FINAL PERSONAL TAKEAWAYS
Action Plan
Take a few minutes and complete this Action Plan about driving for results.
Driving for Results
Self-Handicaps
What is the
Situation
Trigger Impact on
Others
What to Do/When
Having no personal
vision/action plan
___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Developing mastery
goals for yourself
(Getting yourself
straight)
___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Modeling mastery
and creating an
environment of
mastery for
employees
___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Avoiding Challenge ___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Staying “busy”
without aligning
processes with
outcomes
___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Day dreaming
without results
___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Allowing distractions ___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Making work
meaningful for
employees
___Expedient
___Avoiding
___Apprehension
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
Baby Steps
This chapter is the final step in eliminating self-handicapping. Lots of issues were discussed, but here are
a few baby steps for you to implement now.
The baby steps for this chapter are:
1. Every day, start with a small and easy task that you can complete quickly - Don’t forget to make
your bed every morning! Be proud of it.
2. Write out a personal vision of building competence and develop an action plan that aligns with
that vision.
3. From the plan, identify a longer-term goal and break it down into yearly, monthly, and weekly
target checkpoints.
4. Take a piece of paper and write down all of the things you did last week that were not mastery-
oriented. What did you do to be better or to stay out of trouble? Think about the proportion of
time spent in performance goals and how that is affecting your career.
Follow Up Question ...
The 7 Habits of Highly Effective People (summary).pdfBishwajitSingh6
It's a summary of "The 7 Habits of Highly Effective People" a book written by Stephen R. Covey that is very useful for our life improvement if we can practice.
Six Powerful Tips to become successful and productivekomalnan123
The document discusses factors that contribute to success, including perception, attitude, and background. It states that successful people have a positive attitude, learn from mistakes, and spend time with productive people. The document then provides 6 steps to become successful: face challenges; identify weaknesses, skills, and goals; be honest; find role models; have patience; and don't stop after initial success. It encourages continuous self-improvement and remaining motivated.
Setting and achieving goals provides numerous personal and professional benefits. Some key benefits include staying focused, gaining a sense of control over one's life, matching actions to priorities, and helping others understand one's motivations. When setting goals, it is important to ensure they are specific, measurable, achievable, relevant, and time-bound. Proper goal setting involves assessing ability and enthusiasm, listing tasks, establishing timelines, and evaluating progress.
The document discusses how business success is increased when both hard skills (technical/measurable skills) and soft skills (relationship skills) are utilized together in a balanced way. Soft skills like communication, teamwork and problem solving are important for business success but can be difficult to measure. The objective is to explore how to determine the right balance of hard and soft skills for greatest business impact. Coaching is presented as an effective way to improve soft skills by changing thinking patterns and developing more effective solutions.
Coaching for Growth and Development Part 1 - Do you have a Growth Mindset?Mindstrong Ltd
Coaching individuals and teams to encourage growth and personal development requires a growth mindset. Before they can begin coaching others, leaders must first identify whether or not they have the right mindset for success.
This document provides an overview of an entrepreneurship webinar series that will cover topics to help attendees become entrepreneurs and start small businesses in Manitoba. The webinar will be presented in sections on different dates, covering self-assessment, research, legal procedures, and guest speakers. Objectives include learning what entrepreneurship is, the steps to start a business, and must-have skills. The document outlines various aspects of entrepreneurship like risk perception, stress management, goal orientation, and the skills needed to succeed. Self-awareness and evaluation are emphasized to help attendees identify their strengths and growth areas.
The 7 Habits of Highly Effective People (summary).pdfBishwajitSingh6
It's a summary of "The 7 Habits of Highly Effective People" a book written by Stephen R. Covey that is very useful for our life improvement if we can practice.
Six Powerful Tips to become successful and productivekomalnan123
The document discusses factors that contribute to success, including perception, attitude, and background. It states that successful people have a positive attitude, learn from mistakes, and spend time with productive people. The document then provides 6 steps to become successful: face challenges; identify weaknesses, skills, and goals; be honest; find role models; have patience; and don't stop after initial success. It encourages continuous self-improvement and remaining motivated.
Setting and achieving goals provides numerous personal and professional benefits. Some key benefits include staying focused, gaining a sense of control over one's life, matching actions to priorities, and helping others understand one's motivations. When setting goals, it is important to ensure they are specific, measurable, achievable, relevant, and time-bound. Proper goal setting involves assessing ability and enthusiasm, listing tasks, establishing timelines, and evaluating progress.
The document discusses how business success is increased when both hard skills (technical/measurable skills) and soft skills (relationship skills) are utilized together in a balanced way. Soft skills like communication, teamwork and problem solving are important for business success but can be difficult to measure. The objective is to explore how to determine the right balance of hard and soft skills for greatest business impact. Coaching is presented as an effective way to improve soft skills by changing thinking patterns and developing more effective solutions.
Coaching for Growth and Development Part 1 - Do you have a Growth Mindset?Mindstrong Ltd
Coaching individuals and teams to encourage growth and personal development requires a growth mindset. Before they can begin coaching others, leaders must first identify whether or not they have the right mindset for success.
This document provides an overview of an entrepreneurship webinar series that will cover topics to help attendees become entrepreneurs and start small businesses in Manitoba. The webinar will be presented in sections on different dates, covering self-assessment, research, legal procedures, and guest speakers. Objectives include learning what entrepreneurship is, the steps to start a business, and must-have skills. The document outlines various aspects of entrepreneurship like risk perception, stress management, goal orientation, and the skills needed to succeed. Self-awareness and evaluation are emphasized to help attendees identify their strengths and growth areas.
An overview of the How to Start a Small Business webinar series for newcomers. Also outlines the steps of self-evaluation to see if one can be a small business owner
"Motivation: A different perspective" is written based on various literature review on sustainability of performance - organisational culture/behaviour/creativity/ people processes, motivation etc. It brings two specific perspectives: "SPLITS & CARE". My recent interaction with Balaji Prof C who has developed an interesting process known as "Causing Incredible Performance" with remarkable impact on people and organisations - mainly focusing on rewiring their internal voices has further validated my perspectives. Kindly provide your insights on it.
This document discusses various aspects of leadership including setting goals, providing vision, inspiring employees, training and coaching, learning, power and motivation. It emphasizes that effective leaders provide a clear vision and involve employees in setting realistic and attainable goals. Leaders must inspire employees and gain their trust by displaying energy and a positive attitude. Training, coaching, feedback and addressing barriers are important for developing employees. While power can force compliance, leadership influences others to willingly achieve goals. Motivation depends on needs and the perception that certain actions will help satisfy those needs.
Why Your Strategic Plan Does Not Get Executed and What You Can Do About ItHowardLitwak
There is nothing more important than making sure that your strategy is executed in a timely and efficient manner.
Execution disciplines help improve the linkage between your plan and your desired results.
If you are not getting the results you want, this may be the most important presentation you ever view!
Review, synthesize, and reflect on data you have collected about y.docxronak56
Review, synthesize, and reflect on data you have collected about yourself. Weekly discussion in lab will help you to construct this SRL profile. The SRL profile creates an opportunity to draw on data from your weekly self assessments and weekly My Planners to review and summarize your strengths and weaknesses in terms of engagement, SRL, motivation, anxiety, emotion regulation, procrastination, time management, task understanding, goal setting, etc. Summarize and present a profile of YOU. The assignment will conclude with an SRL change plan in which you will choose to tackle/change one problem over the remaining part of the semester in terms of: (a) behavior/s, (b) thinking, (c) motivation, or (d) emotions/affect.
Prepare your answer in word or some other format. Cut and paste it into the text window for this assignment.
You must answer the following questions. This assignment should not exceed 1500:
(1) STRENGTHS: Looking across the topics and self-assessments covered to date, what are my main strengths? How can I leverage those strengths in taking control of my university success?
(2) WEAKNESSES: Looking across the topics and self-assessments covered to date, what are my main weaknesses? Why might addressing those weaknesses be important for taking control of my university success?
(3) CHALLENGES: After reviewing my 6 MyPlanners to date, these are the critical patterns I see in my weekly attempts to take control of my learning. For this you should pay particular attention to: (a) engagement (Q. 1), (b) Goal attainment (first question after STOP sign), (c) Challenges - particularly patterns over time in the challenges that get in your way, (d) Other things such as feeling or motivation reported in the myPlanner.
(4) TARGET FOR CHANGE: Based on what you have summarized above, identify and justify one main thing you want to tackle in the remaining part of the semester. This should be something you want to take control of. It should be something you see as critical for your success in one (or more) of your other courses. Be explicit about whether the thing you want to change is about changing a: (a) behavior, (b) cognitive process or outcome, (c) motivation, or (d) feeling (emotion/affect).
(5) HOW WILL YOU EVALUATE YOUR SUCCESS? What data do you need to collect to figure out if you have been successful in tackling/addressing that target for change. In addition list 5 self-assessments you would like to redo at the end to self-evaluate your change.
Weekly Self-regulated learning assessment
1. Week 1
My strengths are knowing to creating goals and finding the correct adjustment to correct the problem.Through the report, the scores of planning, information management strategy and debugging strategies are relatively high. Personally, I am used to setting goals and planing before I started to learning, and I am satisfied with the good performance in organizing and engage in learning information more efficiently during the process. I also focu ...
a presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goals a presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goals
Much of our ideas about motivating others are inconsistent with what science says. This presentation describes three commonly used methods to motivate. Only one is under the control of all pharmacists and pharmacy personnel.
Network For Teaching Entrepreneurship PresentationBedazzled Media
This document outlines the agenda and objectives for an NFTE Operation: Mindset program. The daily agenda includes identifying skills of successful entrepreneurs, discussing the importance of an entrepreneurial mindset for post-secondary planning, and constructing an action plan. Students are asked to self-assess their entrepreneurial characteristics and skills in order to determine opportunities and areas for growth. Key entrepreneurial traits discussed include creativity, problem-solving, communication, and initiative. Students then work in groups to create action plans around adopting an entrepreneurial mindset.
This document discusses goal setting and how to effectively set goals. It defines what goals are and explains the importance of setting goals. Some key points made include:
- Goals give direction, motivate achievement, and help visualize priorities and plans.
- Effective goals are specific, measurable, attainable, realistic, and time-bound.
- Goals should be self-chosen, moderately difficult, written down, and flexible.
- Large goals should be broken down into smaller, action-oriented steps to stay on track.
- Setting too many goals, unrealistic goals, or goals beyond one's control can undermine effective goal setting.
This document discusses various aspects of effective management. It begins by explaining the importance of managers in organizations and their responsibilities. It then discusses skills managers should focus on developing, including creativity, emotional intelligence, interpersonal skills, team-building, leadership, time management, dealing with stress, and cultural sensitivity. Throughout the document, it provides examples and tips managers can use to strengthen these skills and become more effective in their roles.
This document contains information about setting and achieving goals, including 10 chapters on various aspects of goal setting. It begins with terms and conditions for the content and a table of contents listing the chapter topics, which include identifying goals, defining goals clearly, aligning goals with beliefs, committing to goals, getting others onboard, setting deadlines, and visualizing goals. The overall message is that properly identifying, defining, committing to, and visualizing goals can help people achieve their objectives.
Professional development for strategic managersMohyee3liShahin
The document outlines a personal development plan for a leader. It begins with conducting a skills audit to evaluate the leader's current skills and identify any gaps needed to meet leadership requirements. Various techniques are used to assess the leader's preferred learning style and professional skills. Next, a personal development plan is constructed to develop skills in areas like decision making, delegation, self-confidence, and conflict management. Objectives and measurements for success are outlined for each skill. Finally, suitable methods like SMART goals and performance reviews will be used to assess the outcomes of the personal development plan against the leader's work objectives.
This document discusses various aspects of effective management. It begins by explaining the importance of managers in organizations and their responsibilities. It then discusses skills managers should focus on developing, including creativity, emotional intelligence, interpersonal skills, team-building, leadership, time management, dealing with stress, and cultural sensitivity. Throughout the document, it provides examples and tips managers can use to strengthen these skills and become more effective in their roles.
Chapter 16 Becoming a World-Class Employee and LeaderLecture 1.docxcravennichole326
This lecture discusses key concepts related to becoming a world-class employee and leader, including:
- How good communication skills help organizations succeed by allowing them to set objectives, lead teams, communicate clearly, and achieve results.
- How to find and keep passion for work by pursuing interests, helping others, and feeling valued.
- Why it is important to establish healthy boundaries at work to avoid burnout and communicate effectively even under pressure.
- How to exceed expectations by going above job requirements, developing a positive attitude, and adding value.
This is the 5 steps to master everyday leadership skills, you will discover the topics about learning what leadership skills are, accessing your skills, become self aware, practice courage and move into actions
Transitions are a critical time for leaders at all levels. Missteps made during the crucial first three months in a new role can jeopardize your success.
In this updated and expanded version of the international bestseller, Michael D. Watkins offers proven strategies for conquering the challenges of taking on a new role — no matter where you are in your career. Watkins, a noted expert on leadership transitions, also addresses today’s increasingly demanding professional landscape, where managers face more frequent changes and steeper expectations when they start their new jobs.
Whether you’re starting a new job, being promoted from within, or embarking on an overseas assignment, this is the guide you’ll need to succeed in your first 90 days — and beyond.
This document discusses various motivation techniques for employees and self-motivation. It outlines intrinsic and extrinsic motivational approaches and provides strategies for motivating staff, such as making employees feel heard, secure, and acknowledged through praise. A self-motivation action plan is proposed involving clarifying goals, identifying obstacles, and addressing each obstacle. The power of motivation to drive success for both employees and companies is emphasized.
The document summarizes Stephen Covey's book "Seven Habits of Highly Effective People". It discusses the seven habits which are: 1) Be Proactive, 2) Begin with the End in Mind, 3) Put First Things First, 4) Think Win-Win, 5) Seek First to Understand, 6) Synergize, and 7) Sharpen the Saw. It also introduces an 8th habit of finding your voice and inspiring others. The habits move from dependence to independence to interdependence and building public victory.
To gain competency, a person needs to be able to interpret situations contextually based on their experiences and training. Competency grows through experience and an individual's ability to learn and adapt regardless of training. The document provides tips for developing competencies like clarity of purpose, practical creativity, objective analytical power, market orientation, entrepreneurial drive, leading others, developing others, and influencing others. It emphasizes understanding contexts, creating action plans, flexibility in thinking, analytical thinking, understanding customers, initiative, leadership, developing skills in others, and influencing through relationships.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to FINAL PERSONAL TAKEAWAYS Action Plan Take a few mi.docx
An overview of the How to Start a Small Business webinar series for newcomers. Also outlines the steps of self-evaluation to see if one can be a small business owner
"Motivation: A different perspective" is written based on various literature review on sustainability of performance - organisational culture/behaviour/creativity/ people processes, motivation etc. It brings two specific perspectives: "SPLITS & CARE". My recent interaction with Balaji Prof C who has developed an interesting process known as "Causing Incredible Performance" with remarkable impact on people and organisations - mainly focusing on rewiring their internal voices has further validated my perspectives. Kindly provide your insights on it.
This document discusses various aspects of leadership including setting goals, providing vision, inspiring employees, training and coaching, learning, power and motivation. It emphasizes that effective leaders provide a clear vision and involve employees in setting realistic and attainable goals. Leaders must inspire employees and gain their trust by displaying energy and a positive attitude. Training, coaching, feedback and addressing barriers are important for developing employees. While power can force compliance, leadership influences others to willingly achieve goals. Motivation depends on needs and the perception that certain actions will help satisfy those needs.
Why Your Strategic Plan Does Not Get Executed and What You Can Do About ItHowardLitwak
There is nothing more important than making sure that your strategy is executed in a timely and efficient manner.
Execution disciplines help improve the linkage between your plan and your desired results.
If you are not getting the results you want, this may be the most important presentation you ever view!
Review, synthesize, and reflect on data you have collected about y.docxronak56
Review, synthesize, and reflect on data you have collected about yourself. Weekly discussion in lab will help you to construct this SRL profile. The SRL profile creates an opportunity to draw on data from your weekly self assessments and weekly My Planners to review and summarize your strengths and weaknesses in terms of engagement, SRL, motivation, anxiety, emotion regulation, procrastination, time management, task understanding, goal setting, etc. Summarize and present a profile of YOU. The assignment will conclude with an SRL change plan in which you will choose to tackle/change one problem over the remaining part of the semester in terms of: (a) behavior/s, (b) thinking, (c) motivation, or (d) emotions/affect.
Prepare your answer in word or some other format. Cut and paste it into the text window for this assignment.
You must answer the following questions. This assignment should not exceed 1500:
(1) STRENGTHS: Looking across the topics and self-assessments covered to date, what are my main strengths? How can I leverage those strengths in taking control of my university success?
(2) WEAKNESSES: Looking across the topics and self-assessments covered to date, what are my main weaknesses? Why might addressing those weaknesses be important for taking control of my university success?
(3) CHALLENGES: After reviewing my 6 MyPlanners to date, these are the critical patterns I see in my weekly attempts to take control of my learning. For this you should pay particular attention to: (a) engagement (Q. 1), (b) Goal attainment (first question after STOP sign), (c) Challenges - particularly patterns over time in the challenges that get in your way, (d) Other things such as feeling or motivation reported in the myPlanner.
(4) TARGET FOR CHANGE: Based on what you have summarized above, identify and justify one main thing you want to tackle in the remaining part of the semester. This should be something you want to take control of. It should be something you see as critical for your success in one (or more) of your other courses. Be explicit about whether the thing you want to change is about changing a: (a) behavior, (b) cognitive process or outcome, (c) motivation, or (d) feeling (emotion/affect).
(5) HOW WILL YOU EVALUATE YOUR SUCCESS? What data do you need to collect to figure out if you have been successful in tackling/addressing that target for change. In addition list 5 self-assessments you would like to redo at the end to self-evaluate your change.
Weekly Self-regulated learning assessment
1. Week 1
My strengths are knowing to creating goals and finding the correct adjustment to correct the problem.Through the report, the scores of planning, information management strategy and debugging strategies are relatively high. Personally, I am used to setting goals and planing before I started to learning, and I am satisfied with the good performance in organizing and engage in learning information more efficiently during the process. I also focu ...
a presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goals a presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goalsa presentation about growth in life nad to win and acieve yours goals
Much of our ideas about motivating others are inconsistent with what science says. This presentation describes three commonly used methods to motivate. Only one is under the control of all pharmacists and pharmacy personnel.
Network For Teaching Entrepreneurship PresentationBedazzled Media
This document outlines the agenda and objectives for an NFTE Operation: Mindset program. The daily agenda includes identifying skills of successful entrepreneurs, discussing the importance of an entrepreneurial mindset for post-secondary planning, and constructing an action plan. Students are asked to self-assess their entrepreneurial characteristics and skills in order to determine opportunities and areas for growth. Key entrepreneurial traits discussed include creativity, problem-solving, communication, and initiative. Students then work in groups to create action plans around adopting an entrepreneurial mindset.
This document discusses goal setting and how to effectively set goals. It defines what goals are and explains the importance of setting goals. Some key points made include:
- Goals give direction, motivate achievement, and help visualize priorities and plans.
- Effective goals are specific, measurable, attainable, realistic, and time-bound.
- Goals should be self-chosen, moderately difficult, written down, and flexible.
- Large goals should be broken down into smaller, action-oriented steps to stay on track.
- Setting too many goals, unrealistic goals, or goals beyond one's control can undermine effective goal setting.
This document discusses various aspects of effective management. It begins by explaining the importance of managers in organizations and their responsibilities. It then discusses skills managers should focus on developing, including creativity, emotional intelligence, interpersonal skills, team-building, leadership, time management, dealing with stress, and cultural sensitivity. Throughout the document, it provides examples and tips managers can use to strengthen these skills and become more effective in their roles.
This document contains information about setting and achieving goals, including 10 chapters on various aspects of goal setting. It begins with terms and conditions for the content and a table of contents listing the chapter topics, which include identifying goals, defining goals clearly, aligning goals with beliefs, committing to goals, getting others onboard, setting deadlines, and visualizing goals. The overall message is that properly identifying, defining, committing to, and visualizing goals can help people achieve their objectives.
Professional development for strategic managersMohyee3liShahin
The document outlines a personal development plan for a leader. It begins with conducting a skills audit to evaluate the leader's current skills and identify any gaps needed to meet leadership requirements. Various techniques are used to assess the leader's preferred learning style and professional skills. Next, a personal development plan is constructed to develop skills in areas like decision making, delegation, self-confidence, and conflict management. Objectives and measurements for success are outlined for each skill. Finally, suitable methods like SMART goals and performance reviews will be used to assess the outcomes of the personal development plan against the leader's work objectives.
This document discusses various aspects of effective management. It begins by explaining the importance of managers in organizations and their responsibilities. It then discusses skills managers should focus on developing, including creativity, emotional intelligence, interpersonal skills, team-building, leadership, time management, dealing with stress, and cultural sensitivity. Throughout the document, it provides examples and tips managers can use to strengthen these skills and become more effective in their roles.
Chapter 16 Becoming a World-Class Employee and LeaderLecture 1.docxcravennichole326
This lecture discusses key concepts related to becoming a world-class employee and leader, including:
- How good communication skills help organizations succeed by allowing them to set objectives, lead teams, communicate clearly, and achieve results.
- How to find and keep passion for work by pursuing interests, helping others, and feeling valued.
- Why it is important to establish healthy boundaries at work to avoid burnout and communicate effectively even under pressure.
- How to exceed expectations by going above job requirements, developing a positive attitude, and adding value.
This is the 5 steps to master everyday leadership skills, you will discover the topics about learning what leadership skills are, accessing your skills, become self aware, practice courage and move into actions
Transitions are a critical time for leaders at all levels. Missteps made during the crucial first three months in a new role can jeopardize your success.
In this updated and expanded version of the international bestseller, Michael D. Watkins offers proven strategies for conquering the challenges of taking on a new role — no matter where you are in your career. Watkins, a noted expert on leadership transitions, also addresses today’s increasingly demanding professional landscape, where managers face more frequent changes and steeper expectations when they start their new jobs.
Whether you’re starting a new job, being promoted from within, or embarking on an overseas assignment, this is the guide you’ll need to succeed in your first 90 days — and beyond.
This document discusses various motivation techniques for employees and self-motivation. It outlines intrinsic and extrinsic motivational approaches and provides strategies for motivating staff, such as making employees feel heard, secure, and acknowledged through praise. A self-motivation action plan is proposed involving clarifying goals, identifying obstacles, and addressing each obstacle. The power of motivation to drive success for both employees and companies is emphasized.
The document summarizes Stephen Covey's book "Seven Habits of Highly Effective People". It discusses the seven habits which are: 1) Be Proactive, 2) Begin with the End in Mind, 3) Put First Things First, 4) Think Win-Win, 5) Seek First to Understand, 6) Synergize, and 7) Sharpen the Saw. It also introduces an 8th habit of finding your voice and inspiring others. The habits move from dependence to independence to interdependence and building public victory.
To gain competency, a person needs to be able to interpret situations contextually based on their experiences and training. Competency grows through experience and an individual's ability to learn and adapt regardless of training. The document provides tips for developing competencies like clarity of purpose, practical creativity, objective analytical power, market orientation, entrepreneurial drive, leading others, developing others, and influencing others. It emphasizes understanding contexts, creating action plans, flexibility in thinking, analytical thinking, understanding customers, initiative, leadership, developing skills in others, and influencing through relationships.
Similar to FINAL PERSONAL TAKEAWAYS Action Plan Take a few mi.docx (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
How to Manage Your Lost Opportunities in Odoo 17 CRMCeline George
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
This document provides an overview of wound healing, its functions, stages, mechanisms, factors affecting it, and complications.
A wound is a break in the integrity of the skin or tissues, which may be associated with disruption of the structure and function.
Healing is the body’s response to injury in an attempt to restore normal structure and functions.
Healing can occur in two ways: Regeneration and Repair
There are 4 phases of wound healing: hemostasis, inflammation, proliferation, and remodeling. This document also describes the mechanism of wound healing. Factors that affect healing include infection, uncontrolled diabetes, poor nutrition, age, anemia, the presence of foreign bodies, etc.
Complications of wound healing like infection, hyperpigmentation of scar, contractures, and keloid formation.
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UPRAHUL
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
A review of the growth of the Israel Genealogy Research Association Database Collection for the last 12 months. Our collection is now passed the 3 million mark and still growing. See which archives have contributed the most. See the different types of records we have, and which years have had records added. You can also see what we have for the future.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
How to Make a Field Mandatory in Odoo 17Celine George
In Odoo, making a field required can be done through both Python code and XML views. When you set the required attribute to True in Python code, it makes the field required across all views where it's used. Conversely, when you set the required attribute in XML views, it makes the field required only in the context of that particular view.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
FINAL PERSONAL TAKEAWAYS Action Plan Take a few mi.docx
1. FINAL PERSONAL TAKEAWAYS
Action Plan
Take a few minutes and complete this Action Plan about driving
for results.
Driving for Results
Self-Handicaps
What is the
Situation
Trigger Impact on
Others
What to Do/When
Having no personal
vision/action plan
___Expedient
___Avoiding
6. ___Expedient
___Avoiding
___Apprehension
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
Baby Steps
This chapter is the final step in eliminating self-handicapping.
Lots of issues were discussed, but here are
a few baby steps for you to implement now.
The baby steps for this chapter are:
1. Every day, start with a small and easy task that you can
complete quickly - Don’t forget to make
your bed every morning! Be proud of it.
2. Write out a personal vision of building competence and
develop an action plan that aligns with
that vision.
7. 3. From the plan, identify a longer-term goal and break it down
into yearly, monthly, and weekly
target checkpoints.
4. Take a piece of paper and write down all of the things you
did last week that were not mastery-
oriented. What did you do to be better or to stay out of trouble?
Think about the proportion of
time spent in performance goals and how that is affecting your
career.
Follow Up Questions
1. Does your personal vision conflict with your organization?
Job?
2. Why do you get consumed by distractions? Because you are
extroverted? Hate your job? Are
just bored? Or, are performance-oriented?
3. How can I be more mastery-oriented – or is it something
innate that I can’t change?
4. What more do I need to know about adding value for
customers? Where will I find it?
___Self-Deception ___Look & Listen___________
9. ___Face it _________________
___Look & Listen___________
Proficiency Level
Level 1: Basic Level 2:
Intermediate
Level 3: Advanced Level 4: Expert
Pursues activities
with energy and drive
Pursues his or her
work with energy,
drive, and a need to
finish
Defines his or her
work in terms of
results, and pursues
success with energy
10. and drive
Sets clear and lofty
goals for himself or
herself, as well as for
the organization, and
pursues them with
enthusiasm and
energy
Sets goals, and
pursues them to
completion
Does not give up
before finishing, even
in the face of
resistance or
setbacks
Helps others to define
goals and plan a
11. route to successful
attainment of them
Anticipates obstacles
and is prepared with
contingency plans so
as not to impede the
drive to the goal;
keeps everyone on
track
Is responsible and
can be counted on to
usually meet goals
successfully
Consistently meets
goals
Is a high-achiever
with a reputation for
success and quality
12. performance
Is the go-to person
for both action and
strategic planning of
complex and tough
assignments
Will push self for
results
Continuously pushes
self for results
Dependably achieves
what he or she sets
out to do, and
expects others to do
likewise
Runs the race to
finish strong, not just
to cross the finish
13. line, and is not
satisfied with less-
than-concrete, stellar
results
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
1
Chapter 11 - Driving for Results
Effectively driving for results is a benefit and result of
eliminating self-handicapping behavior. Driving for
results is constant attention to how daily actions align with a
larger goal and having a mindset to master
that goal. One of the enemies of driving for results is comfort -
when we are in our “comfort-zones,”
14. everything is going “fine,” and we are maintaining the “status-
quo,” there is little to no push to perform
better or reach a goal. This is the mindset of staying out of
trouble and just getting the task done and
over with. Many people and organizations have the potential of
being “great,” but they are comfortable
being “good” because of lack of clear goals, a mastery mindset,
or well-
defined action plans to get there. Compounding these issues is
the
tendency to not take risks -- we have a tendency to “not fix
what’s not
broken.” While no one endorses taking unnecessary risks,
without some
risk an organization can remain stagnant while the competition
is
innovating.
How often do you surf the web, go on social-media, read blogs,
shop
online, talk about sports with coworkers, gossip, allow “short”
distractions, gripe about the company or boss, or open your
email
whenever you get an alert? The authors are not advocating for a
15. complete abolishment of the aforementioned distractions – we
just want
to get you thinking about what all of that takes away from being
“results
and mastery-oriented.” When we drive for results, we ensure
daily
processes align to larger outcomes, identify and control
distractions,
develop game plans to reach the goals, quickly find the root
cause for problems, and are directed by our
action plans. We do not work for the sake of being “busy,”
focus on ourselves or monetary reward, try
to be better than everyone else, or focus on staying out of
trouble. We all have that coworker that likes
to announce how much he has worked that day – for some
reason, they “are just so busy.” But the
curious thing is: they produce very little, and it takes them
longer than others to complete a task. While
the obvious short-term issue may be excuses leading to poor
“time management,” the longer-term
obstacles are lack of mastery goals and clear plans driving for
results.
Athletes, especially those competing alone always have a goal
16. in mind and they use that vision to guide
what they have to do to achieve it – to master it. The vision (a
certain speed or score and thereby
winning the national title) sustains their energy and is the
motivation to align their daily processes. They
understand that they must stay away from distractions, work
every day, and continually strive to be
better. There is a thin difference in goals -- their goal is usually
not to win but to reach their personal
goal to improve –their reason for being. This is a mastery
mindset. Due to the abundance of opportunity
in the business world, leaders can fall prey to being “good
enough” – or just to win --and not continually
strive to be great. Often, a worker is too removed from the goals
of the customer or organization to
have that central sense of being mastery-oriented. Neither ruins
careers nor businesses, but it does self-
handicap them – dooming them to a level of mediocrity.
CHAPTER TAKEAWAYS
simple task – build self-
efficacy daily.
17. vision and action plan
are important.
-subdivision.
-
orientated goals.
sses
with consumer-directed
goals.
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
2
Recall from Chapter 1 two things: that individuals have
different theories of intelligence and this likely
helps explain why they strive to achieve for different purposes:
mastery, performance-approach, and
performance-avoidance goals. Mastery goals represent a desire
to continually develop competence,
performance-approach goals reflect a concern to demonstrate
competence by outperforming others.
18. Performance-avoidance goals represent the desire to avoid
appearing incompetent or less competent
than others – fear of failure and making mistakes. Leaders are
more likely to self-handicap when they
have performance goals – particularly performance-avoidance
goals. Simply put: those with mastery
goals do not self-handicap – they drive for results. The adoption
of these goals is influenced in part by
cues, or goal-related messages, from the work, the boss’s
approach, and from within. It is a mindset –
one that should become part of any organization’s talent
development efforts. It is a mindset that
management can influence with effort and focus.
Driving for results means continually asking yourself if your
day-to-day efforts support and are directed
towards a predetermined goal and vision – the customer’s or the
organization’s – and whether mastery
of it is important to you. Do you want to master the process? Is
the goal of adding value for customers
important to you? A lot of people self-handicap in these areas
by not connecting their work activities
with outcomes they really want to achieve; this may be due to
lack of engagement, lack of
19. accountability, or other obstructions. We suggest asking
yourself on a daily basis the following
questions:
-do list today align with larger outcomes?
tomorrow?
ill I handle distractions throughout my day?
A leader that drives for results:1
customer needs
meet those goals
– and meets his own high expectations
20. g for them before
they happen
From our experience, the actions that go along with driving for
results are the best predictors of future
success in leadership – wanting to master the competency, going
above and beyond on assignments,
looking for learning opportunities, exceeding standards, looking
for internships and volunteer
opportunities to enhance competencies, etc. This is not to say
that the great student/early careerist
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
3
won’t cut corners and find better ways to master the goal – they
will. After all, they are “managing”
their education or career. But, when a person sets mastery goals,
develops action plans, and doesn’t let
barriers or obstacles get in their way, they practice what is
required for exceptional leadership and they
21. do become leaders.
IMPACT
We all know the drill. Performance management is created to
ensure that goals are met in an effective
and efficient manner. It is supposed to help employees reconcile
personal goals with organizational
goals and increase productivity and profitability - aligning their
objectives to strategic and operational
goals. Dashboards tell us where we are. We are told that using
integrated software for this may deliver a
significant return on investment by unlocking the time every
employee spends not actually doing their
job. Benefits far and wide are proposed: grow sales, reduce
costs, decrease the time it takes to create
strategic or operational changes, improve employee
engagement, and improve management control.
But do all of these management tools really drive performance?
Regardless of how sophisticated our organizational tools are, we
are all guilty at some point of not
driving for results. Have you ever been in a situation where a
series of good events has happened to
22. your organization or you personally – so you “downshift” the
next couple of weeks/months/year to
enjoy your success? An issue stopping or delaying driving for
results is believing things are going “just
fine” – being good at what you do. Jim Collins2 wrote a book
on this topic entitled, “Good to Great: Why
Some Companies Make the Leap…And Others Don’t”. Collins
states that “good” is the natural enemy of
“great.” He said we have lots of “good” organizations that
survive in America, but very few “great” ones
– those that generated stock returns higher than the average
stock market 7 out of 15 years. So what
did Collins recommend to achieve this level of success? He
suggested seven principles: 3
1. Leadership: Leaders who are humble, but driven to do what's
best for the company.
2. Get the right people on the bus, then figure out where to go.
Finding the right people and
getting them in the right positions is important.
3. Confront the Stockholder paradox – deal with its short-term
mentality but keep a vision and
drive.
23. 4. Determine the space in the middle of three overlapping
circles: “What makes you money?”
“What could you be best in the world at?” and “What lights
your fire?”
5. Develop a culture of discipline: get rid of the fat.
6. Use technology to accelerate growth, within the three
overlapping circles above.
7. Create an additive effect of many small initiatives; they act
on each other like compound
interest.
What do all of these principles have in common? They all focus
on a vision and a drive to get there. No
fat and no messing about is allowed; everyone is working
toward the goal – driven to meet the goal.
That is what many organizations think driving for results is all
about. But, of course, many years after
the book was published, at least half of the great companies he
identified are no longer doing so great.
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
24. Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
4
“Circuit City is bankrupt, Fannie Mae went
bankrupt/nationalized, Wells Fargo needed a bailout, Nucor's
stock and revenue crashed, Pitney Bowes went down
significantly, and Gillette is no longer
independent.”4 One issue is his methodology is that he
measured a company's 'greatness' by its
sustained stock market value being a certain percentage (150%)
above the general market. There are
too many factors involved here to say that vision and driving for
results will overcome the effect of the
economy. Yet, it does seem strange that 'greatness' was so
easily lost and so quickly.
We think that many companies do a great job visioning,
aligning, and developing dashboards and other
tools to keep that alignment. Many do better than the market
average for these reasons. They stay
focused and driven. They also are driven by their customers.
Yet, most are not. What fails is the drive –
there is no mastery mindset and the drive diminishes over time.
At this point, you begin to see the self-
25. handicapping ERO Spiral. Employees and leaders alike can only
keep up with the superhuman level of
work so long without some motivation. Without the spark that
comes from something that “lights your
personal fire,” all of us will eventually let up – “go back to
normal” and “regress toward the mean.”
Organizational goals will only carry us so far and after that you
have to be doing something you truly
love doing for this type of sustained effort. Otherwise, excuses
set in for the very purpose of allowing
reduced effort. Sometimes a leader is trying to soften the blow
of the inevitable let down of pressure,
sometimes he is looking for enhancement so he does not look
bad. But, we all know we can only do so
much without rest, without burnout. Excuses can take us off the
hook and lead into reduced effort we
need to “go the long haul.” The vision and dashboards stay but
the effort must meet reality. Saying “We
are doing just fine” starts it.
So, what is the answer? Are we always doomed to fall back to a
more normal performance after
superhuman effort (market value 150% above the general
market)? Not always, but typically. We think
26. moving from good to great and staying there is more than
vision, goals, dashboards, and especially, a
driven culture. In fact, we think much of that will inevitably
lead to “failure” – a “regression towards the
mean.” Any superhuman drive to greatness is not sustainable
unless you are willing to burn out your
employees and throw them out when used up, or replace good
workers with overseas workers because
they are cheaper. Operations can be made less costly (we do
throw out the equipment) but not forever.
Take the analogy of dieting. Any physician or dietician will tell
you that “binge dieting” does not work.
Yes, you lose weight quickly, but after the sustained effort
meets its inevitable leveling off point, you will
go back to the way you were – fat – because you resumed the
old habits. The way to lose weight is to
change your life style – eat less, eat healthy, and exercise.
Moving to healthy organizational living is to
eliminate self-handicapping and the ERO Spiral and replace it
with a mastery goal orientation focused on
adding value for all customers.
We think that any executive who has tried the binge dieting in
his organization for any long-term
strategy change (not just a quarterly stock return), and see it
27. peter out over time, will begin to
appreciate that healthy living in an organization is to reduce
self-handicapping. That is the only way you
can cut out the wasted effort and sustain a palatable pace
forever in an organization. When leaders,
managers, and workers start to understand self-handicapping -
that the excuses they are using (which
are very successful in the short-term) lead to obstacles that hurt
them, their customers, and the
organization’s goals - healthy organizational living can start.
Healthy living in an organization means
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
5
accountability, open awareness and vision, proper decision
analysis, talent development, real efforts at
engagement and competence mastery, and eliminating
micromanaging. These can be achieved through
the reduction of self-handicapping. This healthy living can be
28. sustained with effort truly focused on
outcomes. The bus can be loaded with employees that have
mastery goals for what they are doing. We
all know that any dashboard in any organization and any
organizational mission/vision can be ignored by
employees. Any failure to meet a goal can be excused. Because
of this, we think dealing with self-
handicapping is the recipe for greatness. A drive for results
must be based on removing self-
handicapping.
The justification of “doing just fine” is what often starts the
ERO Spiral. “It won’t matter if I take a little
time to order something from Amazon.” “The customer won’t
know if I cut this corner on their order.”
“The boss is being a jerk; I am not going to do this task very
well just to show him who really is boss.”
“These customers are really a pain, I am not going to hurry up
just for them.” “I don’t like this job, I am
going to go slower.” These excuses get us through the hard
times and it is easier to do the same the next
time. Slacking off because you can becomes habit. Blaming
everyone except yourself (boss and
customers) becomes habit. This blame and excuses then produce
29. major obstacles: dissatisfied
customers (who go away rather than complain), an annoyed boss
(who does complain and causes more
employee disengagement), and goals not met, behind schedule,
or over budget. Self-handicapping
slowly bogs down the organization.
THE REAL ISSUES
Accountability is fundamental when driving for results. Have
you ever been in a meeting where the
leader/executive spends more time making excuses for why
there are shortcomings in the organization
than making a plan of action? Suppose Company ‘A’ had a
history of tremendous market share in their
industry, but because of changing demographics, more
competition, and static management, the
company is losing the majority market share. The leader comes
in to a meeting of directors and explains
the reasons why (mostly excuses) they lost share: more
competition, competition is innovating more,
etc. Basically, the leader starts most of his sentences with, “the
competition.” This creates a lack of focus
on the true customer (stock holder, product consumers) and
30. shifts to competition – a non-customer.
This type of ERO Spiral at the Board level can be deadly for
organizations – it all starts with excuses,
which lead to reduced effort to retool the strategy.
Remember from Chapter 1, incremental theorists believe that
working hard towards a goal is a way to
get better – to master the goal. On the other hand, entity
theorists think that if they have to work hard,
they must not be very good. So, they choose easier targets,
which when achieved, do little to expand
their skills or provide learning opportunities.8 Entity theorists
want to look good but not put in the work
to do so; and because of that, don’t drive for results as hard.
Incremental theorists will do whatever it
takes to master the job. Furthermore, incremental theorists
persist longer under adversity. They believe
effort towards a goal gives meaning to life. They also know that
mastery can be stressful and painful -
they know “learning hurts.” Finally, they know that mastery is
something you never ever reach. There is
no quitting point. Goal orientation is critical in thinking about
driving for results. In the short-term, you
31. SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
6
may not even notice, but when everyone is working to avoid
errors or stay out of trouble, it could mean
organizational death. Mastery goals are the key to sustaining
driving for results.
Those with mastery goals have a personal vision and an action
plan for at least the next steps of getting
there. They are accountable for their own learning. They have
alignment between everyday processes
and desired customer outcomes at work. Once there is a vision,
a way of dealing with this is, “micro-
planning”, or making sure that what you do every year, month,
and day aligns with your multi-year goals
and vision. Everyone has experienced arriving at work and not
knowing exactly what to do – or how to
fit tasks into specific time periods – time optimization. Imagine
arriving at work at 7:30 and you have a
32. manager’s meeting at 8:00. What do you do during that 30
minute window? If you are like many – you
might use that 30 min to wake up, get coffee, or even find out
what’s new on social media. Now imagine
using that time to practice before the meeting, get a task on
your “to-do” list checked off, or review
information from other industries. Think of the confidence
boost you would have walking into the
meeting after already crossing off one line-item on your list or
being ahead of the game in other ways.
When we complete tasks – even the small ones, we experience a
boost to our confidence and self-
efficacy – we approach the next tasks with more “grunt” and
vigor.
As an example, do you know why people in and retired from the
military always make their bed when
they get out of it? In the 2014 University of Texas – Austin
commencement address, Admiral Bill
McRaven, head of the US Special Operations Command – a
Navy Seal, urged graduates to make their
beds every morning. Admiral McRaven said, “If you make your
bed every morning, you will have
accomplished the first task of the day. It will give you a small
sense of pride and it will encourage you to
33. do another task and another.”5
Sometimes, behavioral change doesn’t make much logical sense.
Why would you make your bed EVERY
morning? It has no intrinsic value except to keep the dog/cat
off the sheets and it takes time – time that
would be better spent drinking that first cup of coffee. But, we
humans need to be reminded every day
to be proactive. Imagine if the first item of the day was an
enormous task that would take at least 3-4
hours to complete. If we get our engine warmed up with a small,
completed task, it will give us
confidence and pride to complete that larger 3 hr. task. By now,
you have noticed all of those “baby-
steps” at the end of each chapter. Upon first glance at them, you
may have said to yourself, “that is such
a small and mundane task, I don’t need to practice that.” We
have given you those baby steps to build
self-efficacy – these, like bed making, will give you the
confidence to keep going. You must first learn to
walk, and then you can run. And if you have a bad day – at least
you will come home to a made bed –
that YOU made!
34. In thinking at the organizational level, you are probably
thinking, “Why not just hire only incremental
theorists with mastery goals?” Well, like all good things, they
are rare and they are picky about where
they work. No one knows the proportion of incremental vs.
entity theorists out there, but we all know
how many people around us are truly mastery driven. There are
not that many – in our classes it
remains about 10% each year. And, even those who know to
look for these individuals do not have the
employee selection systems to find them or the organizational
culture to support and keep them. If you
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
7
are reading this book as a leader trying to change an
organization, you must find ways to attract those
with mastery goals. You are probably trying now, but haven’t
defined it or really know what to look for.
35. Understanding of the ERO Spiral and “The Box of Blame” will
help you develop tools to find those with
mastery goals. But, more importantly, it makes the search
behavioral – things you can see and measure
much more easily than mental mindsets.
And keep in mind that you can create an organizational culture
that will kill mastery. People with
mastery goals need autonomy and purpose. Long ago, Hackman
and Oldham9 said that there were
several core dimensions to any work that increased satisfaction
and motivation. They showed that
workers experience three psychological states in work:
– it has meaning; it is something to
which one can relate. This causes
intrinsic motivation - the work is motivating in and of itself.
o Meaningfulness of work comes from having Skill Variety – an
opportunity to use variety
of skills and talents; Task Identity - being able to identify how
something is done and
why; and Task Significance - being able to identify the task as
contributing to something
wider, to society or a group
36. Autonomy - one is given the opportunity to be a success or
failure and have the ability to make
changes and incorporate the learning gained in doing the job.
- providing feedback on how
successful the work has been, which in
turn enables one to learn from mistakes. Also to connect
emotionally to the customer of the
output which gives purpose to the work.
Knowing these critical characteristics, it is then possible to
derive the key components for designing
jobs, teams, and work culture. It is possible to create a culture
that provides purpose and autonomy
where those with mastery goals will thrive. A poor culture will
drive those seeking mastery out. In order
to do this, you must first address the preceding chapters of self-
handicapping issues. In other words, you
must have personal accountability and an accountable staff, a
proactive communication culture, an
engaged workforce, little micromanagement, and an aware
workforce, etc. When those items are
aligned, and you begin to attract those with mastery goals,
driving for results will happen naturally.
37. DO YOU DRIVE FOR RESULTS?
SURVEY: Do I Drive for Results or Not? (Y = Yes, N= No, DK
= Don’t Know)
_____ I avoid challenge.
_____ I typically set easily-attainable goals and like to stay in
my comfort zone.
_____ I find myself daydreaming about how things should be,
instead of taking action.
_____ I ask “Who?” “When?” and “Why?” much more than
“What?” and “How?”
_____ I do not really have a personal vision or mission.
_____ I don’t have an action plan that is written behaviorally
and results-oriented. .
_____ I pride myself on my ability to stay busy.
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
8
38. _____ My processes are not linked to outcomes for the
organization.
_____ Distractions often get the better of me.
_____ I don’t write a list of tasks to complete the next workday.
_____ This company has no dashboards to show us where we
are.
_____ I blame management a lot for our problems.
_____ I am not sure what “adding value” means.
Scores
9 --13 - Y’s - You are greatly self-handicapping your drive for
results
5 – 8 - You are inconsistent on your approach to driving for
results
1 – 4 - You are pretty good with driving for results
WHAT TO DO
Creating a culture of driving for results occurs at both the
personal and organizational levels. Let’s focus
on you, the individual. Driving for results is the constant force
39. of forward and directed motion. There are
several reasons why this is avoided: lack of company vision
(where are we going?), lack of personal
vision which puts you in the right spot for continued mastery
(what do I need for the next step of my
career/life?), lack of action plans (how do we get there?), lack
of company or personal values (why?),
lack of personal action plan (how do I get there?), or just a
simple disinterest in customer
outcomes(what do they need?). So what to do?
Many leaders think motivation and payment are the same things
– they are not to workers.6 The reality
is that people come to work for money – most are paid to be
there during work hours, and to stay out of
trouble, but not for exceptional work (performance goals). They
work hard and excel because of all kinds
of other things: meaning, creation of something, challenges,
ownership, identity, mastery, and pride.
Seeing the fruits of our labor makes us more productive; and the
less appreciated we feel our work is,
the more money we want to do it. Often, the harder a project is,
the prouder we feel when it is
accomplished. Knowing that our work helps others usually
increases motivation and makes us more
40. likely to work harder. Positive reinforcement about our abilities
may increase performance. Finally,
images that trigger positive emotions may actually help us focus
– pictures of happy customers enjoying
something you designed or built may help you design the next
product. These are all things that come
from leaders and the nature of the work, not money. Simply put,
we show up and stay the work hours
for the money, but we work for other things.
.
Furthermore, do not confuse driving for results with control –
they are two separate ideas. Controlling
people can be quite Machiavellian – a controlling boss doesn’t
rely on a solid infrastructure of
employees and ideas to achieve results but on his micro-
management and the willingness of his
employees to be driven to their tasks. Conversely, a workgroup
without self-handicapping allows a
leader to guide a group of accountable, engaged, visionary, and
courageous staff to achieve results more
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
41. Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
9
effectively – they will not tolerate a control freak. You can be
the captain of your own nuclear submarine
– give your workforce a vision and actionable steps to achieve
it, and get out of the way.
There are five things to do to drive for results:
– Why are you there?
– Understand your “why do it?”
– Create “mastery goals” and figure out the “what”
and “how.”
– Keep improving the “how.”
– Find ways to keep motivated.
Get yourself straight. The first step is to literally decide
between leadership and followership – right
now. Leaders know where they are going and why. They know
their accountabilities. And they
understand the customer is the end-all, be-all in outcomes–it is
all about adding value for the customer.
42. You must embrace these concepts to be a leader – it isn’t about
you anymore. In fact, very little will be
about you in true leadership. Most leaders can tell you the exact
time that they knew they were
different. They were smarter than those around them, they
wanted to change things and they were
willing to put in the time to figure out how - and they had a
need to produce something of value. Once
they figured out this about themselves, they started to develop
the path to get there. They stopped
working on an “hourly” basis and started to work to produce
“outcomes.” If you have not had this
moment yet, you must reach down and find it. Without it, you
may find leadership a weary climb.
Furthermore, most leaders are Servant Leaders in whole or part.
Most have or are trying to make
servant leadership a part of how they run their businesses.7
When the org chart looks like a steep
pyramid with the leader at the top, people in those organizations
focus on pleasing the bosses to the
exclusion of doing as much as they can for the customer. One of
the most central tenets of servant
leadership is listening to the customer and finding ways to add
value to their experience – this requires a
43. flatter organization. Servant leadership also influences how one
treats suppliers – it is important to care
about everyone that the organization touches. The values of
servant leadership include empathy,
awareness of the customer, foresight - understanding lessons
from the past and realities of the present,
stewardship – leaders are holding their institutions in trust for
the greater good of society, and building
community.
While most employees are paid to be there, leaders are paid for
results. Leaders must look at stock
returns, budgets, and customer satisfaction. All leaders must
accept that adding value for customers - all
customers – internal employees or customers outside the
organization, is a key to their position. Adding
value is to increase the functionality or use of a product or
service while holding costs constant, reducing
the cost while not reducing functionality, or to increase
functionality more than cost. One of the best
ways to identify value-added activities is to assess if a
particular product or process does nothing for a
customer. Another is to ask if there is a better solution for the
customer – even if you can’t provide it.
The best is to anticipate their needs and wishes and provide a
44. product that satisfies needs the customer
did not know they had. This has been Apple’s secret. If you
can’t supply what a customer needs, then by
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
10
definition, adding value means to find an alternative source for
the customer and direct them there.
Satisfied customers return even when directed to an alternate
source and appreciate the relationship
where they are taken care of regardless of company products or
policies (or lack of). Adding value to
customers is an attitude or value needed in leadership. Lacking
this value is very self-handicapping.
Adjust to the work. Even if you have known you were destined
for leadership, believe the community
and customer come first, and have fully equipped yourself
mentally for the job of leadership, your
organization may not put you where you belong. You still have
45. to find something to lead that suits you.
Some of us are entrepreneurs who want to build and sell; some
are helpers who want to make other
peoples’ lives better; some of us want to build things, be first,
make a splash; some want to be part of a
larger organization and make a contribution wherever it is
required. It really doesn’t matter who you
are, what matters is that you know it and find a place where
your personal “why do it?” is always
satisfied so you can stay focused and driven without burning
out. We all burn out when we are in the
wrong place.
A personal vision is extremely helpful here – it will guide you
to accept positions better suited to you. It
may guide you to seek out different circumstances. Many
entrepreneurs start in organizations and
slowly discover they are not destined for corporate life – they
need to strike out and create wealth.
Determine your vision and goals and find the spot that satisfies
those goals. To do otherwise is self-
handicapping. And this is often where the excuses start the ERO
Spiral – “I can’t quit this job because of
my family responsibilities.” “I can’t start my own business
because I have to guard our nest egg for
46. retirement.” This leads to reduced effort – not doing what it
takes to move on to what is your real vision
or suppressing your vision for reality. Then the unhappiness and
burnout set in – obstacles. And so on,
down the Spiral.
Organize. Organizing consists of two main activities: Setting
goals and planning. Setting goals includes
determining customer needs and wants. It is asking nothing but
“what” and “how.” Asking “Who will
‘rescue’ me,” “Why can’t I do what so-and-so is doing,” and
“When can I get out of this mess of a job”
will really get you nowhere and are part of the excuses starting
the self-handicapping cycle. We all know
people who spent their careers on these questions and they are
now stuck in their positions without the
credentials to move, blaming everyone but themselves, and in
denial about the whole situation. So plan
out your vision in your current organization or outside of it – it
may be both -- with a progression up
from this organization and into another or one of your own.
Remember two things: this will require a
plan – a detailed, actionable plan – and a commitment right now
to take charge of mastery and execute
47. it. This is where you break the Spiral. Action plans, focus on
mastery rather than performance, and
courage will get you beyond excuses and reduced effort to the
places you want to be. Break the cycle
before it breaks you.
Employees who are mastery-oriented focus on effort, use
appropriate learning strategies, are persistent,
make choices that are challenging and engaging, and develop a
positive orientation toward learning.
Leaders should emphasize goals of understanding and
improvement (rather than being best or avoiding
error). They should convey an activity’s meaning and real-world
significance. Employees should be
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
11
involved in decision-making to develop responsibility,
independence, and self-directed learning
strategies. They should feel they can take risks, make mistakes,
48. and reveal their lack of understanding or
apprehensions. Thus, employees will develop a high sense of
self-efficacy and attribute poor
performance to controllable areas like insufficient practice.
Success should be defined by improvement,
with value placed on the process of learning.
Obviously, making these leaps is easier when you know your
customer and help employees want to
please them. Whether a goal is performance or mastery,
customers still pay the bills. Keeping busy,
pleasing the boss, and drifting in the wind are viable ways to
operate in many corporations. Employees
do these things; but, in the end, the corporation loses. You are
different – you are a leader. Leaders find
ways to motivate their employees to a commitment to customers
– stockholder, consumer, employee,
and corporation – and determine want they need and want.
Leaders reinforce this constantly. Find
better ways to do this and you will always be a successful
leader.
Work better. Leaders are usually smarter – but smarter in a
couple of simple ways that can be
duplicated by anyone who wants to focus. Leaders keep
improving the “hows” of what they do. They
49. plan ahead, they organize, they are efficient, and they bundle.
In sports, the guy who gets the penalty is
usually behind – not in the right spot at the right time – and he
strikes out. Leaders do not get penalties
because they plan and organize to be in the right spot. Sure,
there are mistakes; but they use those to
learn and get better. That is why a progression of jobs is good –
make your mistakes in the small places
and learn. Leaders seek out internships and places to volunteer
when they are starting out. Mistakes are
forgiven there and used as learning opportunities by preceptors.
We quickly found out that the best
students – the ones who moved quickly into the C-suite –
practiced efficiency, avoided meetings,
organized teams and delegated, skipped the “make work,” and
found all the loop holes. Well, guess
what? They were just managing a tough situation. And, they
were teaching others their methods.
Leaders organize to solve problems and produce desired
outcomes. Great leaders know their customers
well and do that to satisfy their customer outcomes.
In our classes, we make students draw out a “goal subdivision
chart.” It can be easy to become
50. distracted what your big goal should be and lose the linkage
between that big goal and what you should
be doing in the short-term. Similarly, when your organization is
going through change, it can sometimes
be hard to maintain focus due to your worries about how it will
affect you. In either situation – goal
setting or change management, consider examining goals and
subdividing time periods. Put those goals
on paper – so you really look at them. Let’s look at a simple
example using easy numbers. Picture this
situation: You acknowledge that your finances are out of order,
you have too much charge card debt,
and want to save (not accounting for time-value of money)
$6,000 in the next 5 years to get out of debt.
You need to attain a yearly goal of $1,200; a monthly goal of
$100; and a weekly goal of $25. You know
the big goal and made a plan – subdivided the savings needed
by week. You now know the “what.” Next
continue to take on the mindset of mastery – “how” do I do it?
How do I personally cut out $25 of
spending not really needed week to week without suffering?
Suffering will take you back to the old
ways. You will continually have to look at what you do and
adjust every week – learning and getting
51. better at saving (without suffering too badly). Reaching a large
goal over a long time-frame may be
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
12
difficult and can even seem daunting. It is easy to slip into
excuses and reduced effort so you do not save
the $25 needed each week. Then, the lack of saving adds up to
the major obstacle of not being able to
pay the bills.And, you start to blame everything and everybody
– car repairs, increase in cable bill,
inflation, and spouse. The point is that have the sub goals and
approaching each week with a mastery
goal mindset would keep you focused on the goal and plan. The
first step, of course, is subdividing the
outcome goal and time-period so you can impose baby-step
goals that give your encouragement along
the way when you reach them – increasing motivation and
learning. The second is to think mastery –
52. only “what” and “how.” If not trained as a child to prefer
mastery, this is one way you can work into that
mindset.
Recharge. Finally, we all wear out; we need to find ways to
keep motivated. Leaders know this and keep
their resume current and in their back pocket at all times. Why?
Because, 1) they realize that they learn
and recharge by moving, and 2) they will never settle for the
organization “owning them” when they are
prepared to move on. Leadership is a transportable skill; it is
needed everywhere. In fact, great
leadership is always in great demand in organizations. We think
this is because so many let the ERO
Spiral drive them out of greatness. But that is the story of this
book. It is self-handicapping to not keep a
current resume and LinkedIn account, to not keep up with your
network, to avoid learning opportunities
due to expediency, to be unwilling to move to new leadership
positions, and to find other ways to
recharge. Find a place to go relax – a cruise, lake place, or
library. It does not matter how or what, just a
place to recharge. Extroverts will recharge in their LinkedIn;
introverts will recharge in the library or their
Kindle. Recharging is another way to stop the excuses leading
53. into the ERO Spiral – recharge and then go
out again for the fight; don’t hide down the rabbit hole.
Here is a worksheet to think about these things:
Behaviors to Work On Where/When It Occurs What Will I do?
Avoiding Challenge.
Challenges help us grow as
people and professionals.
Who are our customers?
Do you know?
Is your mind straight?
Who do you own
accountability? Are YOU in
there too much?
Can/will you add value?
How will you add value to
every interaction you make at
work – list all your customers
54. here.
No personal vision / action
plan. Without a vision and
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
13
action-items, you may be
going 80 mph down the
wrong highway.
Confusing “time-based”
productivity with outcomes-
based processes. Align what
you do everyday to an
55. outcomes-based goal.
Allowing distractions to
derail purposeful pursuits.
Don’t make distractions more
important that achieving
goals.
Symptom-based fixes vs.
finding and addressing the
root cause of an issue. When
you get to the root – the
symptoms will disappear.
Day dreaming. Allowing
dreams in interfere with your
day to day tasks.
Focus. How can you focus to
make it count? Fewer
56. projects, more focused
outcomes, dashboards?
Adjust to the job.
How will you find your place
at work or beyond?
Do you need to find a new
place?
What do you need to do to
make that happen? Resume?
How will you recharge?
How do you recharge? Where
do you recharge?
WHY DON’T YOU
Expediency
57. SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
14
Driving for results is something that you never really get to and
keep it there. You have to constantly
remind yourself to be on guard against distractions in the
workplace, to have servant goals, to make
sure your tasks are aligned with outcomes, and have the courage
to take on challenges that will help you
grow as a person and professional. It is too easy to let
distractions creep up and take time away from
important tasks. These distractions aren’t just external – a lot
are internal. Your daydreams consume
time that should be devoted to getting work done – and they are
really excuses for reduced effort.
While you dream nothing gets done.
Don’t forget that being good enough is a comfortable place to
be in. Being good enough produces
58. satisfactory results with a satisfactory amount of effort; but,
with time marching on, it allows for others
inside and out of the organization to grow and learn. And you
become obsolete.
Much like a lobster being in a pot of lukewarm water that
slowly rises to a boil, we often don’t realize
that our lack of action in the short term is detrimental to our
long-term success. We like to say, “I am
playing the long game” and put off what we can do today
because we “have plenty of time” to achieve
those goals. As time goes by, this thinking persists, and we fail
to realize goals. The reasons could be that
we simply don’t know how to connect the long-term with short-
term actions (expediency), we fail to
accept challenge (avoidance), we may treat the symptoms of a
problem because we fear what may be
the root cause (apprehension), or we may simply believe what
we are currently doing is great, but
everyone else needs to step up (self-deception).
What handicaps do you use to not drive for results because of
expediency?
_____________________________________________________
59. _________________________
Avoidance
Not driving for results can be the result of a more nuanced
cause – focusing on internal outcomes rather
than outcomes that affect the external consumer. This is related
to tunnel vision. Ideally, all operations
of an organization should focus on consumer outcomes – will
this project generate a net positive for the
external consumer that pays the bills, buys the stock? Of course,
some industries like healthcare have
multiple customers with conflicting demands causing problems.
Sometimes, too much effort can be
wasted on activities that do not have any effect on consumer
benefit and this is avoidance of the real
issues. Distractions and daydreaming are avoidance. So is lack
of developing personal visions, action
plans, and keeping up a resume and network. So is not sorting
out conflicting customer demands so
employees know where to focus.
What handicaps are you creating because of avoidance?
_____________________________________________________
60. _________________________
Apprehension
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
15
Once the planning and preparation are not done (avoidance),
driving for results requires mental
toughness, discipline, and grit. That can be scary. Does change
cause anxiety for you – to the point
where you do your best to avoid it? Are you easily distracted
from your goals – letting small
interruptions derail purposeful pursuits? Do you avoid learning
because it is hard? Do you justify the
above by saying it will not hurt the organization or the customer
won’t know? If so, you are not being
accountable to the customers and organization – probably due to
apprehension.
61. The key here is to translate the vision into action. Plans are one
step but baby steps are needed next.
Successive small and successful steps toward a goal will help
one keep on track, overcome hurdles, and
build confidence. Taking one big leap is always hard and often
leads to failure that saps one’s motivation
to continue.
What handicaps to driving for results do you create because of
apprehension?
_____________________________________________________
_________________________
Self-Deception
To some extent, this entire book comes down to this one
paragraph. Leaders have vision and work to
accomplish that vision. Without that, there is no leadership.
Great leaders have no self-deception as to
where the drive should be directed and how. Can you sum up
your career in one sentence? We can: we
educate. It is all we do – in writing, in class, in conversations,
everywhere and always. And we are driven
62. to continually develop ourselves and help others grow. Our
wives are often a victim of that. You are a
victim of this sentence right now in reading this book! When
you can sum up your life in one sentence, it
becomes very hard to deceive yourself. You just keep repeating
the sentence over and over and it gets
more difficult to blame others or hide from a vision. Without
that simple sentence to sum up your
personal vision and the mantra of repetition, you could become
the victim of your self-handicapping.
That one sentence can keep you from spiraling into the Box of
Blame. When others are at fault, you
have to work extra hard, everything is unfair, and you are the
“hero,” you are in self-deception. This
typically means you are driving very hard but in the wrong
direction and probably for too long. Time to
stop, reflect, and maybe recharge. At minimum, reassess the
underlying reason for the blame. If you
step back and look, we will find you have put yourself into a
Box of Blame. When employees are ducking
their heads and provide no feedback of any kind, look and listen
very, very carefully. It is easy to confuse
the “Box of Blame” for driving for results.
63. How does self-deception affect your communication efforts?
_____________________________________________________
_________________________
BEHAVIORS TO CHANGE
Let’s now examine some individual behaviors we do that keep
us from driving for results. As you read
this section, be very honest with yourself – remember, you must
be the example to your staff – when
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
16
you demonstrate behaviors that drive for results and make those
results are meaningful, your staff will
want to jump on the bandwagon – success is attractive.
Developing a Personal Vision
64. Recognize. Visions direct action. Without a vision, how do you
know where you want to go? You are at
risk of a derailment and “blowing in the wind.” But having just
a vision won’t result in much without an
action plan. Many people go through life without either of these
items – floating from one job to
another without any logical progression. In order to find where
your passion fits you must first create a
personal vision and action plan in order to give you direction.
Admit. Admitting that you don’t have a personal vision is a
difficult thing to do. However, it is helpful to
realize how different your life can be when you do. This vision
statement will provide a compass for you
to gauge career decisions, personal decisions, and financial
decisions.10 Once the vision statement is in
place, developing an action plan logically follows (there are
action plans throughout this book as an
example). Not only does the action plan contain specific
actions, but also should contain potential
barriers to achievement. The better you can plan for barriers
(relapses) – the more likely you will be able
to overcome them.
65. Adjust. If you currently don’t have a personal vision statement -
make one. Before you put pen to paper,
ask yourself what you truly want out of your professional
career.11 Your goals need to be specific to you
– no one else. Just because you overheard someone sharing their
vision doesn’t mean you should
automatically adopt it – be true to yourself. This is going to
take time! Your vision statement will come
from your desires, values, and dreams.
Key Behaviors. Here are the Key Behaviors for developing a
Personal Vision12:
1. Keep it simple, clear, and brief.
2. Focus on “wants” – not “shoulds.” Keep it positive.
3. Then ask “what” – what do you want to become as a person?
Why do you want that?
4. Include positive behaviors, traits, and values that you
consider important.
5. Balance your dreams with logic.
6. Create a clear statement that will guide you in day-to-day
actions – remember the one sentence
mantra to sum up your life.
7. Think about how this vision affects other parts of your life. Is
66. it consistent? Where will it
conflict?
8. Make it emotional. Including an emotional payoff infuses
your vision with passion and makes
even more compelling.
Here is a good website that helps you build a mission statement
from scratch. Just remember that a
mission statement is for now while a vision statement is for the
future.
http://www.franklincovey.com/msb/
http://www.franklincovey.com/msb/
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
17
Confusing “Staying Busy” with Mastery Goals
67. Recognize. It can be very easy to confuse “staying busy” with
processes that align with a mastery goal.
Corporations often use time as a unit of measurement of
achievement. You know that hardworking
coworker who stays busy – is overwhelmed – but achieves little,
and worst of all, does not grow and get
better. That coworker is not working toward a mastery goal. It
is likely he is working toward
performance goals that represent the desire to avoid appearing
less competent than others. This is very
self-handicapping.
Admit. Not aligning your day-to-day activities with mastery
goals can have multiple implications.
Personally, you may have a difficult time meeting task goals
and becoming responsible for more tasks
(promotions). Most importantly, you do not grow, and in the
world we have today, that will lead to
problems as you quickly become obsolete. There are fewer and
fewer places to hide with obsolete skills.
The issue of goals is as important as any concept in self-
handicapping. Self-handicapping is caused by
uncertainty. Performance goals will always cause some level of
uncertainty – one is trying to be better
68. than others (performance approach goals) or not make mistakes
(performance avoidance goals). Ask
yourself how much of your time is spent asking, “Who?”
“Why?” or “When?” Only a mastery goal and a
clear plan to reach it will eliminate the uncertainty and
therefore self-handicapping. When one falls
short on a mastery goal, they learn and go right back at it – no
real uncertainty there. They spend their
time on “What” and “How” questions.
Adjust. Remember, when managers emphasize performance
goals, employees have a tendency to
evaluate their lack of ability as a cause for failure. The best
solution here is to not fail – to avoid error at
all cost. The best way to do that is to duck down and do as little
as possible. Managers should emphasize
goals of understanding and improvement (rather than being best
or avoiding error). They should convey
an activity’s meaning by involving workers in decision-making
to develop responsibility, independence,
and self-directed mastery learning strategies.
Great professors help students understand mastery by defining it
in a mastery grid – showing what is
69. needed to progress from beginner, novice, practitioner, to
mastery. They also ask students to think in
terms of their “portfolio” or collection of their work and
competencies. You may have seen either – if
not, develop a mastery grid and start to collect evidence of your
competencies in a “portfolio.” Ask your
employees to do the same. Celebrate and model learning,
improvement, and the success of keeping
external customers happy.
Here are some basic rules:
-- given their
interests, or explain why it must be
done and for whom.
performance.
interactions and in formal and
informal evaluation.
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
70. Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
18
Key Behaviors. Here are the Key Behaviors13 for modeling a
commitment to mastery goals and creating
an environment of mastery.
1. Model a positive attitude, a willingness to take risks, and
continual learning whenever you
personally encounter challenging tasks.
2. Approach all employee tasks as learning tasks – not
something for punishment or reward.
3. Focus attention on persistent effort and strategy use, not on
employee intelligence.
4. When an employee fails, give constructive feedback about
work behaviors and strategy use.
Emphasize that success is related to one’s preparation and effort
– and continual learning.
5. Teach adaptive strategies. Model how employees should plan,
monitor and evaluate their own
work, and especially, their learning.
6. Encourage involvement and a sense of personal
accountability. Let them own their work.
71. 7. De-emphasize the negative consequence of making errors. It
is a part of the learning process;
making mistakes help employees improve their skills.
8. Decrease any emphasis on social comparison at work – the
“have to win” mentality.
Recognize them as individuals taking responsibility for their
work and competence, not being
better than someone else.
Avoiding Challenge
Recognize. Avoiding challenge is a good way to disengage
yourself from work. When you aren’t
challenged – there is no celebration of conquering the
challenge. This isn’t to say that those who avoid
challenge are bad at what they do. But remember – this chapter
is all about transforming from good to
great – breaking out of that comfort zone at work to achieve at a
higher level. Contrary to popular belief,
most challenges are not self-initiated. They come in the form of
day-to-day tasks that we shy away from
because of expediency, avoidance, fear, or self-deception.
72. Admit. We all avoid challenge at some point – but this can be
self-handicapping. Avoiding challenge will
stifle your professional growth and seriously limit future
promotions. When you accept a challenge a
few things happen:
– you
are more promotable
to meet new people within the organization
– networking
When people fear the repercussions of challenge – they are
focused on not making mistakes and
maintaining the status quo. These are performance goals, not
mastery goals. This ultimately stifles
growth and limits the forward motion of you and your
organization. It requires courage to take on the
new “uncharted” challenge. If you think you are fearful of
taking on new challenges, try to think about
remaining static and not growing with the organization. Don’t
get left behind!
Adjust. All challenges that present themselves should not be
accepted. The crux of this section is to
73. learn to be able and willing to accept challenges that will help
you grow and learn – not challenges that
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
19
have no “upside” and will spread your efforts too thin. Mastery
is the key. There is a saying that if you
want to know what you will be like in 5 years – look at the
people you surround yourself with. Surround
yourself with people that challenge you to grow and learn.
It is also important to challenge your employees. It can re-
engage your employees to the organization.
As a leader, you are responsible for the forward momentum of
your employees. Help them grow, give
them special challenges, motivate them to have the courage to
go where they haven’t gone before.
Here are a few ways to challenge employees:14
74. ir own challenges to support career
advancement
– why they make
what they make, and how to get a
promotion
– engage them in decision making
k.
to complete a task
– they are good things!
another
Key Behaviors. Lana Kravtsova15 gives an exercise to help with
the avoidance of challenge. She says to
take a clean sheet of paper and draw vertical lines to create two
columns. In the first column, list some
of your life’s challenges that you have had or are going through
currently; in the second column, list the
corresponding positive lessons that you learned from going
through the challenge. Here are a few
75. examples: first day at a new company | overcoming fear; not
being a micromanager | learning to trust;
fear of increased work responsibilities | increased self-efficacy.
Here are the Key Behaviors for accepting challenge.
1. When a challenge is presented to you (from yourself or
others) acknowledge the challenge.
2. Evaluate potential “upside” – promotions, capable with more
responsibility, etc.
3. Evaluate potential resources needed to accomplish the
challenge.
4. Read the chapter on Decision Analysis and analyze the risks,
ambiguities, and uncertainties
associated with the challenge.
5. Make a decision to accept or reject challenge.
Day Dreaming and Other Distractions
Recognize. Does your brain wander at work? Do you find
yourself thinking about how things should be,
how things would be different if you were boss? While there is
nothing wrong with visualizing a better
work environment or mentally preparing for your next
promotion (it is actually good for your brain) –
76. dreaming about those things can detract time and mental effort
away from your day-to-day
responsibilities and developing an action plan for those dreams.
Furthermore, other distractions can
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
20
creep up – they promise only a 5 minute break from what we are
doing which turns into half an hour on
the computer or counseling an employee.
Admit. All of our brains wander into creativity. The issue is
whether or not it fits the mission, you can
press pause on the wandering, and start developing the idea on
paper – give it legs. This should be a
quick process - dream, refine vision, plan, and action - not a
half-day affair to avoid something.
Douglas Cootey has described the four stages of
77. daydreaming:16
1. Normal – When attention drifts away. You lose focus
temporarily. This stage is when you come
up with new ideas – mostly everyone does this.
2. Dangerous – This is when time runs away from you. You are
so entertained in your daydream
that you are not conscious of time. This stage can be
problematic for your day-to-day tasks and
deadlines.
3. Serious – This stage is when you experience physiological
changes. Your heart rate increases and
you feel emotions. This stage will cause you to make mistakes
at your job – it will detach you
from reality.
4. Mentally unstable – This is when you are unable to come
back to reality. You live in a constant
state of confusing fantasy with reality. Most of us never get
here.
The next time you are reading a work-related email or document
– investigate how many times you stop
when you hear an email “ding”, another person interrupts you,
you mentally shift to another issue, or
78. something else takes your attention away from the work
email/document. Research17 has shown that
office workers experience an interruption every 3 minutes.
Moreover, it can take up to 23 minutes for a
worker to resume their task after the disruption initiated.
Distractions are often boundary violations.
These violations can range from the obvious (someone
interrupting your work), to the ones that “sneak
in” – checking email constantly, responding to social
application “dings”, or thinking about that summer
vacation coming up soon.
Adjust. The best way to limit your time daydreaming is to
identify what triggers your daydreams and
avoid or limit doing them.18 It is also important to get enough
sleep. Research suggests that men need 7-
8 hours of sleep per night, while women need 8-9. Not
achieving these numbers can result in lack of
concentration, daydreaming, and being out of touch with
reality.19 Finally, you can retrain your brain
with a timer. Use a timer on your phone or a timer on the
internet to retrain your brain to daydream for
a certain amount of time. Set the timer for 5 minutes. Allow
yourself that time to go into the creativity
79. dream – when the buzzer goes off – it’s time to refocus.20
Distractions are like eating – you need to eat every now and
again, but eating constantly will lower your
effectiveness. In the same way, distractions can allow your
brain to unwind and relax in between mental
strain. The issue that many people have is becoming distracted
constantly because they do not like their
work or they let technology run their life.
Key Behaviors: Here are the Key Behaviors for daydreaming
and other distractions:21
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
21
1. Identify and list possible triggers for your daydreaming.
2. When you feel yourself slipping into a dream – set the timer
for 5 minutes. When the time goes
off –refocus on your task.
80. 3. Get enough sleep EVERY night.
4. Schedule and enforce a set amount of time in your day for
email – preferably in a “low
productive” time of the day for you. Once you are finished –
close the email application.
5. If you work at a computer – close all internet and social
messaging applications during
productivity hours.
6. If you work in a cubicle, you may want to invest in some
noise-cancelling headphones.
7. Allow 5 minutes on the hour to get up, stretch, move, and be
distracted.
8. When you must head to meetings, allow time for distraction –
this is how you engage your
employees and practice good talent management.
9. Set times and durations for distractions – try not to think
about work during these times.
10. Establish boundaries for others: Tell them about your “peak
productivity hours” and ask them
not to interrupt. If they continue to interrupt – ask them gently
to respect your set boundary.
Not Giving Employees Meaningful Work
81. Recognize. People have strong motivation to seek meaning in
their work. Employees want to feel
worthwhile and make a difference; so, there must be a balance
between work requirements and an
employee’s own personal purpose and interests. Disengagement
occurs when the employee does not
have a personal connection to their work role so learn about
employees’ goals and determine which
roles would enable them to express themselves best.
Admit. There are many things that managers can do to make
work meaningful to employees. Questions
to ask are: Do you personally learn about employees’ goals and
determine which roles could be best for
them? Do you find ways to give employees autonomy and allow
them to make decisions pertaining to
these issues? Do your employees have opportunities to learn
new skills? Do you keep meaningful work
from some employees – your “out” group? Do you give
employees information about the organization,
so they can find a more rewarding position in it? Are you on the
lookout for talent (see our talent
management chapter)? Do you let employees “see the books”
82. and explain how their roles are vitally
important to the organization as a whole? Do you give honest
performance feedback? All of these things
are part of making work more meaningful for employees. Great
leaders learn to make these part of their
job because they want engaged employees.
Adjust. Unfortunately, too many managers don’t even try to
make work meaningful for the people
doing it; they don’t see it as their job. Managers in such
companies seem to think that paying people is
reason enough for them to perform at their best. But extrinsic
motivation only goes so far. Even the
“self-starters” need feedback and encouragement. And, the
company may not help you: their mission
statements fall flat, their selection systems are all about
technical skill, and they may not care if a
person’s values match the job or not. So your job is to kick in
and do it for the company. These
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
83. Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
22
employees work for you and your team will stand out with true
engagement. So match people to tasks
and jobs that will engage them.
Key Behaviors. Here are the Key Behaviors for match people to
jobs to increase engagement:
1. In your interview guide (see Talent Management) add
questions that get at personal needs for
engagement and even advancement. Learn about employees’
goals and determine which roles
be best for them.
2. In your interviewing process, add a realistic job preview so
employee expectations are realistic.
3. Let employees arrange task or jobs to suit their needs.
4. Ask your employees if they want opportunities to learn new
skills and what.
5. Ask yourself if an employee is in your “in” or “out” group
when assigning tasks or projects. Be
fair to the “out” group (who you may not trust, give less
feedback, and give less discretion) in
84. assigning work.
6. Make sure you give employees information about the
organization – job openings, other areas –
and even other companies.
7. Give honest performance feedback.
Not Adding Value for Customers
Recognize. Adding value to customers requires long term
customer relationships, diagnosis of their
needs and wants, a personal strength and foundation to move
away from one’s own needs to those of
the customer, knowledge of what the employee and company
can offer as well as what the competition
can offer, networking to find this out, and honesty with the
customer. There is a complete shift to the
customers’ point of view: from short term indices or sales
quotas to long term customer relationships,
from capturing or manipulating the customer to servicing the
customer, and assessing success not by
sales or number of interactions but by customer satisfaction.
Admit. Consumers’ habits have begun to change dramatically.
They now trust online information such
85. as the opinions of strangers shared in public forums. Consumers
have become savvy researchers and are
considering reviews in context and examining advice to suit
their particular needs. You may try hiding
the fact that you can’t do the best job for a customer, but it
won’t work. Sometimes adding value
requires losing to win. If you can’t add value, someone else can;
and your customer will find them. You
should tell the customer who that is. You may lose a sale but
you will gain a committed, loyal customer.
If your department or company cannot supply what the customer
wants or needs, you and your
employees should have the integrity to say so, and the authority
to tell the customer where to find what
is needed.
Adjust. Start by letting employees know that the customer is
your prime focus and practice it. Ask
yourself, “What will my customer think about this” each and
every time you make a decision. Life no
longer revolves around just what matters most to you. Whenever
our customers (or students) are
becoming a nuisance is when we have stopped trying to add
value. Encourage employees to develop
86. creative ways to serve customers. Engaged employees add value
for their customers.
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
23
Key Behaviors. The Key Behaviors to try out in adding value
are:
1. Develop a plan to build long term customer relationships.
2. Diagnose customers’ needs and wants.
3. Develop the personal strength to move away from your needs
to customer needs.
4. Develop a full knowledge of what you can offer as well as
what the competition can offer.
5. Network to find this out.
6. Offer value in every transaction – even if it is from another
company or department.
7. Do not forget to attend to your communication style and
87. interaction with a customer – it is not
all transaction.
8. Acknowledge your appreciation for and by the customer.
FINAL PERSONAL TAKEAWAYS
Action Plan
Take a few minutes and complete this Action Plan about driving
for results.
Driving for Results
Self-Handicaps
What is the
Situation
Trigger Impact on
Others
What to Do/When
Having no personal
vision/action plan
___Expedient
89. ___Look & Listen___________
Modeling mastery
and creating an
environment of
mastery for
employees
___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Avoiding Challenge ___Expedient
___Avoiding
___Apprehension
___Self-Deception
90. ___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Staying “busy”
without aligning
processes with
___Expedient
___Avoiding
___Apprehension
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
91. 24
Baby Steps
This chapter is the final step in eliminating self-handicapping.
Lots of issues were discussed, but here are
a few baby steps for you to implement now.
The baby steps for this chapter are:
1. Every day, start with a small and easy task that you can
complete quickly - Don’t forget to make
your bed every morning! Be proud of it.
2. Write out a personal vision of building competence and
develop an action plan that aligns with
that vision.
3. From the plan, identify a longer-term goal and break it down
into yearly, monthly, and weekly
target checkpoints.
4. Take a piece of paper and write down all of the things you
did last week that were not mastery-
oriented. What did you do to be better or to stay out of trouble?
Think about the proportion of
92. time spent in performance goals and how that is affecting your
career.
Follow Up Questions
outcomes ___Self-Deception ___Look & Listen___________
Day dreaming
without results
___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Allowing distractions ___Expedient
___Avoiding
___Apprehension
93. ___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Making work
meaningful for
employees
___Expedient
___Avoiding
___Apprehension
___Self-Deception
___Deliberate Action________
___Self-efficacy_____________
___Face it _________________
___Look & Listen___________
Adding value for
customers
95. ___Look & Listen___________
SELF-HANDICAPPING LEADERSHIP: The Behaviors Holding
Back Employees, Managers, and Companies, and How To
Overcome Them
Copyright Phillip J Decker and Jordan Mitchell, 2015. All
rights reserved
25
1. Does your personal vision conflict with your organization?
Job?
2. Why do you get consumed by distractions? Because you are
extroverted? Hate your job? Are
just bored? Or, are performance-oriented?
3. How can I be more mastery-oriented – or is it something
innate that I can’t change?
4. What more do I need to know about adding value for
customers? Where will I find it?
END NOTES
1. Adapted from http://zengerfolkman.com/the-16-days-of-
competencies-6-drives-for-results/ and
http://www. assess-systems.com/thought-
96. leadership/articles/competency-spotlight-driving-for-
results-and-delivering-results/, downloaded 6-5-15.
2. See http://www.amazon.com/Good-Great-Some-Companies-
Others/dp/0066620996/ref=sr_1_1?s=books&ie=UTF8&qid=141
6599068&sr=1-
1&keywords=good+to+great, downloaded 6-5-15.
3. Chad Kettner, in a review,
http://www.goodreads.com/book/show/76865.Good_to_Great,
downloaded 6-5-15.
4. Ibid, See Note 3.
5. See http://scoopdeck.navytimes.com/2014/05/19/top-seals-
life-advice-make-your-bed/, downloaded
6-5-15.
6. Adapted from http://blog.ted.com/2013/04/10/what-
motivates-us-at-work-7-fascinating-studies-
that-give-insights/, downloaded 6-5-15.
7. Adapted from http://www.inc.com/guides/2010/08/how-to-
become-a-servant-leader.html, and
http://www.butler.edu/volunteer/resources/principles-of-
servant-leadership/, downloaded 6-5-15.
8. Summarized from Pink, DH. (2009). Drive: The Surprising
Truth About What Motivates Us, Riverhead
97. Books/Penguin Group, NY, NY.
9. See Hackman, J. R. & Oldham, G. R. (2005). How job
characteristics theory happened. The Oxford
handbook of management theory: The process of theory
development, 151-170.
10. See
http://humanresources.about.com/od/success/a/personalvision.ht
m, downloaded 6-8-15.
11. See http://prinyourpajamas.com/how-to-create-your-vision/
or
http://www.quintcareers.com/creating_personal_mission_statem
ents.html, downloaded 6-8-15.
12. Summarized from http://seapointcenter.com/personal-vision/
and
http://www.carrollk12.org/Assets/file/MVH/Resources/Portfolio
%20-%20Mission%20Statement.pdf,
downloaded 6-8-15.
13. Summarized from
http://www.niu.edu/eteams/pdf_s/GO_GuideCreatingMasteryOri
entedClassrooms.pdf, downloaded 6-
8-15.
14. Summarized from
http://www.incentivemag.com//Strategy/Ask-the-Experts/Roy-