless
phones and baby monitors, all of which can cause significant additional interference. General guidance to
those who suffer these forms of interference or network crowding is to migrate to a Wi-Fi 5 GHz product,
(802.11a, or the newer 802.11n if it has 5 GHz support) as the 5 GHz band is relatively unused and there are
many more channels available. This also requires users to set up the 5 GHz band to be the preferred network
in the client and to configure each network band to a different name (SSID). It is also an issue when
municipalities, or other large entities such as universities, seek to provide large area coverage. This openness
is also important to the success and widespread use of 2.4 GHz Wi-Fi.
- http://www.organicui.org/?page_id=70
Sustainability Implications of Organic UI Technologies: An Inky Problem
The moment you have decided that sustainability is an issue with respect to interaction design and the design
of interactive devices is the moment you realize how complex the business of deciding what to actually do
about it is. It is not just a simple matter of calculating the energy and environmental costs of manufacturing,
use, salvage, and disposal of one technology over another.
For example, it was long ago claimed that computing technologies would create a paperless office—a claim
which is not yet in sight. Many people around me print things rather than read on screen. They like to hold
paper in their hands and mark things up. Ever since I acquired a portrait mode capable LCD monitor, I have
mostly stopped printing things personally. I can now read and write a whole page of text on my 1200×1600
pixel screen at once at 140% of the size it would be if I printed it. As a result, I almost never print anything
anymore. The environmental costs of the energy used to power my display must be weighed against the costs
of printing the page when I am just reading, assuming that I would actually power-off my display when I am
reading what has been printed. Furthermore, the environmental cost of production of the portrait mode display
and the environmental costs of the premature obsolescence and disposal of the display I had before this one
are also part of the equation.
by Eli Blevis © 2008 ACM and/or the authors

LLLLLLLLiiiiiiiinnnnnnnnkkkkkkkkssssssss ttttttttoooooooo ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss
Nanotechnology http://en.wikipedia.org/wiki/Nanotechnology
Printed electronics http://printedelectronics.idtechex.com/printedelectronicsworld/en/
http://www.sciencenet.cn/blog/Print.aspx?id=50678
Transparent electronics http://techon.nikkeibp.co.jp/article/HONSHI/20071024/141211/
http://www.nanowerk.com/spotlight/spotid=1858.php
http://npl.postech.ac.kr/?mid=Trans_Electronic
Gecko adhesive: http://en.wikipedia.org/wiki/Van_der_Waals_force
Electrorheological fluid: http://en.wikipedia.org/wiki/Electrorheological_fluid
Transparent solar cells http://www.hp.com/hpinfo/newsroom/press/2008/080604a.html
http://www.octillioncorp.com/OCTL_20080818.html
http://www.octillioncorp.com/nano-power.php
Solar Cell Sheet That
Collects Energy at Night http://www.nextenergynews.com/news1/next-energy-news1.7d.html
Transparent acoustic transducer http://www.freshpatents.com/Thin-film-transparent-acoustic
Transparent sound http://thefutureofthings.com/news/5967/flexible-transparent-nanotube-based-
loudspeakers.html
Witricity http://en.wikipedia.org/wiki/WiTricity
Transparent Ink http://www.inktec.com/english/product_info/electronic_tec.asp
Display http://nanoarchitecture.net/article/nanotubes-enable-flexible
http://dvice.com/archives/2008/04/firstpaper_erea.php
http://www.sciencedaily.com/releases/2008/03/080331172507.htm
Lens http://www.ibridgenetwork.org/browse/by?categories=23
Oled http://www.oled-display.net/how-works-a-transparent-oled
Samsung Mobile Display's http://www.engadget.com/2010/01/07/samsungs-14-inch-transparent-oled-
laptop-video/
Memory Device http://www.innovations-
report.com/html/reports/physics_astronomy/clear_future_electronics_transpar
ent_memory_device_124145.html
Flexible see-through battery power http://www.gizmag.com/go/7018/picture/32741/

aaaaaaaapppppppppppppppplllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss ooooooooffffffff ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttttttt oooooooorrrrrrrr fffffffflllllllleeeeeeeexxxxxxxxiiiiiiiibbbbbbbblllllllleeeeeeee eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooonnnnnnnniiiiiiiiccccccccssssssss
LG GD900 transparent keypad mobile
- http://www.gadgetlite.com/2009/03/31/pictures-lg-gd900-transparent/
More pictures of LG GD900 transparent keypad mobile ahead of CTIA 2009
March 2009
LG is increasing the buzz on its 13.4mm thick GD900 handset ahead of the upcoming CTIA Wireless Show
2009. The GD900 which you will recall was first shown at the MWC 2009, Barcelona. Its been said that this
time, the 7.2 HSPDA slider with world's first transparent glass (not plastic folks!) keypad will be functional,
running LG's new S-Class UI on the three inch display. GD900 features a vibrational haptic feedback and the
transparent keypad seems to double as a touch-sensitive mouse pad. The GD900 will be available in Europe
and Asia in May.
LG-GD900 transparent mobile

Transparent TFT-LCD
- http://techpatio.com/2009/mobiles/sony-ericsson/sony-ericsson-xperia-pureness-600-euro-november-uk-price
Transparent OLED
- http://www.engadget.com/2010/01/07/samsungs-14-inch-transparent-oled-laptop-video/

- http://www.intomobile.com/2009/04/02/lg-gd900-style-up-close-and-personal-with-the-transparent-phone/
LG GD900 Style — Up close and personal with the 'transparent' phone
by Will Thursday, April 2nd, 2009
Having a capacitance-based touchscreen and touch-sensitive keypad allows the LG Style to support multi-
touch features like pinch-to-zoom. But, the touch-interaction isn't just limited to the display — multi-touch
gestures are supported on both the touchscreen display and the keypad. The LG GD900 Style allows the user
to navigate through the UI using swiping motions on the transparent slide-out keypad. The keypad also goes
beyond simple multi-touch with its support for finger-gestures. Simply trace a _W" (or whatever movement you
choose to program) on the keypad and the LG Style will launch the web browser. Trace an _M" and you get
the music player. It makes sense.
□ □ □ □ □
TDK the transparent OLED
- http://laptopreviewshop.com/tdk-joins-the-transparent-oled-fight.html
TDK joins the transparent OLED fight
Mircea / October 4, 2010

TDK makes its entrance on the transparent OLED market with 2-inch passive matrix screen with a humble
QVGA (320 x 240) resolution. Sure, no eye-popping specs here, but a claimed 50 percent transmittance which
means that half of what's behind the screen can be seen through it, knocks out both Samsung and LG.
TDK also presented another 3.5 inch flexible OLED screen which is as thin as 0.3 mm. It's made using a resin
substrate and squeezes only 256 x 54 pixels at the moment, but TDK plans to take both technologies step by
step into the realm of awesomeness. Be sure to keep your eye on these if you find yourself at CEATEC 2010,
and who knows, maybe we'll even hear about a flexible transparent OLED screen soon if these technologies
will merge together.
□ □ □ □ □
- http://www.crunchgear.com/2010/10/05/ceatec-2010-eyes-on-with-tdks-bendable-and-transparent-oleds-video/
TDK's two passive matrix mini OLED panels
by Serkan Toto on October 2010
t this year's CEATEC: TDK's two passive matrix mini OLED panels, one of which is transparent and the other
bendable (like the one Sony showed earlier this year). What's cool is that both prototypes are showcased as
black-and-white and color models.
You can see both displays in action in the videos I took at the exhibition below.
The flexible type is just 0.3mm thin and sized at 3.5 inches. Apparently, TDK plans to start mass-producing
this panel as early next year. Its picture quality wasn't really as high as you'd want it to be, but there is still time
for improvements.
The panel with the bigger wow-factor, the see-through type, was really cool. It has a transmittance of about
50% and features QVGA resolution — which is OK, at a screen size of about 2 inches. I want one, but I am
not sure why exactly screens (of any size) would have to be transparent.
Video on TDK's displays

□ □ □ □ □
- http://www.engadget.com/2010/10/05/tdks-see-through-and-curved-oled-display-eyes-on/
TDK's see-through and curved OLED display eyes-on
By Chris Ziegler posted Oct 5th 2010
Engadget.com - By Chris Ziegler
Remember the Sony Ericsson Xperia Pureness? At a list price of $1,000, it'd be hard to forget -- but with a
monochrome see-through display, the whole transparency thing was little more than a novelty on a phone that
served little practical purpose. TDK might have the solution with its new transparent QVGA OLEDs, available
now to manufacturers in monochrome and in a lovely color variant by the end of the year. At two inches, they
offer 200ppi pixel density and are more secure than you might think: the light only shines in one direction, so
you actually can't see any data from the back even though you can still see through the display. At a glance,
the display's didn't seem as vibrant as the best AMOLEDs on the market, but then again, these are passive
matrix -- and you can really tell in our videos after the break where the refresh scans stand out.
Video
□ □ □ □ □
- http://www.gizmag.com/tdk-unveils-flexible-oled-display-at-ceatec/16569/
By Rick Martin October 5, 2010
TDK unveils flexible OLED display at CEATEC
□ □ □ □ □
- http://www.kenteklaserstore.com/Category.aspx?CategoryID=315
Toward roll-to-roll printed power sources and control electronics
Dr. Jukka Hast, Dr. Kimmo Solehmainen and Marja Vilkman, VTT Technical Research Centre of Finland
To pave the way for commercialization of printed electronics and optics applications, two European Union-
funded projects are developing roll-to-roll-based fabrication technologies.
In the first project, called FACESS (Flexible Autonomous Cost efficient Energy Source and Storage), roll-to-roll
printed organic photovoltaics and energy storage devices are being developed. In the second one, Polaric
(Printed, Organic and Large-Area Realisation of Integrated Circuits), the aim is to bring the performance of
printed electronics to a new level by combining roll-to-roll compatible high-resolution steps in the transistor
fabrication process, and to demonstrate the developed high-performance organic electronics in various
consumer applications.

Traditionally, the primary function of printing has been the delivery of data and information for visual inspection
and further interpretation by humans or machines. Nowadays, printing and other large-area R2R (roll-to-roll)-
compatible processes enable cost-efficient mass manufacturing of electronics and other functionalities on
large-area and flexible substrates such as plastic, paper and fabrics.
New printable-functional materials, print-production processes and reading mechanisms are expanding the
role and function of printing toward novel application fields. This is the opportunity gap between traditional
paper, packaging and printing industry products, and ICT/ electronics industry products, and it can realize
completely new types of applications and businesses; e.g., disposable sensors, simple “electronic”
components and circuits, large-area functional paperlike intelligent products, smart packages, tag-and-code
technology-based ICT and hybrid media services.
In the FACESS project, energy harvesting and storage are being tackled. The goal of the project partners –
VTT Technical Research Centre and Suntrica Oy, both of Finland; Interuniversity Micro-Electronics Centre of
Belgium; Commissariat à l’Energie Atomique of France; Politechnika Warszawska of Poland; Umicore SA of
Belgium; and Coatema Coating Machinery GmbH and Coatema Maschinenbau GmbH, both of Germany – is
to develop cost-efficient R2R production techniques for organic solar cell modules and rechargeable lithium
batteries.
Also in development is an application-specific integrated circuit (ASIC) chip that would optimize and control the
battery charge from the organic solar modules. To be flexible, the chip is thinned to 30 µm and interconnected
on the flexible backplane. The plan is to use R2R-compatible production technologies to manufacture an
energy storage foil of four printed organic solar cell modules comprising a 100-cm2 area, a printed battery and
an interconnected ASIC to control the charge operation. Under AM1.5, a reference organic solar cell module
can produce 250 mW of power to charge the battery. The battery size is approximately 30 cm2 and its
capacity, between 1 and 3 mAh/cm2.
In Figure, four gravure-printed organic solar cell modules operate at 2.3 percent photon-conversion efficiency
at air mass 1.5 illumination on a 15.5-cm
2
area per module. The modules are manufactured using
commercially available conductive – and photoactive – polymers. The rechargeable lithium battery has anode
and cathode electrodes screen-printed on aluminum and copper foils, and an assembled commercial
separator foil. The battery produces ~40-mAh capacity. The 30-µm-thick ASIC is flip-chip-bonded using
anisotropically conducting adhesive on the backplane substrate.
This energy storage foil is from the FACESS project

All other components of the energy source built for the FACESS project are printed, except for the electronic
part. This is because the performance limitations of printed electronic circuits force the use of traditional,
silicon-based microchips for the control electronics. To enable wholly printed devices, the printed circuits must
be improved significantly.
After the FACESS and POLARIC projects, high-performing organic electronic building blocks and
manufacturing platforms can be used in all areas of printed electronics, including sensors, memory, batteries,
photovoltaics, lighting and any combination of these devices. By combining different functionalities and blocks
on the same flexible foil, and integrating the whole process in a cost-efficient way, the huge market potential
for printed electronics and optics will turn into reality.
Meet the authors Dr. Jukka Hast is a senior research scientist; e-mail: jukka.hast@vtt.fi.
Dr. Kimmo Solehmainen also is a senior research scientist; e-mail: kimmo.solehmainen@vtt.fi. Marja Vilkman is a research scientist; e-
mail: marja.vilkman@vtt.fi. All three work at VTT Technical Research Centre of Finland, Printed Functional Solutions.
□ □ □ □ □
Flexible Autonomous Cost Efficient Energy Source and Storage = FACESS
- http://www.vtt.fi/proj/facess/index.jsp
□ □ □ □ □
- http://www.vtt.fi/proj/facess/facess_overview.jsp
Flexible Autonomous Cost Efficient Energy Source and Storage
Project overview
The general objectives of this project are the following: to manufacture efficient organic solar cells (OSC) and
a thin film battery (TFB) on flexible substrate using commercially available materials and cost efficient roll-to-
roll (R2R) mass production techniques, printing, as well as integrate a control transistor circuitry on a foil.
The ultimate goal is to integrate these three structures to a single assembly resulting in a flexible, fully
autonomous energy source. In this assembly organic solar cells harvest the solar energy and charge the thin
film batteries which provide the electricity for an external load. The Si-based transistor circuitry integrated on
the foil controls the charge operation.

IIIIIIIItttttttt’’’’’’’’ssssssss aaaaaaaa kkkkkkkkiiiiiiiinnnnnnnndddddddd ooooooooffffffff mmmmmmmmaaaaaaaaggggggggiiiiiiiicccccccc
Invisibility Cloak
- http://newscenter.lbl.gov/feature-stories/2009/05/01/invisibility-cloak/
Blurring the Line Between Magic and Science: Berkeley Researchers Create an _Invisibility Cloak"
May 01, 2009
A team led by Xiang Zhang, a principal investigator with Berkeley Lab's Materials Sciences Division and
director of UC Berkeley's Nano-scale Science and Engineering Center, has created a _carpet cloak" from
nanostructured silicon that conceals the presence of objects placed under it from optical detection. While the
carpet itself can still be seen, the bulge of the object underneath it disappears from view. Shining a beam of
light on the bulge shows a reflection identical to that of a beam reflected from a flat surface, meaning the
object itself has essentially been rendered invisible.
We have come up with a new solution to the problem of invisibility based on the use of dielectric
(nonconducting) materials," says Zhang. _Our optical cloak not only suggests that true invisibility materials are
within reach, it also represents a major step towards transformation optics, opening the door to manipulating
light at will for the creation of powerful new microscopes and faster computers."
Zhang and his team have published a paper on this research in the journal Nature Materials entitled: An
Optical Cloak Made of Dielectrics. Co-authoring the paper with Zhang were Jason Valentine, Jensen Li,
Thomas Zentgraf and Guy Bartal, all members of Zhang's research group.
These three images depict how light striking an object covered with the carpet cloak acts as if there were no
object being concealed on the flat surface. In essence, the object has become invisible.
(Image by Thomas Zentgraf)
Previous work by Zhang and his group with invisibility devices involved complex metamaterials — composites
of metals and dielectrics whose extraordinary optical properties arise from their unique structure rather than
their composition. They constructed one material out of an elaborate fishnet of alternating layers of silver and
magnesium fluoride, and another out of silver nanowires grown inside porous aluminum oxide. With these
metallic metamaterials, Zhang and his group demonstrated that light can be bent backwards, a property
unprecedented in nature.
While metallic metamaterials have been successfully used to achieve invisibility cloaking at microwave
frequencies, until now cloaking at optical frequencies, a key step towards achieving actual invisibility, has not
been successful because the metal elements absorb too much light.

Image (a) is a schematic diagram showing the cloaked region (marked with green) which resides below the
reflecting bump (carpet) and can conceal any arbitrary object by transforming the shape of the bump back into
a virtually flat object. Image (b) was taken with a scanning electron microscope image of the carpet coated
bump.
Says Zhang, _Even with the advances that have been made in optical metamaterials, scaling sub-wavelength
metallic elements and placing them in an arbitrarily designed spatial manner remains a challenge at optical
frequencies."
The new cloak created by Zhang and his team is made exclusively from dielectric materials, which are often
transparent at optical frequencies. The cloak was demonstrated in a rectangular slab of silicon (250
nanometers thick) that serves as an optical waveguide in which light is confined in the vertical dimension but
free to propagate in the other two dimensions. A carefully designed pattern of holes — each 110 nanometers
in diameter — perforates the silicon, transforming the slab into a metamaterial that forces light to bend like
water flowing around a rock. In the experiments reported in Nature Materials, the cloak was used to cover an
area that measured about 3.8 microns by 400 nanometers. It demonstrated invisibility at variable angles of
light incident.
Right now the cloak operates for light between 1,400 and 1,800 nanometers in wavelength, which is the near-
infrared portion of the electromagnetic spectrum, just slightly longer than light that can be seen with the human
eye. However, because of its all dielectric composition and design, Zhang says the cloak is relatively easy to
fabricate and should be upwardly scalable. He is also optimistic that with more precise fabrication this all
dielectric approach to cloaking should yield a material that operates for visible light — in other words, true
invisibility to the naked eye.
In this experiment, we have demonstrated a proof of concept for optical cloaking that works well in two
dimensions" says Zhang. _Our next goal is to realize a cloak for all three dimensions, extending the
transformation optics into potential applications."
This research was funded in part by the U.S. Department of Energy's Office of Science through its Basic
Energy Sciences program and by the U.S. Army Research Office.
Berkeley Lab is a U.S. Department of Energy national laboratory located in Berkeley, California. It conducts
unclassified scientific research and is managed by the University of California. Visit website at
http://www.lbl.gov.
Additional information:
A copy of the Nature Materials paper _An Optical Cloak Made of Dielectrics" by Zhang, et al., can be read here:
http://www.nature.com/nmat/journal/vaop/ncurrent/full/nmat2461.html
For more information about the research of Xiang Zhang, visit his Website at http://xlab.me.berkeley.edu/
To learn more about the earlier work by Zhang and his group on invisibility read a UC Berkeley press release at
http://www.universityofcalifornia.edu/news/article/18368

AAAAAAAAccccccccrrrrrrrroooooooonnnnnnnnyyyyyyyymmmmmmmmssssssss
See also: Nanotechnology vol.2 Technology for E-books Readers (B/W & colors display)
AFM Atomic Force Microscope
AMOLED Active Matrix Organic light emitting diode
CIGS Copper Indium Gallium Selenide (semiconductor material)
CMOS Complementary Metal-Oxide Semiconductor (transistor type)
CNT Carbon Nanotube
DEA Dielectric Elastomer Actuators
DSSC Dye sensitized solar cell or Graetzel Cell
EAP Electroactive Polymers
EW Electro-wetting
EMF Electromotive force
ERF Electrorheological fluid
ESD Electrostatic discharge
ESNAM European Scientific Network for Artificial Muscles
FFL Flat, Flexible Loudspeakers
FEC Forward error-correction (biosensors)
FET Field Effect Transistor
F-OLED Flexible Organic light emitting diode
GPS Global Position System
GUI Graphical User Interface
IPMC Ionic polymer-metal-composite
ITO Indium Tin Oxide
LAN Local area networks
LCD Liquid Crystal Display
LCM Liquid crystal module
LED Light-emitting diode
LEP Light emitting polymer
LOPE-C Large-area, Organic and Printed Electronics Convention
MEMS Micro Electronic Mechanical Systems
MR Magneto-Resistive
MRF Magnetorheological fluid
MRAM Magnetoresistive Random Access Memory - A memory fabricated using nanotechnology
which uses electron spin to store data.
MWNT Multi-walled nanotubes
NEMS Nanoelectromechanical systems
OEL Organic Electroluminescent (display technology)
OLED Organic Light-Emitting Diode
Organic UI User Interface
PANI Polyaniline
PH OLED Phosphorescent Organic Light-Emitting Diode
PDA Personal Digital Assistant (electronic handheld information device)
PDMS Polydimethylsiloxane (organic polymer)
PEN Polyethylene Naphthalate (electrical insulation material)
PET Plastic substrates: polyethylene teraphthalate
PM-OLED Passive matrix
P-OLED Polymer light emitting diode
PV Photovoltaic
RFID Radio Frequency Identification
RRAM Resistive random access memory
R2R Roll-To-Roll (manufacturing)
STM Scanning tunneling microscope
SWNT Single-walled nanotubes
TEC Transparent Electronic Conductive
TEG Thermoelectric generators
TFT Thin Film Transistor (Liquid Crystal Display, LCD technology)
TiO2 Titanium Dioxide (Photocatalyst coatings)

T-OLED Transparent organic light-emitting device
TRRAM Transparent resistive random access memory
TUI Touch User Interface
WECA Wireless Ethernet Compatibility Alliance
Wi-Fi Wireless Fidelity (IEEE 802.11 wireless networking)
WiMAX Worldwide Interoperability for Microwave Access
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________

BBBBBBBBooooooooooooooookkkkkkkkssssssss
http://www.foresight.org/nano/Bookstore.html
http://www.azonano.com/BookReview.asp?cat=5
http://www.azom.com/bookreview.asp?cat=10
http://www.materialsviews.com/view/0/books.html
http://www.worldscibooks.com/nanosci/nanosci.shtml
http://www.nanolabweb.com/index.cfm/action/main.default.searchResults/topicID/6/CFID/5216341/CFTOKEN/
29616759/index.html
Transparent Electronics
by Wager, John F., Keszler, Douglas A., Presley, Rick E.
About this title: Transparent electronics is an emerging technology that employs wide band-gap
semiconductors for the realization of invisible circuits. This monograph provides the first roadmap for
transparent electronics, identifying where the field is, where it is going, and what needs to happen to move it
forward. Although the central focus of this monograph involves transparent electronics, many of the materials,
devices, circuits, and process-integration strategies discussed herein will be of great interest to researchers
working in other emerging fields of optoelectronics and electronics involving printing, large areas, low cost,
flexibility, wearability, and fashion and design.
Computational Physics of Carbon Nanotubes
by Hashem Rafii-Tabar
About this title: Carbon nanotubes are the fabric of nanotechnology. Investigation into their properties has
become one of the most active fields of modern research. This book presents the key computational modeling
and numerical simulation tools to investigate carbon nanotube characteristics. In particular, methods applied to
geometry and bonding, mechanical, thermal, transport and storage properties are addressed.
Nanostructure Design: Methods and Protocols
by Ehud Gazit (Editor), Ruth Nussinov (Editor)
About this title: As one of the fastest growing fields of research in the 21st century, nanotechnology is sure to
have an enormous impact on many aspects of our lives. Nanostructure Design: Methods and Protocols serves
as a major reference for theoretical and experimental considerations in the design of biological and bio-
inspired building blocks, the physical characterization of the formed structures, and the development of their
technical applications.
Current Topics in Elastomers Research
by Bhowmick K Bhowmick, Anil K Bhowmick (Editor)
About this title: Written by a world-renowned expert, this concise and pioneering work explores the latest
advances in elastomers research. Discussion includes new developments with rubber, nanotechnology, and
elastomers; the direction of current research; and the new materials derived using new technologies.
Conductive Electroactive Polymers: Intelligent Polymer Systems, Third Edition
by Gordon G Wallace, Geoffrey M Spinks, Leon A P Kane-Maguire
About this title: An in-depth look at intelligent polymer systems, this third edition features new chapters on the
synthesis and fabrication of nanocomponents and nanostructures for polypyrroles, polythiophenes, and
polyanilines.

Nanostructures in Electronics and Photonics
by Faiz Rahman (Editor)
About this title: Nanotechnology is the buzzword these days. This book provides a broad overview of
nanotechnology as applied to contemporary electronics and photonics. The areas of application described are
typical of what originally set off the nanotechnology revolution.
Photonic Ink and Elastic Ink Lab-to-Market
by Ozin, Z. Anorg. Allg. Chem., 2008, 634, 1871-2100
P-Ink is made of a metallopolymer opal gel that reversibly swells and shrinks with application and removal of a
voltage. Elast-Ink is made of an elastomeric opal that undergoes reversible dimensional changes on applying
and removing a mechanical force.
Artificial Muscles: Applications of Advanced Polymeric Nanocomposites
by Professor Mohsen Shahinpoor, Kwang J Kim, Mehran Mojarrad
About this title: Smart materials are the way of the future in a variety of fields, from biomedical engineering
and chemistry to nanoscience, nanotechnology, and robotics. Featuring an interdisciplinary approach to smart
materials and structures, "Artificial Muscles: Applications of Advanced Polymeric Nanocomposites" thoroughly
reviews the existing knowledge of ionic polymeric conductor nanocomposites (IPCNCs), including ionic
polymeric metal nanocomposites (IPMNCs) as biomimetic distributed nanosensors, nanoactuators,
nanotransducers, nanorobots, artificial muscles, and electrically controllable intelligent polymeric network
structures.
Challenges in the Management of New Technologies
by Marianne Horlesberger (Editor), Mohamed El-Nawawi (Editor), Tarek Khalil (Editor)
About this title: New developments in bio- and nanotechnologies and also in information and communication
technologies have shaped the research environment in the last decade. Increasingly, highly educated experts
in R&D departments are collaborating with scientists and researchers at universities and research institutes to
develop new technologies.
Commercializing Micro-Nanotechnology Products
by David Tolfree (Editor), Mark J Jackson (Editor)
About this title: Micro-nanotechnologies are already making a profound impact on our daily lives. New
applications are well underway in the US, Asia, and Europe, but their potential disruptive nature, along with
public concerns, have produced challenges that must be overcome.
Nanotechnology: Health and Environmental Risks (Perspectives in Nanotechnology)
by Shatkin, Jo Anne
About this title: Nanotechnology promises to be the third wave of technological innovation, but the rapid
integration of nanomaterials into consumer products is not without concern. "Nanotechnological Risks"
presents various methods for evaluating health, safety, and environmental nanotechnology risks
Encyclopedia of Nanoscience and Nanotechnology, Volumes 1-10
by Smalley, Richard
About this title: Professor Richard E. Smalley, Nobel Prize Laureate in Chemistry The Encyclopedia of
Nanoscience and Nanotechnology is the world's first single most comprehensive reference source ever
published in the field of nanotechnology.
Nanotechnology: Ethics and Society
by Deb Bennett-Woods
About this title: Nanotechnology promises to be the next great human technological revolution, but such
change often comes at the price of unforeseen consequences. "Navigating the Boundaries" explores several
of the practical and ethical dilemmas presented by this technological leap. This book provides a framework for
deciding how to best take advantage of nanotechnology opportunities while minimizing potential negative
effects

Nanotechnology 101
by John Mongillo
About this title: What should the average person know about science? Because science is so central to life in
the 21st century, science educators and other leaders of the scientific community believe that it is essential
that everyone understand the basic concepts of the most vital and far-reaching disciplines. "Nanotechnology
101" does exactly that.
Organic Nanostructures
by Jerry L Atwood (Editor), Jonathan W Steed (Editor)
About this title: Filling the need for a volume on the organic side of nanotechnology, this comprehensive
overview covers all major nanostructured materials in one handy volume. Alongside metal organic
frameworks, this monograph also treats other modern aspects, such as rotaxanes, catenanes, nanoporosity
and catalysis
Nanotechnology for Dummies
by Richard Booker, Earl Boysen
About this title: This title demystifies the topic for investors, business executives, and anyone interested in how
molecule-sized machines and processes can transform our lives. Along with dispelling common myths, it
covers nanotechnology's origins, how it will affect various industries, and the limitations it can overcome. This
handy book also presents numerous applications such as scratch-proof glass, corrosion resistant paints, stain-
free clothing, glare-reducing eyeglass coatings, drug delivery systems, medical diagnostic tools, burn and
wound dressings, sugar-cube-sized computers, mini-portable power generators, even longer-lasting tennis
balls, and more.
The Nanotech Pioneers: Where Are They Taking Us
by Steven A Edwards
About this title: Hype, hope, or horror? This work is a vivid look at nanotechnology, written by an insider and
experienced science writer. The variety of new products and technologies that will spin out of nanoscience is
limited only by the imagination of the scientists, engineers and entrepreneurs drawn to this new field. Steve
Edwards concentrates on the reader's self interest: no military gadgets, wild fantasies of horror nanobot
predators and other sci-fi stuff, but presents a realistic view of how this new field of technology will affect
people in the near future.
Molecular Devices and Machines: A Journey Into the Nanoworld
by Vincenzo Balzani, Margherita Venturi, Alberto Credi
About this title: The miniaturization of bulky devices and machines is a process that confronts us on a daily
basis. However, nanoscale machines with varied and novel characteristics may also result from the
enlargement of extremely small building blocks, namely individual molecules. This bottom-up approach to
nanotechnology is already being pursued in information technology, with many other branches about to follow.
Written by a team of experienced authors headed by Vincenzo Balzani, one of the pioneers in the
development of molecular machines Covers such diverse aspects as sensors, memory components, solar
energy conversion, biomolecules as molecular machines, and much more
Transparent Electronics: From Synthesis to Applications
Antonio Facchetti (Editor), Tobin Marks (Editor)
ISBN: 978-0-470-99077-3
Hardcover 470 pages April 2010
Structured to strike a balance between introductory and advanced topics, this monograph juxtaposes
fundamental science and technology / application issues, and essential materials characteristics versus device
architecture and practical applications. The first section is devoted to fundamental materials compositions and
their properties, including transparent conducting oxides, transparent oxide semiconductors, p-type wide-
band-gap semiconductors, and single-wall carbon nanotubes. The second section deals with transparent
electronic devices including thin-film transistors, photovoltaic cells, integrated electronic circuits, displays,
sensors, solar cells, and electro-optic devices.

Nanotechnology: New Promises, New Dangers
by Toby Shelley
Zed Books: 2006. 208 pp.
Toby Shelley's book Nanotechnology provides a short, accessible primer on the world of nanotechnology —
the revolutionary realm of seeing, measuring, controlling and making things on the scale of atoms and
molecules. It raises key questions about how this disruptive technology will affect human health, the
environment, civil liberties, weaponry, and people in developing countries.
Microstrip and Printed Antennas
New Trends, Techniques and Applications
1. Edition - November 2010 504 Pages, Hardcover
ISBN-10: 0-470-68192-6
ISBN-13: 978-0-470-68192-3 - John Wiley & Sons
This book focuses on new techniques, analysis, applications and future trends of microstrip and printed
antenna technologies, with particular emphasis to recent advances from the last decade. Attention is given to
fundamental concepts and techniques, their practical applications and the future scope of developments.
Several topics, essayed as individual chapters include reconfigurable antenna, ultra-wideband (UWB)
antenna, reflectarrays, antennas for RFID systems and also those for body area networks. Also included are
antennas using metamaterials and defected ground structures (DGSs). This book provides a reference for
R&D researchers, professors, practicing engineers, and scientists working in these fields.
Chapters 1-4 Presentation Slides for
Science at the Nanoscale: An Introductory Textbook
by Chin Wee Shong, Sow Chorng Haur & Andrew T. S. Wee
National University of Singapore
ISBN: 9789814241038 August 2009 228 pages
- http://www.panstanford.com/books/nanosci/v004.html
Unbounding the Future: the Nanotechnology Revolution
By Eric Drexler and Chris Peterson, with Gayle Pergamit
William Morrow and Company, Inc.New York
This book delivers a rich array of micro-scenarios of nanotechnology at work, some thrilling,
some terrifying, all compelling. Probably none represent exactly what will happen, but in aggregate
they give a deep sense of the kind of thing that will happen. Strategies of how to stay ahead of the
process are proposed, but the ultimate responsibility for the wholesome use and development of
nanotechnology falls on every person aware of it. That now includes you. — Stewart Brand
http://crnano.org/unbounding.htm
Jet-printed Si nanowires for flexible backplane applications
W.S. Wong, S. Raychaudhuri, S. Sambandan, R. Lujan, R.A. Street
ISBN: 978-1-4398-3402-2 - Pages: 862
The integration of Si nanowire (Si NW) materials with low-temperature plastic substrates can enhance the
performance of low-cost flexible electronics. We report the properties of Si NW field-effect transistors (FETs)
fabricated with various contact metals and passivation layers. We also demonstrate the use of
dielectrophoresis and inkjet printing to pattern and assemble active matrix display backplane arrays of Si NW
FETs from a liquid suspension.
Brochure: " Nanotechnology: Innovation for tomorrow's world "
Brochure of the European Commission to illustrate to the public what nanotechnology is
Brochure is available as pdf in Danish, German, English, Greek, Spanish, French, Italian, Dutch, Polish,
Portuguese, Slovenian, Finnish, Swedish, Arab, Chinese, Russian , Czech, Slovak and in Estonian.
http://cordis.europa.eu/nanotechnology/src/pe_leaflets_brochures.htm
This site is designed to help you find out about European Research. Whether you are a researcher or a
teacher, in business or in politics, there is something for you here. You can read about the latest political
decisions, or the latest advances in research; there is even a set of online leaflets about European Research
in Action, written for the non-specialist and available in 11 or more languages.
http://ec.europa.eu/research/index.cfm?lg=en&pg=about

7 things every reporter should know before writing about nanotechnology and 7 questions to ask every _nano"
company
by Nathan Tinker, PhD, Senior Director The Nanotech Company, with Darrell Brookstein, Managing Director
http://www.merlinq.nl/index.php?option=com_content&task=view&id=280&Itemid=74
What are nanoscience and nanotechnologies?
http://www.nanotec.org.uk/finalReport.htm
For Italian readers:
Quanto è piccolo il mondo. Sorprese e speranze dalle nanotecnologie
Pacchioni Gianfranco, 2007, Zanichelli
Cosa sono le nanotecnologie. Istruzioni per l'uso della prossima rivoluzione scientifica
Narducci Dario,2008, Sironi (collana Galápagos)
Brochure: " La Nanotecnologia: Innovazione per il mondo di domani "
http://cordis.europa.eu/nanotechnology/src/pe_leaflets_brochures.htm
JJJJJJJJoooooooouuuuuuuurrrrrrrrnnnnnnnnaaaaaaaallllllll PPPPPPPPaaaaaaaappppppppeeeeeeeerrrrrrrrssssssss
http://rogers.mse.uiuc.edu/publications.html
Journal Papers on Transparent Electronics
Disclaimer: The PDF documents on this WebPages are provided for educational and personal purposes alone and are
subject to their respective publisher's copyrights.
J. Yoon, A.J. Baca, S.-I. Park, P. Elvikis, J.B. Geddes, L. Li, R.H. Kim, J. Xiao, S. Wang, T.H. Kim, M.J.
Motala, B.Y. Ahn, E.B. Duoss, J.A. Lewis, R.G. Nuzzo, P.M. Ferreira, Y. Huang, A. Rockett and J.A. Rogers,
_Ultrathin Silicon Solar Microcells for Semitransparent, Mechanically Flexible and Microconcentrator Module
Designs," Nature Materials 7, 907-915 (2008).
S. Jeon, D.J. Shir, Y.S. Nam, R. Nidetz, M. Highland, D.G. Cahill, J.A. Rogers, M.F. Su, I.F. El-Kady, C.G.
Christodoulou and G.R. Bogart, _Molded Transparent Photopolymers and Phase Shift Optics for Fabricating
Three Dimensional Nanostructures," Optics Express 15(10), 6358-6366 (2007).
Q. Cao, Z.T. Zhu, M.G. Lemaitre, M.G. Xia, M. Shim and J.A. Rogers, "Transparent Flexible Organic Thin-Film
Transistors That Use Printed Single-Walled Carbon Nanotube Electrodes," Applied Physics Letters 88,
113511 (2006).
http://www.interscience.wiley.com
Wiley InterScience® is a leading international resource for scientific, technical, medical and scholarly content.
http://www3.interscience.wiley.com/journal/10008336/home
Advanced Materials
http://www3.interscience.wiley.com/journal/117935002/grouphome
Advanced Functional Materials
Advanced Engineering Materials
Nanomedicine and Nanobiotechnology

LLLLLLLLiiiiiiiinnnnnnnnkkkkkkkkssssssss
http://www.nano.org.uk
The Institute of Nanotechnology (IoN) is a registered Charity, whose core activities are focused on education and training
in nanotechnology, in the widest sense. The Institute was one of the world's first nanotechnology information providers and
is now a global leader.
http://www.crnano.org/whatis.htm
The Center for Responsible Nanotechnology (CRN) is a non-profit research and advocacy think tank concerned with the
major societal and environmental implications of advanced nanotechnology.
http://www.nanowerk.com
Nanowerk is committed to educate, inform and inspire about nanosciences and nanotechnologies.
http://nanotechweb.org/cws/home
Nanotechnology journal
http://thefutureofthings.com
The Future of Things (TFOT) is an online magazine dedicated to bringing original content on science,
technology, and medicine from around the world.
http://www.citala.com/index.php
A leader in flexible displays, Citala is the pioneer of the Active Pixel Display (APD_)—a flexible reflective display that
represents a paradigm shift in the display arena.
http://www.electroscience.com/smartcardappnotes.html
Thick-Film Materials and Ceramic Tapes
http://www.cdtltd.co.uk
Cambridge Display Technology, a subsidiary of Sumitomo Chemical, leads the development of display technology based
on polymer organic light emitting diodes (P-OLEDs).
http://www.vdma.org/wps/portal/Home/en
The Organic Electronics Association is a working group within VDMA, representing the whole process chain in organic
electronics like e.g. plastic chips, organic displays, sensors and photovoltaics. Our members are international leading
companies and institutions and include component and material suppliers, equipment and tool suppliers, producers and
system integrators, end-users and research institutes.

http://www.nanotechobserver.com/
Nanotech Observer is a multilingual, Web-based, free-content encyclopedia project based mostly on anonymous
contributions. Nanotech Observer's articles provide links to guide the user to related pages with additional information.
http://printedelectronics.idtechex.com/printedelectronicsworld/en/
Printed Electronics World provides you with a daily update of the latest industry developments. Launched in May 2007, this
free portal covers the progress to printed electronics in all its forms - from transistor circuits to power, sensors, displays,
materials and manufacturing.
http://www.sciencedaily.com
ScienceDaily is one of the Internet's leading online magazines and Web portals devoted to science, technology, and
medicine.
http://www.nanoforum.org/
European Nanotechnology Community
Nanoforum has produced Nanotechnology Education Tree which is designed to give an introduction to nanotechnology
applications in health, the environment, energy, electronics and modern life
http://www.nanotech-now.com
Very much like a White Paper, we seek to provide a forum and format that helps clarify nanotechnology and nanoscale
science, to laymen, general business persons, non-specialists, highly skilled technicians, professionals, and academics."
http://www.foresight.org
Founded in 1986, we were the first organization to educate society about the benefits and risks of nanotechnology. At that
time our focus was on preparing society for nanotechnology, then a little known science and technology.
http://www.zyvex.com
We started Zyvex to develop practical uses for molecular nanotechnology to transform how we make physical goods —
creating clean, flexible, and powerful manufacturing for the 21st century.
http://www.sciencemuseum.org.uk/antenna/nano
The Science Museum provides an educational and interactive overview of nanotechnology
http://www.nanotechproject.org/consumerproducts
An inventory of nanotechnology-based consumer products currently on the market.
http://www.rmnanotech.com
RMNanotech.com contains links to sites where you can purchase Nanotechnology products and
Nanotechnology books.
http://www.almaden.ibm.com/st/nanoscale_st/
IBM Research at Almaden participates in a wide variety of activities that fall under the broad scope of nanoscale science
and technology. The activities span synthesizing nanoscale materials, nanoscale fabrication for creating nanoscale
structures and devices, and developing novel methods to probe and manipulate atoms.
http://www.cordis.europa.eu/nanotechnology
Nanotechnology Homepage of the European Commission
http://www.nano.gov
The National Nanotechnology Initiative (NNI) is the program established in fiscal year 2001 to coordinate Federal
nanotechnology research and development.
http://www.futuretechnologycenter.eu
The Future Technology Center offers forecasting services on new technologies based on continuous tracking and trend
analysis of global technological developments.
http://www.physorg.com/nanotech-news/
Internet news portal provides the latest news on science including: Physics, Space Science, Earth Science, Health and
Medicine
http://community.safenano.org/
The UK's premier source of information on nanoparticle hazard, and nanotoxicology
http://www.oled-display.net This site informs about OLED - Organic light emitting diodes

http://www.nanotech.it Italian
http://www.venetonanotech.it Italian
http://www.nanotecnologica.com Spanish
http://www.nanovip.com video — Spanish
http://www.nanomicro.recherche.gouv.fr/fr/cnano.html French
http://fr.wikipedia.org/wiki/Nanotechnologie French
http://www.mannometer-nanometer.de German
http://nanonet.mext.go.jp Japanese/English
NanotechJapan is the official web site for the Nanotechnology Network Project (2007-2012) funded by the Japanese
Ministry of Education, Culture, Sports, Science and Technology (MEXT). The primary aim of the Project is to provide
nanotechnology researchers with access to advanced research facilities of the participating institutions.
http://www.aist.go.jp/index_en.html Japanese/English
National Institute of Advanced Industrial Science and Technology (AIST)
http://www.nanochina.cn/ Chinese/English
NanoChina.cn provides a bridge between the nanotechnology activities that are taking place in China and the rest of the
world, with the aim of disseminating information and setting up nano-business and networking opportunities.
SSSSSSSShhhhhhhhoooooooowwwwwwww////////CCCCCCCCoooooooonnnnnnnnvvvvvvvveeeeeeeennnnnnnnttttttttiiiiiiiioooooooonnnnnnnn////////EEEEEEEExxxxxxxxppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiioooooooonnnnnnnn
Bvents is the largest source of information on conferences, tradeshows, conventions, corporate events and
exhibitions worldwide.
http://www.bvents.com
BBBBBBBBllllllllooooooooggggggggssssssss
Top 50 Nanotech & Biomaterial Blogs
by Miranda on January 12, 2010
http://mastersinhealthinformatics.com/2010/top-50-nanotech-biomaterial-blogs/
50 Forward Thinking Nanotech Blogs
http://becomingacomputertechnician.com/?page_id=98
http://www.gizmag.com
http://www.engadget.com
http://us.gizmodo.com
http://www.crunchgear.com
http://www.howtogeek.com
Italian Blogs
http://www.blogtopsites.com/technology/italian
http://chiacchieresulnano.blogspot.com/search/label/nanotecnologie

TTTTTTTToooooooooooooooollllllllbbbbbbbbooooooooxxxxxxxx
http://www.nanoword.net
Nanoword.net is an online nanotechnology resource focusing on education of the general public and distribution of
nanotech products.
http://www.nanoengineer-1.com/mambo
Founded in 2004, Nanorex Inc. is a developer of open-source computational modeling tools for the design and analysis of
atomically precise nanosystems.
http://www.ides.com/?source=.NetProspector Plastic Properties
http://www.plastics-extrusion.co.uk Plastic Properties
http://www.dynalabcorp.com/home_defaultpage.asp Plastic Properties
http://www.claremicronix.com/ o Products o Display Drivers o E Ink and ePaper
http://www.wikipedia.com Free Online Encyclopedia
http://www.howstuffworks.com
HowStuffWorks, a wholly owned subsidiary of Discovery Communications, is the award-winning source of credible,
unbiased, and easy-to-understand explanations of how the world actually works.
http://www.google.com Internet search engine
http://www.thefreedictionary.com/ Free Online Dictionary, Thesaurus, Encyclopedia, Acronyms
http://www.patentstorm.us/
PatentStorm offers full-text U.S. patents and patent applications from the U.S. Patent Office, providing advanced search
capabilities and full image retrieval in handy PDF format.
http://www.wipo.int/portal/index.html.en Patents and patent applications
http://translate.google.com Online translator
http://world.altavista.com Online translator
http://www.babylon.com Online / Offline translator

iiiiiiiiPPPPPPPPaaaaaaaadddddddd && iiiiiiiiPPPPPPPPhhhhhhhhoooooooonnnnnnnneeeeeeee aaaaaaaapppppppppppppppplllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss ffffffffoooooooorrrrrrrr NNNNNNNNaaaaaaaannnnnnnnooooooootttttttteeeeeeeecccccccchhhhhhhh
iPhone
- AzoNano http://www.azonano.com/iphone/
The AZoNanotechnology App from wwww.azonano.com — The A to Z of Nanotechnology,
represents the world of Nanotechnology in the palm of your hand.
- findNano http://www.nanotechproject.org/news/archive/8295/
findNano allows users to browse an inventory of more than 1,000 nanotechnology-enabled
consumer products, from sporting goods to food products and electronics to toys, using the
iPhone and iPod Touch. Using the built-in camera, iPhone users can even submit new
nanotech products to be included in future inventory updates.
- Nanovip http://www.nanovip.com/free-nanovip-app
Nanovip is an online Nanotechnology Portal bringing you the latest nanotech news, jobs and
more. Updated in real time
- PhysOrg.con News Lite http://www.physorg.com/help/iphone/
- Technology News
This news application will provide you the relevant information of all type of academic and
research technologies. Like biotechnology, Information technology, Auto technology,
communication, computing, Biometrics, nanotechnology, robotic technology and so on
- Tiscali http://itunes.apple.com/it/app/tiscali/id361736404?mt=8
Italian Apps
iPad
- PhysOrg.con News Lite HD http://www.physorg.com/help/ipad/
- Tiscali per iPad http://itunes.apple.com/it/app/tiscali-per-ipad/id396097628?mt=8
Italian Apps

AAAAAAAAnnnnnnnnddddddddrrrrrrrrooooooooiiiiiiiidddddddd aaaaaaaapppppppppppppppplllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss ttttttttoooooooo rrrrrrrreeeeeeeeaaaaaaaadddddddd RRRRRRRRSSSSSSSSSSSSSSSS NNNNNNNNaaaaaaaannnnnnnnooooooootttttttteeeeeeeecccccccchhhhhhhh
http://www.talkandroid.com/8805-top-5-android-rss-readers/
gReader
gReader is an RSS feed client that allows you to view your feeds by site, or view all at the
same time
FeedR
FeedR allows you to view you feeds by category. Even better, you can color code your
categories so that you can find the news that you want to read fast.
FastReader
FastReader is an RSS feed client that gets you your news in a time efficient manner. The app
has 2 tabs, one that shows you each feed, and another that lets you view all of the feeds at
once.
FeedSquares
FeedSquares is not your ordinary RSS reader. In fact, there are no apps like it. Instead of
giving you a boring list of your feeds, FeedSquares gives you colorful boxes that represent
each feed. If you only have one or two feeds that you get news from, then this app is not for you. But if you
have a bunch of news from a bunch of places, then look no further.
NewsRob
NewsRob is a very sleek app that gets you your news from your Google Reader account.
Comparison

22222222000000001111111111111111 UUUUUUUUppppppppddddddddaaaaaaaatttttttteeeeeeee
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………
…………………………………………………………………………………………………………

BIODOMOTICABIODOMOTICABIODOMOTICABIODOMOTICA®
Massimo Marrazzo
www.biodomotica.com info@biodomotica.com
Disclaimer
No one can sell or ask money for this e-book.
Every info in this document is available free on Internet, like this e-book.
I don’t receive money or any other benefits by the companies cited.
I’m not responsible for errors, damages, mistakes o any fraud by websites listed in this e-book.
If you don’t want be mentioned here just write me an email to (info@biodomotica.com)
and I’ll delete any reference of you from this e-book.
Copyright © 2011 Massimo Marrazzo - Biodomotica
This document may be used and distributed provided that this copyright statement is not removed
from the file and that any derivative work contains the original copyright notice.
If you want reproduce, distribute, print articles mentioned in this e-book
you must contact owners of copyright, not me.
Any of the trademarks, service marks, collective marks, design rights or similar rights that are mentioned,
used or cited in “A foldable World” are the property of their respective owners.

Foldable world

More Related Content

What's hot

Similar to Foldable world

More from Massimo N. Marrazzo - マッラッツォ ・ マッシモ

Recently uploaded

Foldable world

More from Massimo N. Marrazzo - マッラッツォ・マッシモ