Final Applied Lab Project-BIOL 103The Effect of low pH on Enzyme A.docx
•Download as DOCX, PDF•
0 likes•11 views
Final Applied Lab Project-BIOL 103The Effect of low pH on Enzyme Activity Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. Recall: enzymes are proteins! To complete this project, it may be useful for you to first review the Scientific Method Tutorial, the OLI module about pH and enzymes, Lab 1 (Introduction to Science) and Lab 4 (Enzymes). As you review Lab 4, you will be reminded that there are several factors that impact enzymatic activity: pH, temperature, and amount of reagent. It is OK to use the same enzyme/substrate/method as you did in lab 4 (but modify the treatment), but you are encouraged to search on-line to find a different enzyme/substrate/method for measuring enzyme activity for your project (include all references). As you design your experiment for this project, please remember that you are trying to examine how an acidic fluid will modify the outcome of an enzymatic reaction. To successfully complete this project, you will need to identify the question(s) being asked in your experiment and the hypothesis that you are testing. In your experimental design, you must clearly explain what you are doing. That means that you will need to identify the enzyme, the substrate, the acidic fluid used as treatment, the control treatment and the method of measuring enzyme activity, as well as explain your experimental protocol. You must also thoroughly explain how the acidic fluid impacted enzyme activity based on the results from your own experiment as well as knowledge of enzymes and pH from the OLI modules, lab manual and potentially additional information sources. Submit Files - Final Applied Lab Project Top of Form Folder Final Applied Lab Project Instructions Final Applied Lab Project Addresses course outcomes 1-4: · recognize and explain how the scientific method is used to solve problems · make observations and discriminate between scientific and pseudoscientific explanations · weigh evidence and make decisions based on strengths and limitations of scientific knowledge and the scientific method · use knowledge of biological principles, the scientific method, and appropriate technologies to ask relevant questions, develop hypotheses, design and conduct experiments, interpret results, and draw conclusions This is the culminating lab assessment in BIOL 103. It is designed to assess your ability to apply the principles of the scientific method. The Effect of low pH on Enzyme Activity Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. Recall: enzymes are proteins! To complete this project, it may be useful for you to first review the Scientific Method Tutorial, the OLI module about pH and enzymes, Lab 1 (Introduction to Science) and Lab 4 (Enzymes). As you review Lab 4, you will be reminded that there are several factors that impact enzymatic activity: pH, temperature, and amount of reagent. It is OK to use the same enzyme/s ...
Report
Share
Report
Share
Recommended
FINAL APPLIED LAB PROJECT (1 CREDIT LAB COMPONENT)
This document outlines the requirements for a final applied lab project assessing a student's ability to apply the scientific method. Students must design an experiment to test the effect of an acidic fluid on enzyme activity. They will measure the impact of pH on a chosen enzyme-substrate reaction. The project involves writing a paper that includes an introduction, experimental design, results, discussion, conclusion, and references. An outline is to be submitted in advance for feedback. The goal is to examine how an acidic treatment modifies an enzymatic reaction to determine if results support the hypothesis.
Final Applied Lab Project (1 credit Lab Component) Addresses cou.docx
Final Applied Lab Project (1 credit Lab Component)
Addresses course outcomes 1-4:
· recognize and explain how the scientific method is used to solve problems
· make observations and discriminate between scientific and pseudoscientific explanations
· weigh evidence and make decisions based on strengths and limitations of scientific knowledge and the scientific method
· use knowledge of biological principles, the scientific method, and appropriate technologies to ask relevant questions, develop hypotheses, design and conduct experiments, interpret results, and draw conclusions
This is the culminating lab assessment in BIOL 102. It is designed to assess your ability to apply the principles of the scientific method.
The Effect of low pH on Enzyme Activity
Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. Recall: enzymes are proteins! To complete this project, it may be useful for you to first review the Scientific Method Tutorial, information about pH and enzymes in the text book and course modules, Lab 1 (Introduction to Science) and Lab 4 (Enzymes). As you review Lab 4, you will be reminded that there are several factors that impact enzymatic activity: pH, temperature, and amount of reagent. It is OK to use the same enzyme/substrate/method as you did in lab 4 (but modify the treatment), or you can search on-line to find a different enzyme/substrate/method for measuring enzyme activity for your project (include all references).
As you design your experiment for this project, please remember that you are trying to examine how an acidic fluid will modify the outcome of an enzymatic reaction. To successfully complete this project, you will need to identify the question(s) being asked in your experiment and the hypothesis that you are testing. In your experimental design, you must clearly explain what you are doing. That means that you will need to identify the enzyme, the substrate, the acidic fluid used as treatment, the control treatment and the method of measuring enzyme activity, as well as explain your experimental protocol. You must also thoroughly explain how the acidic fluid impacted enzyme activity based on the results from your own experiment as well as knowledge of enzymes and pH from the text book, modules, lab manual and potentially additional information sources.
Hint: Keep in mind that the acid will change the environmental conditions of the experiment (for example, a low pH value could change the shape of the active site on the enzyme protein), without directly participating in the reaction.
Lab Materials
You may need all or some of the following, depending on your experimental design:
Materials from your lab kit:
· pH paper
· hydrogen peroxide solution (you can purchase this at a pharmacy if you have used up the bottle that came with the lab kit)
· plastic beakers or cups
· vinegar
· yeast (can be purchased at grocery store if more is needed)
· balloons
· plastic bottle
· marker f ...
Running Head Title1Title3TitleNameSCI 207 De.docx
Running Head: Title
1
Title
3
Title
Name
SCI 207: Dependence of man on the environment
Instructor
Date
*This template will provide you with the details necessary to finalize a quality Final Lab Report. Utilize this template to complete the Week 5 Final Lab Report and ensure that you are providing all of the necessary information and proper format for the assignment. Before you begin, please note the following important information:
1. Carefully review the Final Lab Report instructions before you begin this assignment.
2. The Final Lab Report should cover all 3 experiments from your Week Two Lab.
3. Review instructor feedback from the Week Three outline of the Final Lab Report and make changes as necessary.
4. Review the Sample Final Lab Report for an example of a final product on a different topic. Your format should look like this sample report before submission.
5. Run your Final Lab Report through Turnitin using the student folder to ensure protection from accidental plagiarism
Title
Abstract
The abstract should provide a brief summary of the methods, results, and conclusions. It should very briefly allow the reader to see what was done, how it was done, and the results. It should not exceed 200 words and should be the last part written (although it should still appear right after the title page).
Introduction
The introduction should describe the background of water quality and related issues using cited examples. You should include scholarly sources in this section to help explain why water quality research is important to society. When writing this section, make sure to cite all resources in APA format.
The introduction should also contain the objective for your study. This objective is the reason why the experiment is being done. Your final report should provide an objective that describes why we want to know the answer to the questions we are asking.
Finally, the introduction should end with your hypotheses. This section should include a hypothesis for each one of the three experiments. These hypotheses should be the same ones posed before you began your experiments. You may reword them following feedback from your instructor to illustrate a proper hypothesis, however, you should not adjust them to reflect the “right” answer. You do not lose points for an inaccurate hypothesis; scientists often revise their hypotheses based on scientific evidence following an experiment.
Materials and Methods
The materials and methods section should provide a brief description of the specialized materials used in your experiment and how they were used. This section needs to summarize the instructions with enough detail so that an outsider who does not have a copy of the lab instructions knows what you did. However, this does not mean writing every little step like “dip the pH test strip in the water, then shake the test strips,” these steps can be simplified to read “we used pH test strips to measure water pH”, etc. Additionally, this se.
Running Head Title1Title4TitleNameSCI 207 De.docx
Running Head: Title
1
Title
4
Title
Name
SCI 207: Dependence of man on the environment
Instructor
Date
*This template will provide you with the details necessary to finalize a quality Final Lab Report. Utilize this template to complete the Week 5 Final Lab Report and ensure that you are providing all of the necessary information and proper format for the assignment. Before you begin, please note the following important information:
1. Carefully review the Final Lab Report instructions before you begin this assignment
2. The Final Lab Report should cover all 3 experiments from your Week Two Lab
3. Review instructor feedback from the Week Three outline of the final lab report and make changes as necessary
4. Review the Sample Final Lab Report for an example of a final product on a different topic. Your format should look like this sample report before submission.
5. Run your Final Lab Report through turnitin using the student folder to ensure protection from accidental plagiarism
Title
Abstract
The abstract should provide a brief summary of the methods, results, and conclusions. It should very briefly allow the reader to see what was done, how it was done, and the results. It should not exceed 200 words and should be the last part written (although it should still appear right after the title page).
Introduction
The introduction should describe the background of water quality and related issues using cited examples. You should include scholarly sources in this section to help explain why water quality research is important to society. When writing this section, make sure to cite all resources in APA format.
The introduction should also contain the objective for your study. This objective is the reason why the experiment is being done. Your final report should provide an objective that describes why we want to know the answer to the questions we are asking.
Finally, the introduction should end with your hypotheses. This section should include a hypothesis for each one of the three experiments. These hypotheses should be the same ones posed before you began your experiments. You may reword them following feedback from your instructor to illustrate a proper hypothesis, however, you should not adjust them to reflect the “right” answer. You do not lose points for an inaccurate hypothesis; scientists often revise their hypotheses based on scientific evidence following an experiment.
Materials and Methods
The materials and methods section should provide a brief description of the specialized materials used in your experiment and how they were used. This section needs to summarize the instructions with enough detail so that an outsider who does not have a copy of the lab instructions knows what you did. However, this does not mean writing every little step like “dip the pH test strip in the water, then shake the test strips,” these steps can be simplified to read “we used pH test strips to measure water pH”, etc. Additionally, this se.
Design an experiment in which you will test the effect of an acidic .docx
Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. (Recall: Enzymes are proteins.) If necessary, it may be useful for you to review the Scientific Method Tutorial (found in the Course Content section of the classroom).
Lab Materials
You may need the following, depending on your experimental design:
Materials in your lab kit:
none
Additional materials you may need:
plastic beakers or cups
hydrogen peroxide solution (from Lab 4)
yeast (from Lab 4)
sample of fresh meat, about 1 cm cubed in size (unprocessed and uncooked, e.g., liver, steak, fish, or poultry—particularly organs)
sample of fresh vegetable, about 1 cm cubed in size (e.g., potatoes or other root vegetables)
a pen for labeling the beakers or cups
a ruler with centimeter markings
1. Write a brief introduction. Include the question that you are asking and a clear hypothesis for your experiment (15 points).
2. Design an experiment. Provide a detailed account of the materials and methods used to conduct the experiment. Also include the methods for data collection and analysis (20 points).
3. Conduct the experiment and record your results below. What did you observe? Which samples showed bubbling? Rate the bubbling for comparison between samples. Present your data in table or graph format. You might also include pictures (20 points).
4. Use your knowledge about enzymes to interpret and discuss your results. It may be necessary for you to refer to your textbook and/or use other information resources. What effect does the acid have on the enzyme? Looking back, how could you have improved the experiment? (20 points)
5. What is your conclusion? Was your hypothesis supported? (15 points)
6. Cite all reference sources used (including text book) and provide a reference section with citations in APA format (10 points).
Grading
Your Final Applied Lab Project will be graded based on the following criteria (100 points total):
Excellent
Good
Poor
Unacceptable
Outline
5 points
Outline includes brief description of planned experiment that meets the assignment description. Submitted on time.
5 points
Outline includes brief description of planned experiment, but a few issues with content, relevance and/or organization. Submitted on time.
3-4 points
Outline includes brief description of planned experiment, but major issues with content, relevance and/or organization, and/or not submitted on time.
1-2 points
No outline submitted
0 points
Introduction, Question and Hypothesis
15 points
Accurate and specific introduction, question and hypothesis that is directly related to the experiment
12-15 points
Introduction, question, and/or hypothesis is somewhat vague or includes some mitakes, and/or not directly related to experiment
5-11 points
Missing introduction, question and/or hypothesis, and/or very vague and/or not related to experiment.
1-.
Qualitative Analysis of Functional Groups Assignment - SCH4U h5, Chemistry, 1...
SCH4U h5+, Chemistry, 12, University Virtual High School
Unit Assignment: Qualitative Analysis of Functional Groups Assignment
Request the complete assignment now.
LamiaFinal data ( results).docx1- label all lanes, label ma.docx
Lamia/Final data ( results).docx
1- label all lanes, label marker sizes, and indicate which three lanes, containing at least one BSA sample and one E. coli sample, you are writing about.
2- lanes 2, 5, 6, 9, and 11 are BSA, lanes 14 and 15 are empty, and lanes 3, 4, 7, 8, 10, 12, and 13 are E. coli.
Lamia/Graphing page.pdf
Lamia/Guidelines.doc
Biology 105 Laboratory Fall 2013
Instructor: Ayça Akal-Strader
Guidelines for Lab Report
Lab 2: Quantification of Protein (Bradford Assay)
Your report for Lab 2: Quantification of Protein (Bradford Assay) is due the week of October 7/8/9/10. Please include the following information in your report:
Hypothesis: as usual
Introduction:
• Background/theory of Bradford Assay
• Purpose of the experiment
Results:
In addition to the specific data discussed below, your Results section should always include one or more paragraphs of text that provide:
• A brief description of the procedure
• Explanations of any charts, graphs, figures, or calculations that are included
• Statements about the most interesting/noteworthy data
Data:
1. Table of measured absorbances (like Table 2 on p. 31).
2. Table showing protein concentrations of unknowns (like Table 3 on p. 31). Say which unknowns—1, 2, or both—you used.
**Please re-make the tables for your report. DO NOT simply tear out p. 31 from your lab manual and staple it to your report.
3. Standard Curve:
• Label with title and caption
• Label axes: x-axis = Concentration (μg/ml); y-axis = Absorbance at 595 nm. Be sure to include units on Concentration. Remember that absorbance (optical density; OD) has no units.
• Plot points, leaving room to plug in your unknown absorbances to find their concentrations
• Connect the dots
(Note: Do NOT draw a straight line—unless your data really looks like a straight line. The samples we measured did not fall into the “linear range” of the spectrophotometer, and everyone’s data that I saw flattened out a lot at the high concentration end of the range. Connect your data points with a curve.)
• Indicate by drawing horizontal and vertical lines how you found the concentration of your unknowns.
Discussion:
• Did your results match your expectations? If not, why not?
• Did you have any difficulty finding the concentration of any of your unknowns?
• Do you think your measurement of protein concentration was accurate? Did your duplicates agree well? For your standards, did your absorbances increase as your protein concentrations increased?
Conclusion: as usual
Lab Report Rewrites
You may rewrite TWO of your first FIVE lab reports in an effort to improve your grade.
You do not need to rewrite the entire report; just fix the problems that caused you to lose points the first time around.
You MUST hand in the original version of your report along with your corrected version. If you do not have the original attached, we will not accept your rewrite.
Your final grade on the rewritten report will be ...
Umuc biology 102103 Success Begins / snaptutorial.com
Exercise 1: Data Interpretation
Dissolved oxygen is oxygen that is trapped in a fluid, such as water. Since many living organism requires oxygen to survive, it is a necessary component of water systems such as streams, lakes and rivers in order to support aquatic life. The dissolved oxygen is measured in units of ppm (parts per million). Examine the data in Table 4 showing the amount of dissolved oxygen present and the number of fish observed in the body of water the sample was taken from; finally, answer the questions below.
Post-Lab Questions
1. What patterns do you observe based on the information in Table 4?
2. Develop a hypothesis relating to the amount of dissolved oxygen measured in the water sample and the number of fish observed in the body of water.
3. What would your experimental approach be to test this hypothesis?
4. What would be the independent and dependent variables?
Recommended
FINAL APPLIED LAB PROJECT (1 CREDIT LAB COMPONENT)
This document outlines the requirements for a final applied lab project assessing a student's ability to apply the scientific method. Students must design an experiment to test the effect of an acidic fluid on enzyme activity. They will measure the impact of pH on a chosen enzyme-substrate reaction. The project involves writing a paper that includes an introduction, experimental design, results, discussion, conclusion, and references. An outline is to be submitted in advance for feedback. The goal is to examine how an acidic treatment modifies an enzymatic reaction to determine if results support the hypothesis.
Final Applied Lab Project (1 credit Lab Component) Addresses cou.docx
Final Applied Lab Project (1 credit Lab Component)
Addresses course outcomes 1-4:
· recognize and explain how the scientific method is used to solve problems
· make observations and discriminate between scientific and pseudoscientific explanations
· weigh evidence and make decisions based on strengths and limitations of scientific knowledge and the scientific method
· use knowledge of biological principles, the scientific method, and appropriate technologies to ask relevant questions, develop hypotheses, design and conduct experiments, interpret results, and draw conclusions
This is the culminating lab assessment in BIOL 102. It is designed to assess your ability to apply the principles of the scientific method.
The Effect of low pH on Enzyme Activity
Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. Recall: enzymes are proteins! To complete this project, it may be useful for you to first review the Scientific Method Tutorial, information about pH and enzymes in the text book and course modules, Lab 1 (Introduction to Science) and Lab 4 (Enzymes). As you review Lab 4, you will be reminded that there are several factors that impact enzymatic activity: pH, temperature, and amount of reagent. It is OK to use the same enzyme/substrate/method as you did in lab 4 (but modify the treatment), or you can search on-line to find a different enzyme/substrate/method for measuring enzyme activity for your project (include all references).
As you design your experiment for this project, please remember that you are trying to examine how an acidic fluid will modify the outcome of an enzymatic reaction. To successfully complete this project, you will need to identify the question(s) being asked in your experiment and the hypothesis that you are testing. In your experimental design, you must clearly explain what you are doing. That means that you will need to identify the enzyme, the substrate, the acidic fluid used as treatment, the control treatment and the method of measuring enzyme activity, as well as explain your experimental protocol. You must also thoroughly explain how the acidic fluid impacted enzyme activity based on the results from your own experiment as well as knowledge of enzymes and pH from the text book, modules, lab manual and potentially additional information sources.
Hint: Keep in mind that the acid will change the environmental conditions of the experiment (for example, a low pH value could change the shape of the active site on the enzyme protein), without directly participating in the reaction.
Lab Materials
You may need all or some of the following, depending on your experimental design:
Materials from your lab kit:
· pH paper
· hydrogen peroxide solution (you can purchase this at a pharmacy if you have used up the bottle that came with the lab kit)
· plastic beakers or cups
· vinegar
· yeast (can be purchased at grocery store if more is needed)
· balloons
· plastic bottle
· marker f ...
Running Head Title1Title3TitleNameSCI 207 De.docx
Running Head: Title
1
Title
3
Title
Name
SCI 207: Dependence of man on the environment
Instructor
Date
*This template will provide you with the details necessary to finalize a quality Final Lab Report. Utilize this template to complete the Week 5 Final Lab Report and ensure that you are providing all of the necessary information and proper format for the assignment. Before you begin, please note the following important information:
1. Carefully review the Final Lab Report instructions before you begin this assignment.
2. The Final Lab Report should cover all 3 experiments from your Week Two Lab.
3. Review instructor feedback from the Week Three outline of the Final Lab Report and make changes as necessary.
4. Review the Sample Final Lab Report for an example of a final product on a different topic. Your format should look like this sample report before submission.
5. Run your Final Lab Report through Turnitin using the student folder to ensure protection from accidental plagiarism
Title
Abstract
The abstract should provide a brief summary of the methods, results, and conclusions. It should very briefly allow the reader to see what was done, how it was done, and the results. It should not exceed 200 words and should be the last part written (although it should still appear right after the title page).
Introduction
The introduction should describe the background of water quality and related issues using cited examples. You should include scholarly sources in this section to help explain why water quality research is important to society. When writing this section, make sure to cite all resources in APA format.
The introduction should also contain the objective for your study. This objective is the reason why the experiment is being done. Your final report should provide an objective that describes why we want to know the answer to the questions we are asking.
Finally, the introduction should end with your hypotheses. This section should include a hypothesis for each one of the three experiments. These hypotheses should be the same ones posed before you began your experiments. You may reword them following feedback from your instructor to illustrate a proper hypothesis, however, you should not adjust them to reflect the “right” answer. You do not lose points for an inaccurate hypothesis; scientists often revise their hypotheses based on scientific evidence following an experiment.
Materials and Methods
The materials and methods section should provide a brief description of the specialized materials used in your experiment and how they were used. This section needs to summarize the instructions with enough detail so that an outsider who does not have a copy of the lab instructions knows what you did. However, this does not mean writing every little step like “dip the pH test strip in the water, then shake the test strips,” these steps can be simplified to read “we used pH test strips to measure water pH”, etc. Additionally, this se.
Running Head Title1Title4TitleNameSCI 207 De.docx
Running Head: Title
1
Title
4
Title
Name
SCI 207: Dependence of man on the environment
Instructor
Date
*This template will provide you with the details necessary to finalize a quality Final Lab Report. Utilize this template to complete the Week 5 Final Lab Report and ensure that you are providing all of the necessary information and proper format for the assignment. Before you begin, please note the following important information:
1. Carefully review the Final Lab Report instructions before you begin this assignment
2. The Final Lab Report should cover all 3 experiments from your Week Two Lab
3. Review instructor feedback from the Week Three outline of the final lab report and make changes as necessary
4. Review the Sample Final Lab Report for an example of a final product on a different topic. Your format should look like this sample report before submission.
5. Run your Final Lab Report through turnitin using the student folder to ensure protection from accidental plagiarism
Title
Abstract
The abstract should provide a brief summary of the methods, results, and conclusions. It should very briefly allow the reader to see what was done, how it was done, and the results. It should not exceed 200 words and should be the last part written (although it should still appear right after the title page).
Introduction
The introduction should describe the background of water quality and related issues using cited examples. You should include scholarly sources in this section to help explain why water quality research is important to society. When writing this section, make sure to cite all resources in APA format.
The introduction should also contain the objective for your study. This objective is the reason why the experiment is being done. Your final report should provide an objective that describes why we want to know the answer to the questions we are asking.
Finally, the introduction should end with your hypotheses. This section should include a hypothesis for each one of the three experiments. These hypotheses should be the same ones posed before you began your experiments. You may reword them following feedback from your instructor to illustrate a proper hypothesis, however, you should not adjust them to reflect the “right” answer. You do not lose points for an inaccurate hypothesis; scientists often revise their hypotheses based on scientific evidence following an experiment.
Materials and Methods
The materials and methods section should provide a brief description of the specialized materials used in your experiment and how they were used. This section needs to summarize the instructions with enough detail so that an outsider who does not have a copy of the lab instructions knows what you did. However, this does not mean writing every little step like “dip the pH test strip in the water, then shake the test strips,” these steps can be simplified to read “we used pH test strips to measure water pH”, etc. Additionally, this se.
Design an experiment in which you will test the effect of an acidic .docx
Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. (Recall: Enzymes are proteins.) If necessary, it may be useful for you to review the Scientific Method Tutorial (found in the Course Content section of the classroom).
Lab Materials
You may need the following, depending on your experimental design:
Materials in your lab kit:
none
Additional materials you may need:
plastic beakers or cups
hydrogen peroxide solution (from Lab 4)
yeast (from Lab 4)
sample of fresh meat, about 1 cm cubed in size (unprocessed and uncooked, e.g., liver, steak, fish, or poultry—particularly organs)
sample of fresh vegetable, about 1 cm cubed in size (e.g., potatoes or other root vegetables)
a pen for labeling the beakers or cups
a ruler with centimeter markings
1. Write a brief introduction. Include the question that you are asking and a clear hypothesis for your experiment (15 points).
2. Design an experiment. Provide a detailed account of the materials and methods used to conduct the experiment. Also include the methods for data collection and analysis (20 points).
3. Conduct the experiment and record your results below. What did you observe? Which samples showed bubbling? Rate the bubbling for comparison between samples. Present your data in table or graph format. You might also include pictures (20 points).
4. Use your knowledge about enzymes to interpret and discuss your results. It may be necessary for you to refer to your textbook and/or use other information resources. What effect does the acid have on the enzyme? Looking back, how could you have improved the experiment? (20 points)
5. What is your conclusion? Was your hypothesis supported? (15 points)
6. Cite all reference sources used (including text book) and provide a reference section with citations in APA format (10 points).
Grading
Your Final Applied Lab Project will be graded based on the following criteria (100 points total):
Excellent
Good
Poor
Unacceptable
Outline
5 points
Outline includes brief description of planned experiment that meets the assignment description. Submitted on time.
5 points
Outline includes brief description of planned experiment, but a few issues with content, relevance and/or organization. Submitted on time.
3-4 points
Outline includes brief description of planned experiment, but major issues with content, relevance and/or organization, and/or not submitted on time.
1-2 points
No outline submitted
0 points
Introduction, Question and Hypothesis
15 points
Accurate and specific introduction, question and hypothesis that is directly related to the experiment
12-15 points
Introduction, question, and/or hypothesis is somewhat vague or includes some mitakes, and/or not directly related to experiment
5-11 points
Missing introduction, question and/or hypothesis, and/or very vague and/or not related to experiment.
1-.
Qualitative Analysis of Functional Groups Assignment - SCH4U h5, Chemistry, 1...
SCH4U h5+, Chemistry, 12, University Virtual High School
Unit Assignment: Qualitative Analysis of Functional Groups Assignment
Request the complete assignment now.
LamiaFinal data ( results).docx1- label all lanes, label ma.docx
Lamia/Final data ( results).docx
1- label all lanes, label marker sizes, and indicate which three lanes, containing at least one BSA sample and one E. coli sample, you are writing about.
2- lanes 2, 5, 6, 9, and 11 are BSA, lanes 14 and 15 are empty, and lanes 3, 4, 7, 8, 10, 12, and 13 are E. coli.
Lamia/Graphing page.pdf
Lamia/Guidelines.doc
Biology 105 Laboratory Fall 2013
Instructor: Ayça Akal-Strader
Guidelines for Lab Report
Lab 2: Quantification of Protein (Bradford Assay)
Your report for Lab 2: Quantification of Protein (Bradford Assay) is due the week of October 7/8/9/10. Please include the following information in your report:
Hypothesis: as usual
Introduction:
• Background/theory of Bradford Assay
• Purpose of the experiment
Results:
In addition to the specific data discussed below, your Results section should always include one or more paragraphs of text that provide:
• A brief description of the procedure
• Explanations of any charts, graphs, figures, or calculations that are included
• Statements about the most interesting/noteworthy data
Data:
1. Table of measured absorbances (like Table 2 on p. 31).
2. Table showing protein concentrations of unknowns (like Table 3 on p. 31). Say which unknowns—1, 2, or both—you used.
**Please re-make the tables for your report. DO NOT simply tear out p. 31 from your lab manual and staple it to your report.
3. Standard Curve:
• Label with title and caption
• Label axes: x-axis = Concentration (μg/ml); y-axis = Absorbance at 595 nm. Be sure to include units on Concentration. Remember that absorbance (optical density; OD) has no units.
• Plot points, leaving room to plug in your unknown absorbances to find their concentrations
• Connect the dots
(Note: Do NOT draw a straight line—unless your data really looks like a straight line. The samples we measured did not fall into the “linear range” of the spectrophotometer, and everyone’s data that I saw flattened out a lot at the high concentration end of the range. Connect your data points with a curve.)
• Indicate by drawing horizontal and vertical lines how you found the concentration of your unknowns.
Discussion:
• Did your results match your expectations? If not, why not?
• Did you have any difficulty finding the concentration of any of your unknowns?
• Do you think your measurement of protein concentration was accurate? Did your duplicates agree well? For your standards, did your absorbances increase as your protein concentrations increased?
Conclusion: as usual
Lab Report Rewrites
You may rewrite TWO of your first FIVE lab reports in an effort to improve your grade.
You do not need to rewrite the entire report; just fix the problems that caused you to lose points the first time around.
You MUST hand in the original version of your report along with your corrected version. If you do not have the original attached, we will not accept your rewrite.
Your final grade on the rewritten report will be ...
Umuc biology 102103 Success Begins / snaptutorial.com
Exercise 1: Data Interpretation
Dissolved oxygen is oxygen that is trapped in a fluid, such as water. Since many living organism requires oxygen to survive, it is a necessary component of water systems such as streams, lakes and rivers in order to support aquatic life. The dissolved oxygen is measured in units of ppm (parts per million). Examine the data in Table 4 showing the amount of dissolved oxygen present and the number of fish observed in the body of water the sample was taken from; finally, answer the questions below.
Post-Lab Questions
1. What patterns do you observe based on the information in Table 4?
2. Develop a hypothesis relating to the amount of dissolved oxygen measured in the water sample and the number of fish observed in the body of water.
3. What would your experimental approach be to test this hypothesis?
4. What would be the independent and dependent variables?
Assignment classifying reactions report
This document provides instructions for a Year 9 science assignment on classifying chemical reactions. Students must choose a chemical reaction from a list, conduct the reaction experiment, and write a scientific report identifying the products and classifying the reaction type. The report should include an aim, hypothesis, method, results, discussion identifying the reaction type based on evidence from tests, conclusion, and bibliography. Students have access to computers on April 2nd and 3rd to work on their assignment, which is due on April 4th and will be graded based on several criteria.
Written assignment 1 trace the scientific method in a primary scientific article
The document provides instructions for a written assignment asking students to analyze a primary scientific article describing a study investigating whether coffee prevents high blood sugar in diabetic mice. It describes the study where one group of mice was given water and one group was given coffee-water mixture for 5 weeks. Blood glucose was monitored weekly, finding a 30% lower level in the coffee group. Students are asked to outline the scientific method used, form a hypothesis, describe the study design and results, and critique the study limitations and relevance.
Written assignment 1 trace the scientific method in a primary scientific article
The document provides instructions for a written assignment asking students to analyze a primary scientific article describing a study investigating whether coffee prevents high blood sugar in diabetic mice. Students are asked to: 1) outline the scientific method steps used in the study and describe the experimental design; 2) critique the study methodology; 3) discuss the relevance of the research; and 4) submit their response of 300-400 words following APA style guidelines. The study described gave one group of mice water and another group diluted coffee for five weeks, monitoring blood glucose levels weekly. Results showed the coffee group had 30% lower blood glucose than the water group, indicating coffee may reduce diabetes risk.
Written assignment 1 trace the scientific method in a primary scientific article
The document provides instructions for a written assignment asking students to analyze a primary scientific article describing a study investigating whether coffee prevents high blood sugar in diabetic mice. It describes the study where one group of mice was given water and one group was given coffee-water mixture for 5 weeks. Blood glucose was monitored weekly, finding a 30% lower level in the coffee group. Students are asked to outline the scientific method used, form a hypothesis, describe the study design and results, and critique the study limitations and relevance.
PurposeStudents will conduct one brief research exercise that w.docx
Purpose:
Students will conduct one brief research exercise that will be written up as a research report using APA style. Please note: It needs to be written in paper format, not answers to questions. This paper will give the student practical experience in defining explanatory/independent and response/dependent variables, selecting the appropriate statistical technique, conducting data analysis, and writing up research results in APA format. One important note: This assignment will NOT include collecting data from people or animals. Use the data provided by the instructor in the attached spreadsheet. The data was collected from selected foods in a US commissary in Germany.
Content of the Paper:
Following APA guidelines for laboratory reports, your paper must contain the following:
1. Title Page
2. Abstract
3. Introduction – one to two paragraph introduction based on information from one source provided by the instructor. Must include the research question, statement of the research hypothesis, and identification of the explanatory/independent and response/dependent variables.
4. Method – including procedures and information collected.
5. Results – this section describes the statistical analysis used and presents the results in text, statistical, and graphic formats
6. Discussion – including the strengths and limitations of the design and ethical concerns, if any.
7. References
Content of the Paper:
Your paper must contain the following:
Title Page
1. Abstract – Brief (200 words) summary of the study. This should describe:
a. The problem under investigation, in one sentence, if possible
b. The participants (in this case, it would describe the Soups)
c. Essential features of the study method
d. The basic findings
e. Conclusions and implications or applications
2. Introduction – one to two paragraph introduction. Read the "Limit Fat and Sugar" article available at: http://www.nhlbi.nih.gov/health/educational/wecan/eat-right/limit-fat-sugar.htm. Based on this information contained in this article, develop a research question and hypotheses regarding the data collected from the commissary. Be sure to answer all ofthe following questions:
· What is the research question? Specifically, what is the researcher interested in determining from this study? Please be sure to use the information from the article in your report as background information to justify the research question.
· What are the hypotheses being tested? Describe both the null and alternative hypothesis for each of the four nutrients.
· What are the explanatory/independent and response/dependent variables?
3. Method – brief description including procedures and information collected.
· Are the samples independent or dependent? Please explain.
· How was the data collected? (ex. How was the data obtained for the samples?) Note: the data was collected from nutrition fact labels from selected Soups. For more information on Nutritional Food Fact labels, please go to: http://ww ...
Overview of lab 2016.pdf
The document provides information about a laboratory course including:
- Five two-week labs must be completed involving experiments using instrumentation like GC, HPLC, ICP, UV-Vis spectroscopy, and LC-MS.
- Lab reports are due the week following each experiment and constitute 50% of the course grade.
- Experiments involve separation and analysis of compounds using the various instruments and following proper laboratory technique.
how does pH impact the function of peroxidase doc 19.docx
Peroxidase is an enzyme that breaks down hydrogen peroxide. The pH level impacts peroxidase function by affecting its structure and catalytic activity in several ways. Optimal peroxidase activity occurs within a specific pH range, typically acidic to neutral, depending on the source. Changes in pH alter the enzyme's structure and the ionization of amino acids in its active site, disrupting substrate binding and catalytic activity. Deviating from the optimal pH reduces the reaction rate and can fully inactivate the enzyme.
The Do's & Don'ts of Lab Reports (McGill SUS Peer Tutoring)
This document provides guidance on writing an effective lab report, outlining the key sections and what they should contain. It discusses the purpose of each section, including the abstract, introduction, materials and methods, results, discussion, references, and supplemental information. For each section, it provides tips on what to include and examples of both good and bad content. The overall document aims to teach students how to properly structure and communicate the key aspects of a science experiment through a formal written lab report.
C125C126 FORMAL LAB REPORTFORMAL LAB REPORT, GeneralA f.docx
C125/C126 FORMAL LAB REPORT
FORMAL LAB REPORT, General
A formal lab report is required in conjunction with some of the experiments in each chemistry course. It is your chance to demonstrate to your professor or TA how well you understand the experiment and the chemical principles involved. A formal report is different than a term paper. It should be written in a scientific style, which is not the same style used for English or philosophy papers.
The keys to effective technical writing are organization, brevity, clarity, and an appreciation of the needs of the reader. You must write clearly and be thorough, but concise. Do not ramble. The best way to avoid rambling is to first prepare an outline of the report and stick to it. Always use complete sentences. Bulleted lists are okay in a lab notebook but are unacceptable in a formal report. Formal reports must be typed. Use 1.5 line spacing, 1-inch margins, 12 pt font and 8.5x11 inch paper. Only use third person, past tense. Also, proofread well.
The general structure of a formal lab report follows that of a scientific paper. It is:
Title and Author (s)
Introduction
Experimental Information
Data and Calculation
Results and Discussion
Conclusion
References
Results and discussion sections are combined into one single section. Different instructors may have specific formats that they want you to follow. You should always defer to the instructions given to you by your course. Presented here are general guidelines for writing formal lab reports and scientific papers.
Before writing your first report, visit the library and examine several journal articles. Pay close attention to the style of the prose and the contents of each particular section. Several common journals to investigate are:
The Journal of the American Chemical Society
The Journal of Physical Chemistry
Analytical Chemistry
Biochemistry
Initialed and dated laboratory notebook pages of the experiment must be submitted. While report sheets may be a joint effort, formal reports must be individually written. A schedule of reports and dates on which they are due is given in the course laboratory schedule. We highly recommend that reports be completed prior to the day of submission to allow time to proofread, and thus avoiding loss of points due to last minute problems. Lost data or the inability to print reports is not acceptable excuses for incomplete or missing reports. You will be informed when notebook pages will be collected before the report is due.
FORMAL LAB REPORT - Title and Author(s)
State the title of the experiment, your name, the date and your laboratory section number, if applicable. Also state the name of your lab partner(s). This information should be at the top of the first page.
FORMAL LAB REPORT – Introduction
The Introduction states the purpose of the study and introduces the reader with new ideas and topics. It also provides any background necessary to acquaint the read.
HTM301 – Food Science & Production Final Project Guidelines .docx
HTM301 – Food Science & Production Final Project Guidelines
Page 1 of 5 Last Revised: 10/31/2019 1:49 PM
FINAL PROJECT GUIDELINES
(20% of Semester Grade)
Completed Report Due 12/17/19, Uploaded to iLearn by 500pm
Assignment Purpose:
The final project is your opportunity to demonstrate that you can apply the principles of food science taught
over the course of the semester to successfully modify a recipe to achieve new plan and execute a formal
experiment based on the scientific method. So essentially, you’ll practice two things that will help you later
in life: 1) applying the food science principles and knowledge taught in this course, and 2) practice applying
the scientific method so you can experience how a good experiment should be run (so you can critically
evaluate whether experiments that you encounter are sound, and so you can create future experiments to
test your own theories in the future). Your final project, has seven (7) components:
1. Identify an area of inquiry: Choose an existing recipe, with the aim to improve that recipe in a
way of your choosing.
2. Conduct a literature review: Research the scientific principles involved with achieving the desired
improvement of your chosen recipe.
3. Form a hypothesis: Based on your research, modify the original recipe, to achieve the desired
outcome that you have chosen.
4. Conduct your experiment: Make the original recipe once. Then also execute your modified recipe.
5. Report your results: Document the process and output of your attempts to execute on the original
and modified recipes.
6. Analyze your experiment results: Evaluate whether, and explain why your modified recipe (did
not) achieve your desired outcome.
7. Discuss your learnings and advise future researchers: Discuss the weakness and flaws of your
experiment and make suggestions on how others can use your experience to help make their own
recipe changes in the future.
Project Component Guidelines and Details:
The following is more detail on each of the components of your final project. This is not a comprehensive,
yes/no list of what you are/not allowed to do for your project. These guidelines and details exist so that you
can explore what is interesting to you and still meet the learning objectives of this assignment. If after
reading this section, you still have questions, please contact Sybil.
1. Identify an area of inquiry – You have a lot of latitude here. Ask yourself what in the world of
food do you want to find out more about? What have you always been curious about?
Maybe you want to find a way to make a healthier version of your favorite recipe.
A fluffier version of your mom’s favorite cake?
A way to make a favorite treat gluten- or dairy-free?
Choose an area of food science that you are genuinely interested in, and that relates to some of the
scientific principles discussed in the course.
2. Conduct a literature review – Now it’s tim ...
viriology1) Describe and explain the structure , genomic org.docx
viriology
1) Describe and explain the structure , genomic organization , and infection cycle bacteriophages .
2) Compare and contrast ssRNA , dsRNA , and DNA phages.
3) Discuss the theories of putative virus evolution
4) Explain how viruses can evolve
5) Compare and contrast emerging and re-emerging viruses
6) Discuss 3 (re-)emerging viruses, discuss their transmission , host , epidemiology , and elaborate on the reasons for their (re-) emergence amongst other aspects
7) Explain how viruses can result in the development of cancer , and elaborate on how onco-viruses can be countered/treated
8) Discuss the purpose of virus vaccinations, , the different types of viruses , and how vaccines are developed
9) Discuss the different classes of anti-viral drugs, their use and efficacy , and how they are developed
10) Discuss the structure , function , emergency , and disease conditions of prions .
11) Describe the morphology , genomic organization , life-cycle , and pathogenesis of viruses in the family Coronaviridae , and hallmark virus from the family as a representative case
12) Describe the morphology , genomic organization , life-cycle , and pathogenesis of viruses in the family Arenaviridae ,and use a hallmark virus from the family as a representative case
13) Describe the morphology , genomic , organization , life-cycle , and pathogenesis of viruses in the family Bunyaviridae , and use a hallmark virus from the family as a representative case
14) Describe the morphology , genomic organization , life –cycle , and pathogenesis of viruses in the family Flaviviridae , and use a hallmark virus from the family as a representative cas
15) Describe the morphology , genomic organization , life –cycle , and pathogenesis of viruses in the family Filoviridae , and use a hallmark virus from the family as a representative
Name:
Date:
Instructor’s Name:
Assignment: SCIE211 Phase 5 Lab Report
Title: Identifying Environmental Hazards
Instructions: You will write a 1-page lab report using the scientific method to answer the following questions:
· Why do you see increases and decreases in the invasive species population?
· What are the implications associated with these alterations to the ecosystem as a whole?
When your lab report is complete, post it in Submitted Assignment files.
Part I: Using the lab animation, fill in the data table below to help you generate your hypothesis, outcomes, and analysis.
Years
Zebra and Quagga Mussel (density/m2)
Phytoplankton (µg/ml)
Zooplankton (µg/ml)
Cladophora Biomass (g/m2)
Foraging Fish (kilotons)
Lake Trout (kilotons)
0
3
7
10
13
15
20
Part II: Write a 1-page lab report using the following scientific method sections:
· Purpose
· State the purpose of the lab.
· Introduction
· This is an investigation of what is currently known about the question being asked. Use background information from credible references to write a short summary about concepts in the ...
Manual de prácticas de laboratorio de química orgánica
This document provides guidelines and procedures for a laboratory manual on organic chemistry for fisheries engineering students. It includes introductions to 4 laboratory practices covering physical properties of organic compounds, functional group identification, geometric isomerism, and typical organic chemistry reactions. The document establishes safety and academic norms for the laboratory work. It describes the evaluation process, which includes pre-lab, in-lab work, and report components for each practice. Detailed procedures are provided for Practice 1 on determining physical properties of organic compounds based on polarity and intermolecular forces.
Manual de prácticas de laboratorio de química orgánica
This document provides guidelines and procedures for organic chemistry laboratory practices for fisheries engineering students. It outlines 4 laboratory practices covering physical properties of organic compounds, functional group identification, geometric isomerism, and typical organic chemistry reactions. The document establishes safety and academic norms for the laboratory sessions and provides an evaluation scheme for student assessments.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docx
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docx
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
More Related Content
Similar to Final Applied Lab Project-BIOL 103The Effect of low pH on Enzyme A.docx
Assignment classifying reactions report
This document provides instructions for a Year 9 science assignment on classifying chemical reactions. Students must choose a chemical reaction from a list, conduct the reaction experiment, and write a scientific report identifying the products and classifying the reaction type. The report should include an aim, hypothesis, method, results, discussion identifying the reaction type based on evidence from tests, conclusion, and bibliography. Students have access to computers on April 2nd and 3rd to work on their assignment, which is due on April 4th and will be graded based on several criteria.
Written assignment 1 trace the scientific method in a primary scientific article
The document provides instructions for a written assignment asking students to analyze a primary scientific article describing a study investigating whether coffee prevents high blood sugar in diabetic mice. It describes the study where one group of mice was given water and one group was given coffee-water mixture for 5 weeks. Blood glucose was monitored weekly, finding a 30% lower level in the coffee group. Students are asked to outline the scientific method used, form a hypothesis, describe the study design and results, and critique the study limitations and relevance.
Written assignment 1 trace the scientific method in a primary scientific article
The document provides instructions for a written assignment asking students to analyze a primary scientific article describing a study investigating whether coffee prevents high blood sugar in diabetic mice. Students are asked to: 1) outline the scientific method steps used in the study and describe the experimental design; 2) critique the study methodology; 3) discuss the relevance of the research; and 4) submit their response of 300-400 words following APA style guidelines. The study described gave one group of mice water and another group diluted coffee for five weeks, monitoring blood glucose levels weekly. Results showed the coffee group had 30% lower blood glucose than the water group, indicating coffee may reduce diabetes risk.
Written assignment 1 trace the scientific method in a primary scientific article
The document provides instructions for a written assignment asking students to analyze a primary scientific article describing a study investigating whether coffee prevents high blood sugar in diabetic mice. It describes the study where one group of mice was given water and one group was given coffee-water mixture for 5 weeks. Blood glucose was monitored weekly, finding a 30% lower level in the coffee group. Students are asked to outline the scientific method used, form a hypothesis, describe the study design and results, and critique the study limitations and relevance.
PurposeStudents will conduct one brief research exercise that w.docx
Purpose:
Students will conduct one brief research exercise that will be written up as a research report using APA style. Please note: It needs to be written in paper format, not answers to questions. This paper will give the student practical experience in defining explanatory/independent and response/dependent variables, selecting the appropriate statistical technique, conducting data analysis, and writing up research results in APA format. One important note: This assignment will NOT include collecting data from people or animals. Use the data provided by the instructor in the attached spreadsheet. The data was collected from selected foods in a US commissary in Germany.
Content of the Paper:
Following APA guidelines for laboratory reports, your paper must contain the following:
1. Title Page
2. Abstract
3. Introduction – one to two paragraph introduction based on information from one source provided by the instructor. Must include the research question, statement of the research hypothesis, and identification of the explanatory/independent and response/dependent variables.
4. Method – including procedures and information collected.
5. Results – this section describes the statistical analysis used and presents the results in text, statistical, and graphic formats
6. Discussion – including the strengths and limitations of the design and ethical concerns, if any.
7. References
Content of the Paper:
Your paper must contain the following:
Title Page
1. Abstract – Brief (200 words) summary of the study. This should describe:
a. The problem under investigation, in one sentence, if possible
b. The participants (in this case, it would describe the Soups)
c. Essential features of the study method
d. The basic findings
e. Conclusions and implications or applications
2. Introduction – one to two paragraph introduction. Read the "Limit Fat and Sugar" article available at: http://www.nhlbi.nih.gov/health/educational/wecan/eat-right/limit-fat-sugar.htm. Based on this information contained in this article, develop a research question and hypotheses regarding the data collected from the commissary. Be sure to answer all ofthe following questions:
· What is the research question? Specifically, what is the researcher interested in determining from this study? Please be sure to use the information from the article in your report as background information to justify the research question.
· What are the hypotheses being tested? Describe both the null and alternative hypothesis for each of the four nutrients.
· What are the explanatory/independent and response/dependent variables?
3. Method – brief description including procedures and information collected.
· Are the samples independent or dependent? Please explain.
· How was the data collected? (ex. How was the data obtained for the samples?) Note: the data was collected from nutrition fact labels from selected Soups. For more information on Nutritional Food Fact labels, please go to: http://ww ...
Overview of lab 2016.pdf
The document provides information about a laboratory course including:
- Five two-week labs must be completed involving experiments using instrumentation like GC, HPLC, ICP, UV-Vis spectroscopy, and LC-MS.
- Lab reports are due the week following each experiment and constitute 50% of the course grade.
- Experiments involve separation and analysis of compounds using the various instruments and following proper laboratory technique.
how does pH impact the function of peroxidase doc 19.docx
Peroxidase is an enzyme that breaks down hydrogen peroxide. The pH level impacts peroxidase function by affecting its structure and catalytic activity in several ways. Optimal peroxidase activity occurs within a specific pH range, typically acidic to neutral, depending on the source. Changes in pH alter the enzyme's structure and the ionization of amino acids in its active site, disrupting substrate binding and catalytic activity. Deviating from the optimal pH reduces the reaction rate and can fully inactivate the enzyme.
The Do's & Don'ts of Lab Reports (McGill SUS Peer Tutoring)
This document provides guidance on writing an effective lab report, outlining the key sections and what they should contain. It discusses the purpose of each section, including the abstract, introduction, materials and methods, results, discussion, references, and supplemental information. For each section, it provides tips on what to include and examples of both good and bad content. The overall document aims to teach students how to properly structure and communicate the key aspects of a science experiment through a formal written lab report.
C125C126 FORMAL LAB REPORTFORMAL LAB REPORT, GeneralA f.docx
C125/C126 FORMAL LAB REPORT
FORMAL LAB REPORT, General
A formal lab report is required in conjunction with some of the experiments in each chemistry course. It is your chance to demonstrate to your professor or TA how well you understand the experiment and the chemical principles involved. A formal report is different than a term paper. It should be written in a scientific style, which is not the same style used for English or philosophy papers.
The keys to effective technical writing are organization, brevity, clarity, and an appreciation of the needs of the reader. You must write clearly and be thorough, but concise. Do not ramble. The best way to avoid rambling is to first prepare an outline of the report and stick to it. Always use complete sentences. Bulleted lists are okay in a lab notebook but are unacceptable in a formal report. Formal reports must be typed. Use 1.5 line spacing, 1-inch margins, 12 pt font and 8.5x11 inch paper. Only use third person, past tense. Also, proofread well.
The general structure of a formal lab report follows that of a scientific paper. It is:
Title and Author (s)
Introduction
Experimental Information
Data and Calculation
Results and Discussion
Conclusion
References
Results and discussion sections are combined into one single section. Different instructors may have specific formats that they want you to follow. You should always defer to the instructions given to you by your course. Presented here are general guidelines for writing formal lab reports and scientific papers.
Before writing your first report, visit the library and examine several journal articles. Pay close attention to the style of the prose and the contents of each particular section. Several common journals to investigate are:
The Journal of the American Chemical Society
The Journal of Physical Chemistry
Analytical Chemistry
Biochemistry
Initialed and dated laboratory notebook pages of the experiment must be submitted. While report sheets may be a joint effort, formal reports must be individually written. A schedule of reports and dates on which they are due is given in the course laboratory schedule. We highly recommend that reports be completed prior to the day of submission to allow time to proofread, and thus avoiding loss of points due to last minute problems. Lost data or the inability to print reports is not acceptable excuses for incomplete or missing reports. You will be informed when notebook pages will be collected before the report is due.
FORMAL LAB REPORT - Title and Author(s)
State the title of the experiment, your name, the date and your laboratory section number, if applicable. Also state the name of your lab partner(s). This information should be at the top of the first page.
FORMAL LAB REPORT – Introduction
The Introduction states the purpose of the study and introduces the reader with new ideas and topics. It also provides any background necessary to acquaint the read.
HTM301 – Food Science & Production Final Project Guidelines .docx
HTM301 – Food Science & Production Final Project Guidelines
Page 1 of 5 Last Revised: 10/31/2019 1:49 PM
FINAL PROJECT GUIDELINES
(20% of Semester Grade)
Completed Report Due 12/17/19, Uploaded to iLearn by 500pm
Assignment Purpose:
The final project is your opportunity to demonstrate that you can apply the principles of food science taught
over the course of the semester to successfully modify a recipe to achieve new plan and execute a formal
experiment based on the scientific method. So essentially, you’ll practice two things that will help you later
in life: 1) applying the food science principles and knowledge taught in this course, and 2) practice applying
the scientific method so you can experience how a good experiment should be run (so you can critically
evaluate whether experiments that you encounter are sound, and so you can create future experiments to
test your own theories in the future). Your final project, has seven (7) components:
1. Identify an area of inquiry: Choose an existing recipe, with the aim to improve that recipe in a
way of your choosing.
2. Conduct a literature review: Research the scientific principles involved with achieving the desired
improvement of your chosen recipe.
3. Form a hypothesis: Based on your research, modify the original recipe, to achieve the desired
outcome that you have chosen.
4. Conduct your experiment: Make the original recipe once. Then also execute your modified recipe.
5. Report your results: Document the process and output of your attempts to execute on the original
and modified recipes.
6. Analyze your experiment results: Evaluate whether, and explain why your modified recipe (did
not) achieve your desired outcome.
7. Discuss your learnings and advise future researchers: Discuss the weakness and flaws of your
experiment and make suggestions on how others can use your experience to help make their own
recipe changes in the future.
Project Component Guidelines and Details:
The following is more detail on each of the components of your final project. This is not a comprehensive,
yes/no list of what you are/not allowed to do for your project. These guidelines and details exist so that you
can explore what is interesting to you and still meet the learning objectives of this assignment. If after
reading this section, you still have questions, please contact Sybil.
1. Identify an area of inquiry – You have a lot of latitude here. Ask yourself what in the world of
food do you want to find out more about? What have you always been curious about?
Maybe you want to find a way to make a healthier version of your favorite recipe.
A fluffier version of your mom’s favorite cake?
A way to make a favorite treat gluten- or dairy-free?
Choose an area of food science that you are genuinely interested in, and that relates to some of the
scientific principles discussed in the course.
2. Conduct a literature review – Now it’s tim ...
viriology1) Describe and explain the structure , genomic org.docx
viriology
1) Describe and explain the structure , genomic organization , and infection cycle bacteriophages .
2) Compare and contrast ssRNA , dsRNA , and DNA phages.
3) Discuss the theories of putative virus evolution
4) Explain how viruses can evolve
5) Compare and contrast emerging and re-emerging viruses
6) Discuss 3 (re-)emerging viruses, discuss their transmission , host , epidemiology , and elaborate on the reasons for their (re-) emergence amongst other aspects
7) Explain how viruses can result in the development of cancer , and elaborate on how onco-viruses can be countered/treated
8) Discuss the purpose of virus vaccinations, , the different types of viruses , and how vaccines are developed
9) Discuss the different classes of anti-viral drugs, their use and efficacy , and how they are developed
10) Discuss the structure , function , emergency , and disease conditions of prions .
11) Describe the morphology , genomic organization , life-cycle , and pathogenesis of viruses in the family Coronaviridae , and hallmark virus from the family as a representative case
12) Describe the morphology , genomic organization , life-cycle , and pathogenesis of viruses in the family Arenaviridae ,and use a hallmark virus from the family as a representative case
13) Describe the morphology , genomic , organization , life-cycle , and pathogenesis of viruses in the family Bunyaviridae , and use a hallmark virus from the family as a representative case
14) Describe the morphology , genomic organization , life –cycle , and pathogenesis of viruses in the family Flaviviridae , and use a hallmark virus from the family as a representative cas
15) Describe the morphology , genomic organization , life –cycle , and pathogenesis of viruses in the family Filoviridae , and use a hallmark virus from the family as a representative
Name:
Date:
Instructor’s Name:
Assignment: SCIE211 Phase 5 Lab Report
Title: Identifying Environmental Hazards
Instructions: You will write a 1-page lab report using the scientific method to answer the following questions:
· Why do you see increases and decreases in the invasive species population?
· What are the implications associated with these alterations to the ecosystem as a whole?
When your lab report is complete, post it in Submitted Assignment files.
Part I: Using the lab animation, fill in the data table below to help you generate your hypothesis, outcomes, and analysis.
Years
Zebra and Quagga Mussel (density/m2)
Phytoplankton (µg/ml)
Zooplankton (µg/ml)
Cladophora Biomass (g/m2)
Foraging Fish (kilotons)
Lake Trout (kilotons)
0
3
7
10
13
15
20
Part II: Write a 1-page lab report using the following scientific method sections:
· Purpose
· State the purpose of the lab.
· Introduction
· This is an investigation of what is currently known about the question being asked. Use background information from credible references to write a short summary about concepts in the ...
Manual de prácticas de laboratorio de química orgánica
This document provides guidelines and procedures for a laboratory manual on organic chemistry for fisheries engineering students. It includes introductions to 4 laboratory practices covering physical properties of organic compounds, functional group identification, geometric isomerism, and typical organic chemistry reactions. The document establishes safety and academic norms for the laboratory work. It describes the evaluation process, which includes pre-lab, in-lab work, and report components for each practice. Detailed procedures are provided for Practice 1 on determining physical properties of organic compounds based on polarity and intermolecular forces.
Manual de prácticas de laboratorio de química orgánica
This document provides guidelines and procedures for organic chemistry laboratory practices for fisheries engineering students. It outlines 4 laboratory practices covering physical properties of organic compounds, functional group identification, geometric isomerism, and typical organic chemistry reactions. The document establishes safety and academic norms for the laboratory sessions and provides an evaluation scheme for student assessments.
Similar to Final Applied Lab Project-BIOL 103The Effect of low pH on Enzyme A.docx (13)
Written assignment 1 trace the scientific method in a primary scientific article
Written assignment 1 trace the scientific method in a primary scientific article
Written assignment 1 trace the scientific method in a primary scientific article
Written assignment 1 trace the scientific method in a primary scientific article
Written assignment 1 trace the scientific method in a primary scientific article
Written assignment 1 trace the scientific method in a primary scientific article
PurposeStudents will conduct one brief research exercise that w.docx
PurposeStudents will conduct one brief research exercise that w.docx
how does pH impact the function of peroxidase doc 19.docx
how does pH impact the function of peroxidase doc 19.docx
The Do's & Don'ts of Lab Reports (McGill SUS Peer Tutoring)
The Do's & Don'ts of Lab Reports (McGill SUS Peer Tutoring)
C125C126 FORMAL LAB REPORTFORMAL LAB REPORT, GeneralA f.docx
C125C126 FORMAL LAB REPORTFORMAL LAB REPORT, GeneralA f.docx
HTM301 – Food Science & Production Final Project Guidelines .docx
HTM301 – Food Science & Production Final Project Guidelines .docx
viriology1) Describe and explain the structure , genomic org.docx
viriology1) Describe and explain the structure , genomic org.docx
Manual de prácticas de laboratorio de química orgánica
Manual de prácticas de laboratorio de química orgánica
Manual de prácticas de laboratorio de química orgánica
Manual de prácticas de laboratorio de química orgánica
More from mydrynan
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docx
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docx
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
Cryptography
Lesson 10
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
© (ISC)2 ® 2010, All Rights Reserved
For Personal Use of (ISC)2 Seminar Attendee Only
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
CISSP-ISSEP® Bootcamp Seminar v10
Technical Management
Public Key Infrastructure
Chapter 7
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
2
Key Management
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
3
2
Usage Control
5
6
7
Storage
Recovery
Escrow
8
Zeroization
1
3
Creation
Change and Expiry
4
Distribution
Creation
Automated key generation
Truly random
Suitable length
Key encrypting keys
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
4
Key Usage Control
Management has a vested interest in what activities or content may be hidden in cryptographically protected communications or files
They may create a policy that allows management to audit or decrypt encrypted data at their discretion
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
5
Key Change and Expiry
In any environment, plans should be made to update keys periodically
Generating symmetric keys is easy, but delivering them is expensive since you will be delivering [N*(N-1)]/2 keys to N users
Expiry
Expiry ensures that a key is never overused
Expiry based upon:
Amount of traffic
Amount of traffic over time
Time-in-use
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
6
Distribution
Out of band
Public key encryption
Secret key construction
Secret key delivery
Key Distribution Centers (KDC)
Certificates
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
7
Storage
Trusted hardware
Smartcards
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
8
Recovery
Split knowledge
Multi-party key recovery (MPR)
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise.
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCI 352 - Digital Forensics
Assignment #1
Spring 2020
Due Date: Tuesday, February 25, 2020
Total Points: 100
You are going to write a Python program that represents a command line version of a hexadecimal editor.
This program will be similar to the Linux built-in command line hexadecimal editors such as xxd and
hexdump.
The program will first ask the user to enter the name of any file you want to read. Your program will then
print the binary contents of the file into the standard output (screen). The output will be divided into three
main sections: the offset values in decimal, sixteen space-separated hexadecimal bytes, followed by the
same sixteen bytes but in ASCII value. The figure below shows an example of the first 48 bytes of an
output, and the three different sections:
Notice that in the 2nd section there a space between the 8th and 9th byte. Each output line represents 16 bytes.
The first column shows the decimal offset, where the first byte from the first line represents the 0th byte;
the second line starts with byte 16th and so on. The final section only shows the printable ASCII characters.
These are the ASCII characters can be printed on the screen (usually they are the characters with ASCII
values between 0x20 and 0x7EThe rest of the unprintable bytes are replaced by a period ('.'). The following
built-in Python functions will be useful in this situation: chr, hex, ord. More information about these
functions can be found here: https://docs.python.org/3/library/functions.html
What to hand in
Submit your program electronically through D2L. Please hand in the Python program (.py file or.ipynb)
offset
Hexadecimal Values
ASCII Values
https://docs.python.org/3/library/functions.html
© 2016 by Pearson Education, Inc.
*
THINK CRITICALLY, FACIONE & GITTENS
Chapter 12
Comparative Reasoning
© 2016 by Pearson Education, Inc.
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Learning OutcomesExplain comparative reasoning and how it impacts our understanding of novel situationsApply correctly the five criteria for the evaluation of comparative reasoningDescribe the uses, benefits, and risks of comparative reasoning
Learning OutcomesChapter first explains comparative reasoning and how it impacts our understanding of novel situations.It then applies correctly the five criteria for the evaluation of comparative reasoning.The chapter finally describes the uses, benefits, and risks of comparative reasoning.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Chapter Opening Video
Chapter Opening VideoThe video talks about comparative reasoning.It shows the importance of identifying and evaluating the comparative reasoning and the analogies.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
This is Like That—Recognizing Comparative ReasoningOur minds crave patternsComparative, ideological, and emp.
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docx
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docx
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
More from mydrynan (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSCI 714 Software Project Planning and EstimationLec.docx
CSCI 714 Software Project Planning and EstimationLec.docx
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSC-321 Final Writing Assignment In this assignment, you .docx
CSC-321 Final Writing Assignment In this assignment, you .docx
Cryptography is the application of algorithms to ensure the confiden.docx
Cryptography is the application of algorithms to ensure the confiden.docx
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
Recently uploaded
Temple of Asclepius in Thrace. Excavation results
The temple and the sanctuary around were dedicated to Asklepios Zmidrenus. This name has been known since 1875 when an inscription dedicated to him was discovered in Rome. The inscription is dated in 227 AD and was left by soldiers originating from the city of Philippopolis (modern Plovdiv).
Walmart Business+ and Spark Good for Nonprofits.pdf
"Learn about all the ways Walmart supports nonprofit organizations.
You will hear from Liz Willett, the Head of Nonprofits, and hear about what Walmart is doing to help nonprofits, including Walmart Business and Spark Good. Walmart Business+ is a new offer for nonprofits that offers discounts and also streamlines nonprofits order and expense tracking, saving time and money.
The webinar may also give some examples on how nonprofits can best leverage Walmart Business+.
The event will cover the following::
Walmart Business + (https://business.walmart.com/plus) is a new shopping experience for nonprofits, schools, and local business customers that connects an exclusive online shopping experience to stores. Benefits include free delivery and shipping, a 'Spend Analytics” feature, special discounts, deals and tax-exempt shopping.
Special TechSoup offer for a free 180 days membership, and up to $150 in discounts on eligible orders.
Spark Good (walmart.com/sparkgood) is a charitable platform that enables nonprofits to receive donations directly from customers and associates.
Answers about how you can do more with Walmart!"
Wound healing PPT
This document provides an overview of wound healing, its functions, stages, mechanisms, factors affecting it, and complications.
A wound is a break in the integrity of the skin or tissues, which may be associated with disruption of the structure and function.
Healing is the body’s response to injury in an attempt to restore normal structure and functions.
Healing can occur in two ways: Regeneration and Repair
There are 4 phases of wound healing: hemostasis, inflammation, proliferation, and remodeling. This document also describes the mechanism of wound healing. Factors that affect healing include infection, uncontrolled diabetes, poor nutrition, age, anemia, the presence of foreign bodies, etc.
Complications of wound healing like infection, hyperpigmentation of scar, contractures, and keloid formation.
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...Nguyen Thanh Tu Collection
https://app.box.com/s/tacvl9ekroe9hqupdnjruiypvm9rdaneBenner "Expanding Pathways to Publishing Careers"
This presentation was provided by Rebecca Benner, Ph.D., of the American Society of Anesthesiologists, for the second session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session Two: 'Expanding Pathways to Publishing Careers,' was held June 13, 2024.
HYPERTENSION - SLIDE SHARE PRESENTATION.
IT WILL BE HELPFULL FOR THE NUSING STUDENTS
IT FOCUSED ON MEDICAL MANAGEMENT AND NURSING MANAGEMENT.
HIGHLIGHTS ON HEALTH EDUCATION.
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh
The History of Stoke Newington Street Names
Presented at the Stoke Newington Literary Festival on 9th June 2024
www.StokeNewingtonHistory.com
Jemison, MacLaughlin, and Majumder "Broadening Pathways for Editors and Authors"
Jemison, MacLaughlin, and Majumder "Broadening Pathways for Editors and Authors"National Information Standards Organization (NISO)
This presentation was provided by Racquel Jemison, Ph.D., Christina MacLaughlin, Ph.D., and Paulomi Majumder. Ph.D., all of the American Chemical Society, for the second session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session Two: 'Expanding Pathways to Publishing Careers,' was held June 13, 2024.LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UP
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
How to Setup Warehouse & Location in Odoo 17 Inventory
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
Lifelines of National Economy chapter for Class 10 STUDY MATERIAL PDF
The chapter Lifelines of National Economy in Class 10 Geography focuses on the various modes of transportation and communication that play a vital role in the economic development of a country. These lifelines are crucial for the movement of goods, services, and people, thereby connecting different regions and promoting economic activities.
Recently uploaded (20)
Walmart Business+ and Spark Good for Nonprofits.pdf
Walmart Business+ and Spark Good for Nonprofits.pdf
REASIGNACION 2024 UGEL CHUPACA 2024 UGEL CHUPACA.pdf
REASIGNACION 2024 UGEL CHUPACA 2024 UGEL CHUPACA.pdf
spot a liar (Haiqa 146).pptx Technical writhing and presentation skills
spot a liar (Haiqa 146).pptx Technical writhing and presentation skills
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
Jemison, MacLaughlin, and Majumder "Broadening Pathways for Editors and Authors"
Jemison, MacLaughlin, and Majumder "Broadening Pathways for Editors and Authors"
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UP
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UP
How to Setup Warehouse & Location in Odoo 17 Inventory
How to Setup Warehouse & Location in Odoo 17 Inventory
SWOT analysis in the project Keeping the Memory @live.pptx
SWOT analysis in the project Keeping the Memory @live.pptx
Lifelines of National Economy chapter for Class 10 STUDY MATERIAL PDF
Lifelines of National Economy chapter for Class 10 STUDY MATERIAL PDF
Final Applied Lab Project-BIOL 103The Effect of low pH on Enzyme A.docx
- 1. Final Applied Lab Project-BIOL 103The Effect of low pH on Enzyme Activity Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. Recall: enzymes are proteins! To complete this project, it may be useful for you to first review the Scientific Method Tutorial, the OLI module about pH and enzymes, Lab 1 (Introduction to Science) and Lab 4 (Enzymes). As you review Lab 4, you will be reminded that there are several factors that impact enzymatic activity: pH, temperature, and amount of reagent. It is OK to use the same enzyme/substrate/method as you did in lab 4 (but modify the treatment), but you are encouraged to search on-line to find a different enzyme/substrate/method for measuring enzyme activity for your project (include all references). As you design your experiment for this project, please remember that you are trying to examine how an acidic fluid will modify the outcome of an enzymatic reaction. To successfully complete this project, you will need to identify the question(s) being asked in your experiment and the hypothesis that you are testing. In your experimental design, you must clearly explain what you are doing. That means that you will need to identify the enzyme, the substrate, the acidic fluid used as treatment, the control treatment and the method of measuring enzyme activity, as well as explain your experimental protocol. You must also thoroughly explain how the acidic fluid impacted enzyme activity based on the results from your own experiment as well as knowledge of enzymes and pH from the OLI modules, lab manual and potentially additional information sources. Submit Files - Final Applied Lab Project Top of Form
- 2. Folder Final Applied Lab Project Instructions Final Applied Lab Project Addresses course outcomes 1-4: · recognize and explain how the scientific method is used to solve problems · make observations and discriminate between scientific and pseudoscientific explanations · weigh evidence and make decisions based on strengths and limitations of scientific knowledge and the scientific method · use knowledge of biological principles, the scientific method, and appropriate technologies to ask relevant questions, develop hypotheses, design and conduct experiments, interpret results, and draw conclusions This is the culminating lab assessment in BIOL 103. It is designed to assess your ability to apply the principles of the scientific method. The Effect of low pH on Enzyme Activity Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. Recall: enzymes are proteins! To complete this project, it may be useful for you to first review the Scientific Method Tutorial, the OLI module about pH and enzymes, Lab 1 (Introduction to Science) and Lab 4 (Enzymes). As you review Lab 4, you will be reminded that
- 3. there are several factors that impact enzymatic activity: pH, temperature, and amount of reagent. It is OK to use the same enzyme/substrate/method as you did in lab 4 (but modify the treatment), but you are encouraged to search on-line to find a different enzyme/substrate/method for measuring enzyme activity for your project (include all references). As you design your experiment for this project, please remember that you are trying to examine how an acidic fluid will modify the outcome of an enzymatic reaction. To successfully complete this project, you will need to identify the question(s) being asked in your experiment and the hypothesis that you are testing. In your experimental design, you must clearly explain what you are doing. That means that you will need to identify the enzyme, the substrate, the acidic fluid used as treatment, the control treatment and the method of measuring enzyme activity, as well as explain your experimental protocol. You must also thoroughly explain how the acidic fluid impacted enzyme activity based on the results from your own experiment as well as knowledge of enzymes and pH from the OLI modules, lab manual and potentially additional information sources. Hint: Keep in mind that the acid will change the environmental conditions of the experiment (for example, a low pH value could change the shape of the active site on the enzyme protein), without directly participating in the reaction. Lab Materials You may need all or some of the following, depending on your experimental design: Materials from your lab kit: · pH paper · hydrogen peroxide solution (you can purchase this at a pharmacy if you have used up the bottle that came with the lab kit)
- 4. · plastic beakers or cups · vinegar · yeast (can be purchased at grocery store if more is needed) · balloons · plastic bottle · marker for labeling of beakers You may choose to use additional materials (different acidic fluids and/or different organisms and/or different substrate if you chose an enzyme other than catalase). Outline (10 points) submit in assignment folder in week 7. · Name of enzyme you will use: Yeast · Name of organism (if applicable): N/A · The substrate: Hydrogen peroxide · Method for measuring enzyme activity: Circumference of balloons · Treatment: acidic fluid(s), pH, length of exposure, how you will treat your samples: length of exposure will be 1min, 3min, 5min · The control(s) in the experiment: 3 Tubes filled with 10ml of catalase, 10ml of hydrogen peroxide and no acetic acid · Sample size: 3 tubes with 10ml of catalase, 10ml of hydrogen peroxide and each one with 1ml, 3ml, 5ml of acetic acid
- 5. · Hypothesis: When acetic fluids are added to enzyme-substrate mixtures, enzyme activity is affected. · How you will present your data (table and/or type of graph): Table Write a lab report that includes the following: 1. Title page: descriptive title, your name, course name, semester 2. Introduction: general background information about enzymes and specific information about your chosen enzyme, the question(s) that you are asking and a clear hypothesis for your experiment (15 points). 3. Design an experiment. Provide a detailed description of the materials and methods used to conduct the experiment. Identify control and experimental samples, as well as independent and dependent variables. Also include the methods used for data collection and analysis (20 points). 4. Conduct the experiment and record your results. What did you observe? Present your data in table and/or graph format. Remember to label everything and include the unit of measure with all numbers (20 points) 5. Use your knowledge of enzymes and pH to interpret and discuss your results. It may be necessary for you to refer to the OLI course modules, lab manual and/or use additional information resources. What effect does the acidic treatment have on enzyme activity? Did you get the expected results? Explain. (15 points) 6. State a specific and accurate conclusion. Is your hypothesis supported by the results? Looking back, how could you have improved your experiment? (10 points)
- 6. 7. Include a list of references to all information sources used in APA format (5 points). Avoid Plagiarism It is very important to write with your own words. If you do copy one or two sentences directly (use sparingly), use quotation marks (") around the copied text, followed by an in- text reference. All information sources need to be included in the reference list and as in-text references. Plagiarism will be reported to the proper UMUC authority. Guidance on how to avoid plagiarism can be found here: Submission Submit your final applied lab project to both the TurnItIn website as well as in the assignment folder by the due date specified in the course schedule. Grading Your Final Applied Lab Project will be graded based on the following criteria (100 points total): Rubric Name: Final Applied Laboratory Project Criteria Excellent (90-100%) 100 points Good (75-89%) 89 points Adequate (50-74%) 74 points Unacceptable (0-49%) 49 points Outline 10 points (Due in week 7) Outline includes all the required components and planned experiment meets requirements for the assignment and is clearly
- 7. and accurately described. Submitted on time. 9-10 points Outline missing one or two of the required components, and/or planned experiment does not meet one of requirements for the assignment and/or minor issues with clarity and accuracy. 7-8 points Outline missing several of the required components, and/or planned experiment does not meet several of the requirements for the assignment and/or major issues with clarity and accuracy. 5-6 points Outline missing most of the required components andplanned experiment does not meet the requirements of the assignment. 0-4 points Introduction, Question and Hypothesis (15 points) Background information about enzymes in general and about specific enzyme used in project is clearly and accurately written. Questions and hypothesis are specific, relevant and clearly stated. 14-15 points Background information about enzymes in general and about specific enzyme is somewhat unclear and/or inaccurate. Questions and hypothesis could be more specific, relevant and clearly stated. 11-13 points
- 8. Missing background information about enzymes in general or about specific enzyme used in project or questions and hypothesis. 7-12 point Missing background information about enzymes in general and about specific enzyme used in project andquestions/hypothesis. 0-6 points Experimental Design, Materials and Methods (20 points) Experiment is designed to directly test the hypothesis; description of experiment is detailed and well written and includes all materials and methods used. 18-20 points Experiment is mostly designed to test the hypothesis and/or description of experiment is somewhat inaccurate and/or some information about materials and methods used is missing and/or minor problems with clarity an organization. 15-17 points Experiment is barely designed to test the hypothesis and/or description of experiment is inaccurate and/or most of the materials and methods used are missing and/or major problems with clarity an organization. 10-14 points Experiment is not designed to test hypothesis and/or description of experiment and materials and methods used are missing. 0-9 points Results (20 points)
- 9. Results are clearly and accurately presented in a table and/or graph format. 18-20 points Results are presented, but minor problems with clarity and/or accuracy. 15-17 points Results are described, but major problems with clarity and/or accuracy and/or results not presented in table or graph. 10-14 points Results are not included 0-9 points Discussion of Results (15 points) A clear, accurate and well organized discussion of results that demonstrates good knowledge of enzymes. 14-15 points Minor problems with clarity, accuracy or organization and/or demonstrates some gaps in knowledge of enzymes. 15-17 points Major problems with clarity, accuracy or organization or demonstrates minimal knowledge of enzymes. 10-14 points Missing discussion of results, or major problems with clarity, accuracy or organization andmissing understanding of enzymes.
- 10. 0-9 points Conclusion ( 10 points ) A well stated conclusion that is accurate and specific and directly related to the data collected. Clearly stated whether or not the results support the hypothesis. Relevant suggestion for improvement of experiment. 9-10 points Conclusion stated, but slightly inaccurate, and/or not directly related to data collected and/or suggestion for improvement of experiment not very relevant. 7-8 points Conclusion stated, but inaccurate and/or barely related to data collected and/or missing suggestion for improvement of experiment. 5-6 points Missing conclusion, only suggestion for improvement of experiment. 0-4 points Citations (5 points) All references used are included and in correct APA format, in- text references are included. 5 points All references are included, but a few minor mistakes in APA format, and/or missing in-text references. 4 points
- 11. Missing one or several references and/or major mistakes in APA format. 3 point No references included or references not in APA format. 0-2 points Grammar and Spelling (5 points) Less than 3 minor spelling and grammatical errors 5 points Between 4 and 7 minor spelling and grammatical errors 4 points Between 8 and 12 spelling and grammatical errors 3 point More than 13 spelling and grammatical errors 0-2 points Overall Score Level 4 90 or more Level 3 75 or more Level 2 50 or more
- 12. Level 1 0 or more Bottom of Form Final Project Outline The Effect of low pH on Enzyme Activity in Raw Meat Purpose: To recognize the impact of acid on based on the activity of enzymes Hypothesis: When acetic fluids are added to enzyme- substrate mixtures, enzyme activity is affected. Experiment: Observation of the yeast and temperature regulated hydrogen peroxide in the presence of food. Materials: · Name of enzyme you will use: Yeast · Name of organism (if applicable): Liver, carrot · The substrate: Hydrogen peroxide · Method for measuring enzyme activity: Circumference of balloons · Treatment: acidic fluid(s), pH, length of exposure, how you will treat your samples: length of exposure will be 1 min, 3 min, 5 min · The control(s) in the experiment: 3 Tubes filled with 10ml of catalase, 10ml of hydrogen peroxide and no acetic acid · Sample size: 3 tubes with 10ml of catalase, 10ml of hydrogen peroxide and each one with 1ml, 3ml, 5ml of acetic acid · Hypothesis: When acetic fluids are added to enzyme-substrate
- 13. mixtures, enzyme activity is affected. · How you will present your data (table and/or type of graph): Table Procedure: 1. Cut 1 cm of meet and add to 200 ml cylinder 2. Add yeast into the same 200 ml cylinder 3. Add Hydrogen peroxide into the testing tube. 4. Cylinder and testing tube is kept in water both temperatures 80 degrees F. 5. Pour hot Hydrogen Peroxide in the cylinder that contains meat and yeast. 6. Volume of both cylinder and testing tube will be measured, before and after combining all items. 7. After 3 minutes the volume is measured again and recorded 8. Initial volume will be subtracted from final volume, to obtain the actual amount of foam. 9. Repeat by replace the acidic food with the alkaline one. 10. The data obtained will be used to create the table. Data and Analysis: observing the altered pH condition and the level of oxygen that is generated will collect Data Conclusion: the results of my exeriment References: Any references used (i.e.: internet, books, documentation)