FAI-lT .1 Financing the Global Firm
Cost of Capital ('/d
30
28
26
24
20
1B
16
14
12
10
B
6
4
2
The Cost of Capital and Financial Structure
ke = cost of equity
k'vncc = weighted
average after-tax
cost of capital
ka r x) = after-iax
cost of debt
Total Debt (D)
Debt Ratio (o/"\ =
-
Total Assets (V)
Partly offsetting the favorable effect of more debt is an increase in the cost of equity (k"),
because investors perceive greater financial risk. Nevertheless, the overall lveighted average
after-tax cost of capital (kwacc) continues to decline as the debt ratio increases, until finan-
cial risk becomes so serious that investors and management alike pierceive a real danger of
insoivency. This result causes a sharp increase in the cost of new debt and equity, thus increas-
ing the weighted average cost of capital. The lou,point on the resulting U-shaped cost of cap-
ital curve. which is at 14"/" in Exhibit 13.2. defines the debt ratio range in which the cost of
capital is minimized.
Most theorists believe that the low point is actually a rather broad flat area encompass-
ing a wide range of debt ratios, 30% to 60% In Exhibit 13.2, rvhere little difference exists in
the cost of capital. They also believe that, at least in the United States, the range of the flat
area and the location of a particular firm's debt ratio rvithin that range are determined by
such variables as 1) the industry in which it competes;2) volatility of its sales and operating
income; and 3) the collateral value of its assets.
*ptirt:;:l Finasreial Strer*t*r* and the MfdH
The domestic theory of optimal financial structures needs to be modified by four more vari-
ables in order to accommodate the case of the MNE. These variables, in order of appearance,
are 1) availability of capital; 2) diversification of cash flows; 3) foreign exchange risk; and
4) expectations of international portfoiio investors.
Availability of Capital. Chapter 12 demonstrated that access to capital in global markets allows
an MNE to lower its cost of equity and debt compared rvith most domestic firms. It also per-
mits an MNE to maintain its desired debt ratio, even when significant amounts of new funds
must be raised. In other wordq a multinational firm's marginal cost of capital is constant for
considerable ranges of its capital budget. This statement is not true for most small domestic
k").
1ge
an-
'of
ras-
ap-
.of
firms because they do not have access to the national
equity or debt markets' They must either
rely on internally generated funds or borrow for
the short and medium terms from commel-
cial banks. : r ^^-:+-r *^.lzatc are
Multinational firms domiciled in countries that have illiquid
capital markets ale rn
almost the same ,it,ruiion u, small domesri" tlt*t uniess they have
gained a global cost and
availability of capital. They must rely on l"t"t"u!V generated
funds and bank borrowing' If
they need to raise significant u*o,rrrt. of new iunO--t
to finance gr ...
This document discusses the cost of capital from an international perspective. It defines key terms like weighted average cost of capital and explains how cost of capital is determined. It also discusses how segmented versus integrated capital markets can impact a firm's cost of capital calculation. The document notes that international diversification can lower a firm's cost of capital. Cross-border stock listings are also discussed as a way for firms to potentially achieve a lower cost of capital.
The document discusses topics related to international finance and financial management for multinational firms. It covers concepts like weighted average cost of capital (WACC), capital asset pricing model (CAPM), adjusted present value (APV) analysis, and implications of foreign ownership restrictions. It also provides an example of using APV to evaluate a potential diesel engine plant investment in the UK by a US-based company.
Writing a 15 pages final paper, will be discussed in our 1st meeti.docxambersalomon88660
Writing a 15 pages final paper, will be discussed in our 1st meeting.
The final Paper and PowerPoint Presentation: Topic Analysis– 15 to 20 pages in APA format
Choose a topic in IT Project Management for your topic analysis. Email to your instructor a proposal of the topic area you intend to use for your topic analysis. Prepare a summary that identifies the major research threads in your topic. A reference list should be included in the summary. The topic should be relevant to your course material.
The professor will approve the topic of the project during the time when the class meets. E-mail the professor by week 2 with the topic for your final project. Email the professor a draft reference list by week 5. The Final Project will be a research report relevant to the selected topic. Your report will include an evolution of the chosen topic, the problems resolved or will be resolved, and future trends. The paper should have 5-7 academic references for each of these areas (published articles and/or textbook. The paper should be 15 to 20 pages in length and must be presented in the APA style, and is due during the last week of classes.
CHAPTER 14 Raising Equity and Debt Globally
Do what you will, the capital is at hazard. All that can be required of a trustee to invest, is, that he shall conduct himself faithfully and exercise a sound discretion. He is to observe how men of prudence, discretion, and intelligence manage their own affairs, not in regard to speculation, but in regard to the permanent disposition of their funds, considering the probable income, as well as the probable safety of the capital to be invested.
—Prudent Man Rule, Justice Samuel Putnam, 1830.
LEARNING OBJECTIVES
■Design a strategy to source capital equity globally
■Examine the potential differences in the optimal financial structure of the multinational firm compared to that of the domestic firm
■Describe the various financial instruments that can be used to source equity in the global equity markets
■Understand the different forms of foreign listings—depositary receipts—in U.S. markets
■Analyze the unique role private placement enjoys in raising global capital
■Evaluate the different goals and considerations relevant to a firm pursuing foreign equity listing and issuance
■Explore the different structures that can be used to source debt globally
Chapter 13 analyzed why gaining access to global capital markets should lower a firm’s cost of capital, increase its access to capital, and improve the liquidity of its shares by overcoming market segmentation. A firm pursuing this lofty goal, particularly a firm from a segmented or emerging market, must first design a financial strategy that will attract international investors. This involves choosing among alternative paths to access global capital markets.
This chapter focuses on firms that reside in less liquid, segmented, or emerging markets. They are the ones that need to tap liquid and unsegmented markets in order to attain.
This document discusses sources of financing for international firms and how financial structure varies across countries. It states that firms often turn to global capital markets for lower-cost financing than domestic markets. However, some host countries require local financing. Financial structure, meaning the debt to equity mix, varies significantly across countries, though reasons for differences are unclear. The document recommends firms adopt a structure minimizing their cost of capital regardless of local norms. Money management aims to efficiently manage global cash resources by minimizing cash balances through centralized management and reducing transaction costs through netting of intrafirm transfers.
Multinational cost and capital structureNits Kedia
The document discusses how multinational corporations determine their cost of capital and establish optimal capital structures. It explains that an MNC's cost of capital may differ from domestic firms due to their size, access to international markets, diversification across countries, and exposure to exchange rate and country risks. The cost of capital also varies by country based on interest rates, risk premiums, and tax laws. An MNC considers these corporate and country characteristics when deciding how much debt and equity to use in different subsidiaries to minimize its overall cost of capital.
The document discusses how multinational corporations determine their cost of capital and establish optimal capital structures. It explains that an MNC's cost of capital may differ from domestic firms due to their size, access to international markets, diversification across countries, and exposure to exchange rate and country risks. The cost of capital also varies by country based on interest rates, risk premiums, and tax laws. An MNC considers these corporate and country characteristics when deciding how much debt and equity to use in different subsidiaries to minimize its overall cost of capital.
Cost of capital, international financial managementAshutosh136471
User
in short
ChatGPT
Capital budgeting is about choosing the right long-term investments, while cost of capital is the expense associated with financing those investments.
This document discusses the cost of capital from an international perspective. It defines key terms like weighted average cost of capital and explains how cost of capital is determined. It also discusses how segmented versus integrated capital markets can impact a firm's cost of capital calculation. The document notes that international diversification can lower a firm's cost of capital. Cross-border stock listings are also discussed as a way for firms to potentially achieve a lower cost of capital.
The document discusses topics related to international finance and financial management for multinational firms. It covers concepts like weighted average cost of capital (WACC), capital asset pricing model (CAPM), adjusted present value (APV) analysis, and implications of foreign ownership restrictions. It also provides an example of using APV to evaluate a potential diesel engine plant investment in the UK by a US-based company.
Writing a 15 pages final paper, will be discussed in our 1st meeti.docxambersalomon88660
Writing a 15 pages final paper, will be discussed in our 1st meeting.
The final Paper and PowerPoint Presentation: Topic Analysis– 15 to 20 pages in APA format
Choose a topic in IT Project Management for your topic analysis. Email to your instructor a proposal of the topic area you intend to use for your topic analysis. Prepare a summary that identifies the major research threads in your topic. A reference list should be included in the summary. The topic should be relevant to your course material.
The professor will approve the topic of the project during the time when the class meets. E-mail the professor by week 2 with the topic for your final project. Email the professor a draft reference list by week 5. The Final Project will be a research report relevant to the selected topic. Your report will include an evolution of the chosen topic, the problems resolved or will be resolved, and future trends. The paper should have 5-7 academic references for each of these areas (published articles and/or textbook. The paper should be 15 to 20 pages in length and must be presented in the APA style, and is due during the last week of classes.
CHAPTER 14 Raising Equity and Debt Globally
Do what you will, the capital is at hazard. All that can be required of a trustee to invest, is, that he shall conduct himself faithfully and exercise a sound discretion. He is to observe how men of prudence, discretion, and intelligence manage their own affairs, not in regard to speculation, but in regard to the permanent disposition of their funds, considering the probable income, as well as the probable safety of the capital to be invested.
—Prudent Man Rule, Justice Samuel Putnam, 1830.
LEARNING OBJECTIVES
■Design a strategy to source capital equity globally
■Examine the potential differences in the optimal financial structure of the multinational firm compared to that of the domestic firm
■Describe the various financial instruments that can be used to source equity in the global equity markets
■Understand the different forms of foreign listings—depositary receipts—in U.S. markets
■Analyze the unique role private placement enjoys in raising global capital
■Evaluate the different goals and considerations relevant to a firm pursuing foreign equity listing and issuance
■Explore the different structures that can be used to source debt globally
Chapter 13 analyzed why gaining access to global capital markets should lower a firm’s cost of capital, increase its access to capital, and improve the liquidity of its shares by overcoming market segmentation. A firm pursuing this lofty goal, particularly a firm from a segmented or emerging market, must first design a financial strategy that will attract international investors. This involves choosing among alternative paths to access global capital markets.
This chapter focuses on firms that reside in less liquid, segmented, or emerging markets. They are the ones that need to tap liquid and unsegmented markets in order to attain.
This document discusses sources of financing for international firms and how financial structure varies across countries. It states that firms often turn to global capital markets for lower-cost financing than domestic markets. However, some host countries require local financing. Financial structure, meaning the debt to equity mix, varies significantly across countries, though reasons for differences are unclear. The document recommends firms adopt a structure minimizing their cost of capital regardless of local norms. Money management aims to efficiently manage global cash resources by minimizing cash balances through centralized management and reducing transaction costs through netting of intrafirm transfers.
Multinational cost and capital structureNits Kedia
The document discusses how multinational corporations determine their cost of capital and establish optimal capital structures. It explains that an MNC's cost of capital may differ from domestic firms due to their size, access to international markets, diversification across countries, and exposure to exchange rate and country risks. The cost of capital also varies by country based on interest rates, risk premiums, and tax laws. An MNC considers these corporate and country characteristics when deciding how much debt and equity to use in different subsidiaries to minimize its overall cost of capital.
The document discusses how multinational corporations determine their cost of capital and establish optimal capital structures. It explains that an MNC's cost of capital may differ from domestic firms due to their size, access to international markets, diversification across countries, and exposure to exchange rate and country risks. The cost of capital also varies by country based on interest rates, risk premiums, and tax laws. An MNC considers these corporate and country characteristics when deciding how much debt and equity to use in different subsidiaries to minimize its overall cost of capital.
Cost of capital, international financial managementAshutosh136471
User
in short
ChatGPT
Capital budgeting is about choosing the right long-term investments, while cost of capital is the expense associated with financing those investments.
-8-CARREFOUR S.A.Synopsis and Objectives.docxmercysuttle
-8-
CARREFOUR S.A.
Synopsis and Objectives
In August 2002, the French retail giant Carrefour S.A. is considering alternative currencies for raising (euros) EUR750 million in the eurobond market. Carrefour’s investment bankers provide various borrowing rates across four different currencies. Despite the high nominal coupon rate and the lack of any material business activity in the United Kingdom, the British-pound issue appears to provide the lowest cost of funds if the exchange rate risk is hedged.
The case is designed to serve as an introduction to topics in international finance. Topics of discussion include foreign-currency borrowing, interest-rate parity, currency risk exposure, derivative contracts (in particular forward and swap contracts), and currency risk management. Students are tasked with exploring (1) motives for borrowing in foreign currencies, (2) the exposure created by such financing policy, and (3) strategies for managing currency risk.
Suggested Questions for Advance Assignment to Students
1. Why should Carrefour consider borrowing in a currency other than euros?
2. Assuming the bonds are issued at par, what is the cost in euros of each of the bond alternatives?
3. Which debt issue would you recommend and why?
Hypothetical Teaching Plan
1. What is going on at Carrefour?
2. Is the Swiss-franc issue, at 3⅝%, a “no-brainer”?
3. What can a firm do to manage the exchange-rate risk of foreign-currency borrowing?
4. Using appropriate forward rates, what is the cost of borrowing in Swiss francs? British pounds? U.S. dollars? What should Carrefour do?
As reference material, broad empirical evidence of the managerial question in the case can be found in Matthew R. McBrady and Michael J. Schill, “Foreign currency denominated borrowing in the absence of operating incentives” Journal of Financial Economics 86 (October 2007): 145–177 and Matthew R. McBrady, Sandra Mortal, and Michael J. Schill, “Do firms believe in interest-rate parity?” working paper, Darden Graduate School of Business Administration, University of Virginia, Charlottesville.
Case Analysis
1.What is going on at Carrefour?
Carrefour is a massive retailer (Europe’s largest) with strong but selective expansion prospects internationally (case Exhibit 1). The company has a history of funding its capital needs through securities denominated in many different currencies (case Exhibit 3), and is sophisticated in managing currency risk. Carrefour currently has a EUR750 million capital need that the company intends to meet through the eurobond market.[footnoteRef:1] This offering represents approximately 11% of Carrefour’s bond portfolio. Carrefour’s investment bank has provided market borrowing rates in euros and three foreign currencies. [1: Bob Bruner suggests using the case to develop various facets of the eurobond market: (1) the eurobond market is an external market, outside the regulatory jurisdiction of any one country; (2) the bonds so iss ...
Learning ObjectivesUpon completion of Chapter 10, you will.docxSHIVA101531
Learning Objectives
Upon completion of Chapter 10, you will be able to:
• Understand the meaning of the weighted average cost of capital (WACC).
• Be able to estimate the weights in the WACC.
• Be able to estimate the cost of debt and how it is affected by taxes.
• Be able to estimate the cost of preferred stock.
• Know three approaches for estimating the cost of equity.
• Understand flotation costs and how they affect the WACC.
• Know when the WACC is the appropriate approach for estimating the required return for a project.
• Know an alternative approach for estimating a project’s required return when the WACC is not
the appropriate measure.
Cost of Capital
10
Nina Mourier/Getty Images
byr80656_10_c10_245-270.indd 245 3/28/13 3:35 PM
CHAPTER 10Section 10.1 Estimating the Discount Rate
Corporate managers use various capital budgeting techniques. Among these tech-niques, net present value (NPV) emerges as the best measure of a project’s con-tribution to shareholder wealth. In NPV analysis, the present value of a project’s
expected future cash flows is compared to the initial investment, and the project is accepted
if the present value exceeds the initial investment. Calculation of NPV requires the analyst
to estimate cash flows and an appropriate discount rate. Techniques for estimating cash
flows were covered in Chapter 6. In this chapter you will learn how to estimate the dis-
count rate. The same estimates of cash flows and discount rate are also used in internal
rate of return analysis. Used in IRR, the discount rate becomes a hurdle rate against which
to compare the project’s IRR.
10.1 Estimating the Discount Rate
To illustrate the calculation and use of the discount rate, we introduce a case study of Pacific Offshore Ltd. (POL). POL is considering the manufacture and sale of har-nesses to be used by sailors who must be tethered to their boats in the high seas.
The harnesses can save the lives of sailors who are washed overboard in rough water and
storms. The NPV of POL’s harness project is $9,110, which was found by discounting the
project’s net cash flows by 12.5%. The project’s internal rate of return of 17.2% is greater
than the 12.5% required rate of return on the harness project. Therefore, whether we use
NPV or IRR, the harness project appears to be acceptable because it meets the respective
decision criteria. Had the required return been 20%, for example, the project would have
been rejected using either criterion.
We have referred to the 12.5% as the harness project’s required rate of return. To be more
specific, 12.5% is the weighted average return demanded by the company’s investors. The
weightings reflect the proportional values of their investments. The cost of the harness
project is $64,384, meaning that the owners must raise that amount from their investors
to fund tools, equipment, and working capital and to pay the cost of reconfiguring the
plant. The owners decided to fund futu ...
COST of CAPITAL SLIDE Semester 2 2020-2021 part 1.pptmishJOHN1
The cost of preferred stock is the annual dividend divided by the net proceeds price. For Duchess' 10% preferred stock, the dividend is $8.70 per share and the net proceeds price is $82 per share. Therefore, the cost of preferred stock (rP) is 10.6% ($8.70/$82).
The document discusses the cost of capital and how to calculate the weighted average cost of capital (WACC) for a firm. It explains the different sources of capital including debt, preferred stock, and common equity. It also discusses how to estimate the costs of each type of capital and calculate WACC, as well as how to adjust the WACC for project-specific risks that differ from the average risk of the firm.
Funds of hedge funds failed to deliver value to investors and demonstrated dangerous redemption risks. FoHF managers ran large liquidity mismatches and did not address warnings about this risk. When hedge fund performance declined and redemptions increased in late 2008, the liquidity mismatch led to a crisis. Research on accurately modeling redemption terms and liquidity risks in FoHFs could have helped prevent this.
This document discusses considerations for multinational capital budgeting. It compares capital budgeting analyses from the perspective of a parent company versus a subsidiary and identifies factors that create differences in their cash flows, such as taxes, regulations on transferring funds, and exchange rate movements. The document also outlines inputs needed for multinational capital budgeting analyses and methods for assessing risk.
- BASF is a major international company with over 112,000 employees across 5 continents. It operates in industries like agriculture, chemicals, oil/gas, and plastics.
- In an attempt to increase value, BASF launched Vision 2020, a comprehensive strategic plan that challenged employees to act entrepreneurially. A key goal was for the company to earn its weighted average cost of capital (WACC) plus a premium each year.
- The chapter will explain how to calculate a firm's WACC, which is the minimum return needed to satisfy investors including stockholders, bondholders, and preferred stockholders. It will also discuss when the WACC should and should not be used.
1. The document discusses the concept of cost of capital, which is the weighted average cost of various sources of finance used by a firm. It is an important factor in financial decision making.
2. It provides details on different components that make up the cost of capital, including the cost of debt, cost of equity, weighted average cost of capital, and how they are calculated. It also discusses the risk free rate and equity risk premium.
3. The document considers different approaches that regulators have taken to estimate the components of cost of capital and which approaches the CAA intends to adopt in its analysis, including relying on historical averages for the risk free rate and equity risk premium.
Chapter15 International Finance ManagementPiyush Gaur
This document provides suggested answers and solutions to end-of-chapter questions from a textbook on international portfolio investment. It includes:
1) Answers to 12 multiple choice or short answer questions on topics like factors driving international investment, security return correlations across countries, world beta, and the impact of exchange rate fluctuations.
2) Solutions to 7 quantitative problems calculating returns, risks, and optimal portfolio weights for international investments considering exchange rate movements and correlations between different markets.
3) A description of input received from three consultants for a pension fund regarding the risks and rewards of international equity allocation, with two favoring it and one questioning the ability of international investing to reduce risk.
MCM will offer the lowest cost global index funds by managing labor costs. It will outsource all labor except sales to India, where costs are one-fourth of U.S. rates. MCM will track the MSCI All Country World Investable Market Index for stocks and the Barclays Global Aggregate Float Adjusted Bond Index for bonds, charging only 0.25% for each fund. This low cost structure takes advantage of trends showing investor capital increasingly flowing into low cost, global index funds due to their benefits of diversification and minimized fees. By keeping costs lower than competitors, MCM aims to maximize its assets under management.
The concept of Cost of capital for MNC is addressed in this ppt
Subscribe to Vision Academy for Video assistance https://www.youtube.com/channel/UCjzpit_cXjdnzER_165mIiw
Building and Maintaining a Private Market Portfolio: Inroduction to Private M...BrookePollack
CTC Consulting White Paper: Introduction to private market portfolio management and cash flow characteristcs of these investments for long-term private market investors.
Oil & Gas Intelligence Report: Financing Instruments in the Upstream SectorDuff & Phelps
This report includes an introduction to petroleum fiscal regimes and a classification of the main contracts, concessionary systems, sharing agreements and service agreements.
IMF is a global leader in litigation funding, with a $1.5 billion litigation portfolio and a track record of winning 78% of cases. Litigation funding provides portfolio diversification and is not correlated with economic cycles. IMF trades at a discount to its $1.96 blended valuation, offering upside potential from case wins and portfolio growth. Key value drivers are the size of the litigation portfolio, IMF's high win rate, and the duration of its cases.
FOREIGN DIRECT INVESTMENT AND BALANCE OF PAYMENTS IN LATIN AMERICA (1990-2011)pkconference
This document analyzes foreign direct investment (FDI) and its impact on the balance of payments in Latin America from 1990-2011. It discusses how FDI flows increased in Latin America in the 1990s as the region became reintegrated into the global financial system. However, some authors argue that high levels of FDI may actually constrain economic growth by putting pressure on countries' balance of payments through payments like profits, interest, and royalties sent abroad. The document aims to empirically test this theory using a panel data methodology to determine if GDP growth in Latin America was constrained by balance of payments issues related to FDI inflows.
The document provides an analysis of Land Securities Group PLC, a UK property company. It includes the following key points:
- Land Securities is the largest property company in the UK by market capitalization and is a member of the FTSE 100.
- The analysis estimates the cost of equity for Land Securities to be 6.78% based on the company's beta of 0.9 calculated from its market model, a market risk premium of 5.2%, and a risk-free rate of 2.1%.
- Using the dividend valuation model with a dividend growth rate of 2.6% and the estimated cost of equity, the document values Land Securities' share price at £0.782, which
Capital budgeting under financial system-1.pdfStarAngel16
This document discusses capital budgeting decisions for multinational corporations (MNCs). It explains that MNCs use the same framework as domestic firms but international projects face additional complexities. These include multiple currencies and tax systems, political risk, and restrictions on cash flow repatriation. The document outlines the capital budgeting process and key differences for MNCs, such as evaluating projects from both a local subsidiary and parent company perspective due to tax/exchange rate issues. It also discusses tools for incorporating risks like adjusting required rates of return or cash flows.
This study examines the value effects of hedging foreign currency and interest rate risk with derivatives for firms in Italy, Spain and Portugal from 2006-2008. The authors find an overall hedging premium of 13% for the full sample, but this masks country-level variation. Separate analyses find a 12% premium for Italian firms and 20% premium for Spanish firms, but no significant premium for Portuguese firms. The authors aim to determine if hedging increases firm value, which could influence regulators' proposals to require central clearing of derivatives that may deter corporate hedging activities.
This document summarizes an agenda for the 7th annual conference on Liquidity and Cash Management for European Companies taking place on March 17-18, 2009 in Amsterdam. The conference will address responding to the financial crisis and embracing risk, with programming highlights such as the new banking landscape, fostering growth in a down market, and understanding counterparty risk with financial service providers. Over 270 finance and treasury professionals from across Europe attended the 2008 conference.
This document discusses the various types of risks faced by banks, including credit risk, liquidity risk, market risk, operational risk, capital risk, and others. It provides definitions and considerations for evaluating each type of risk, such as key ratios to examine for credit risk, balance sheet items that influence liquidity risk, and how changes in interest rates and exchange rates can impact market risk. The CAMELS framework for regulatory bank ratings is also summarized. Overall, the document provides an overview of fundamental risks in bank financial intermediation and how they can be assessed.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to FAI-lT .1 Financing the Global FirmCost of Capital (d.docx
-8-CARREFOUR S.A.Synopsis and Objectives.docxmercysuttle
-8-
CARREFOUR S.A.
Synopsis and Objectives
In August 2002, the French retail giant Carrefour S.A. is considering alternative currencies for raising (euros) EUR750 million in the eurobond market. Carrefour’s investment bankers provide various borrowing rates across four different currencies. Despite the high nominal coupon rate and the lack of any material business activity in the United Kingdom, the British-pound issue appears to provide the lowest cost of funds if the exchange rate risk is hedged.
The case is designed to serve as an introduction to topics in international finance. Topics of discussion include foreign-currency borrowing, interest-rate parity, currency risk exposure, derivative contracts (in particular forward and swap contracts), and currency risk management. Students are tasked with exploring (1) motives for borrowing in foreign currencies, (2) the exposure created by such financing policy, and (3) strategies for managing currency risk.
Suggested Questions for Advance Assignment to Students
1. Why should Carrefour consider borrowing in a currency other than euros?
2. Assuming the bonds are issued at par, what is the cost in euros of each of the bond alternatives?
3. Which debt issue would you recommend and why?
Hypothetical Teaching Plan
1. What is going on at Carrefour?
2. Is the Swiss-franc issue, at 3⅝%, a “no-brainer”?
3. What can a firm do to manage the exchange-rate risk of foreign-currency borrowing?
4. Using appropriate forward rates, what is the cost of borrowing in Swiss francs? British pounds? U.S. dollars? What should Carrefour do?
As reference material, broad empirical evidence of the managerial question in the case can be found in Matthew R. McBrady and Michael J. Schill, “Foreign currency denominated borrowing in the absence of operating incentives” Journal of Financial Economics 86 (October 2007): 145–177 and Matthew R. McBrady, Sandra Mortal, and Michael J. Schill, “Do firms believe in interest-rate parity?” working paper, Darden Graduate School of Business Administration, University of Virginia, Charlottesville.
Case Analysis
1.What is going on at Carrefour?
Carrefour is a massive retailer (Europe’s largest) with strong but selective expansion prospects internationally (case Exhibit 1). The company has a history of funding its capital needs through securities denominated in many different currencies (case Exhibit 3), and is sophisticated in managing currency risk. Carrefour currently has a EUR750 million capital need that the company intends to meet through the eurobond market.[footnoteRef:1] This offering represents approximately 11% of Carrefour’s bond portfolio. Carrefour’s investment bank has provided market borrowing rates in euros and three foreign currencies. [1: Bob Bruner suggests using the case to develop various facets of the eurobond market: (1) the eurobond market is an external market, outside the regulatory jurisdiction of any one country; (2) the bonds so iss ...
Learning ObjectivesUpon completion of Chapter 10, you will.docxSHIVA101531
Learning Objectives
Upon completion of Chapter 10, you will be able to:
• Understand the meaning of the weighted average cost of capital (WACC).
• Be able to estimate the weights in the WACC.
• Be able to estimate the cost of debt and how it is affected by taxes.
• Be able to estimate the cost of preferred stock.
• Know three approaches for estimating the cost of equity.
• Understand flotation costs and how they affect the WACC.
• Know when the WACC is the appropriate approach for estimating the required return for a project.
• Know an alternative approach for estimating a project’s required return when the WACC is not
the appropriate measure.
Cost of Capital
10
Nina Mourier/Getty Images
byr80656_10_c10_245-270.indd 245 3/28/13 3:35 PM
CHAPTER 10Section 10.1 Estimating the Discount Rate
Corporate managers use various capital budgeting techniques. Among these tech-niques, net present value (NPV) emerges as the best measure of a project’s con-tribution to shareholder wealth. In NPV analysis, the present value of a project’s
expected future cash flows is compared to the initial investment, and the project is accepted
if the present value exceeds the initial investment. Calculation of NPV requires the analyst
to estimate cash flows and an appropriate discount rate. Techniques for estimating cash
flows were covered in Chapter 6. In this chapter you will learn how to estimate the dis-
count rate. The same estimates of cash flows and discount rate are also used in internal
rate of return analysis. Used in IRR, the discount rate becomes a hurdle rate against which
to compare the project’s IRR.
10.1 Estimating the Discount Rate
To illustrate the calculation and use of the discount rate, we introduce a case study of Pacific Offshore Ltd. (POL). POL is considering the manufacture and sale of har-nesses to be used by sailors who must be tethered to their boats in the high seas.
The harnesses can save the lives of sailors who are washed overboard in rough water and
storms. The NPV of POL’s harness project is $9,110, which was found by discounting the
project’s net cash flows by 12.5%. The project’s internal rate of return of 17.2% is greater
than the 12.5% required rate of return on the harness project. Therefore, whether we use
NPV or IRR, the harness project appears to be acceptable because it meets the respective
decision criteria. Had the required return been 20%, for example, the project would have
been rejected using either criterion.
We have referred to the 12.5% as the harness project’s required rate of return. To be more
specific, 12.5% is the weighted average return demanded by the company’s investors. The
weightings reflect the proportional values of their investments. The cost of the harness
project is $64,384, meaning that the owners must raise that amount from their investors
to fund tools, equipment, and working capital and to pay the cost of reconfiguring the
plant. The owners decided to fund futu ...
COST of CAPITAL SLIDE Semester 2 2020-2021 part 1.pptmishJOHN1
The cost of preferred stock is the annual dividend divided by the net proceeds price. For Duchess' 10% preferred stock, the dividend is $8.70 per share and the net proceeds price is $82 per share. Therefore, the cost of preferred stock (rP) is 10.6% ($8.70/$82).
The document discusses the cost of capital and how to calculate the weighted average cost of capital (WACC) for a firm. It explains the different sources of capital including debt, preferred stock, and common equity. It also discusses how to estimate the costs of each type of capital and calculate WACC, as well as how to adjust the WACC for project-specific risks that differ from the average risk of the firm.
Funds of hedge funds failed to deliver value to investors and demonstrated dangerous redemption risks. FoHF managers ran large liquidity mismatches and did not address warnings about this risk. When hedge fund performance declined and redemptions increased in late 2008, the liquidity mismatch led to a crisis. Research on accurately modeling redemption terms and liquidity risks in FoHFs could have helped prevent this.
This document discusses considerations for multinational capital budgeting. It compares capital budgeting analyses from the perspective of a parent company versus a subsidiary and identifies factors that create differences in their cash flows, such as taxes, regulations on transferring funds, and exchange rate movements. The document also outlines inputs needed for multinational capital budgeting analyses and methods for assessing risk.
- BASF is a major international company with over 112,000 employees across 5 continents. It operates in industries like agriculture, chemicals, oil/gas, and plastics.
- In an attempt to increase value, BASF launched Vision 2020, a comprehensive strategic plan that challenged employees to act entrepreneurially. A key goal was for the company to earn its weighted average cost of capital (WACC) plus a premium each year.
- The chapter will explain how to calculate a firm's WACC, which is the minimum return needed to satisfy investors including stockholders, bondholders, and preferred stockholders. It will also discuss when the WACC should and should not be used.
1. The document discusses the concept of cost of capital, which is the weighted average cost of various sources of finance used by a firm. It is an important factor in financial decision making.
2. It provides details on different components that make up the cost of capital, including the cost of debt, cost of equity, weighted average cost of capital, and how they are calculated. It also discusses the risk free rate and equity risk premium.
3. The document considers different approaches that regulators have taken to estimate the components of cost of capital and which approaches the CAA intends to adopt in its analysis, including relying on historical averages for the risk free rate and equity risk premium.
Chapter15 International Finance ManagementPiyush Gaur
This document provides suggested answers and solutions to end-of-chapter questions from a textbook on international portfolio investment. It includes:
1) Answers to 12 multiple choice or short answer questions on topics like factors driving international investment, security return correlations across countries, world beta, and the impact of exchange rate fluctuations.
2) Solutions to 7 quantitative problems calculating returns, risks, and optimal portfolio weights for international investments considering exchange rate movements and correlations between different markets.
3) A description of input received from three consultants for a pension fund regarding the risks and rewards of international equity allocation, with two favoring it and one questioning the ability of international investing to reduce risk.
MCM will offer the lowest cost global index funds by managing labor costs. It will outsource all labor except sales to India, where costs are one-fourth of U.S. rates. MCM will track the MSCI All Country World Investable Market Index for stocks and the Barclays Global Aggregate Float Adjusted Bond Index for bonds, charging only 0.25% for each fund. This low cost structure takes advantage of trends showing investor capital increasingly flowing into low cost, global index funds due to their benefits of diversification and minimized fees. By keeping costs lower than competitors, MCM aims to maximize its assets under management.
The concept of Cost of capital for MNC is addressed in this ppt
Subscribe to Vision Academy for Video assistance https://www.youtube.com/channel/UCjzpit_cXjdnzER_165mIiw
Building and Maintaining a Private Market Portfolio: Inroduction to Private M...BrookePollack
CTC Consulting White Paper: Introduction to private market portfolio management and cash flow characteristcs of these investments for long-term private market investors.
Oil & Gas Intelligence Report: Financing Instruments in the Upstream SectorDuff & Phelps
This report includes an introduction to petroleum fiscal regimes and a classification of the main contracts, concessionary systems, sharing agreements and service agreements.
IMF is a global leader in litigation funding, with a $1.5 billion litigation portfolio and a track record of winning 78% of cases. Litigation funding provides portfolio diversification and is not correlated with economic cycles. IMF trades at a discount to its $1.96 blended valuation, offering upside potential from case wins and portfolio growth. Key value drivers are the size of the litigation portfolio, IMF's high win rate, and the duration of its cases.
FOREIGN DIRECT INVESTMENT AND BALANCE OF PAYMENTS IN LATIN AMERICA (1990-2011)pkconference
This document analyzes foreign direct investment (FDI) and its impact on the balance of payments in Latin America from 1990-2011. It discusses how FDI flows increased in Latin America in the 1990s as the region became reintegrated into the global financial system. However, some authors argue that high levels of FDI may actually constrain economic growth by putting pressure on countries' balance of payments through payments like profits, interest, and royalties sent abroad. The document aims to empirically test this theory using a panel data methodology to determine if GDP growth in Latin America was constrained by balance of payments issues related to FDI inflows.
The document provides an analysis of Land Securities Group PLC, a UK property company. It includes the following key points:
- Land Securities is the largest property company in the UK by market capitalization and is a member of the FTSE 100.
- The analysis estimates the cost of equity for Land Securities to be 6.78% based on the company's beta of 0.9 calculated from its market model, a market risk premium of 5.2%, and a risk-free rate of 2.1%.
- Using the dividend valuation model with a dividend growth rate of 2.6% and the estimated cost of equity, the document values Land Securities' share price at £0.782, which
Capital budgeting under financial system-1.pdfStarAngel16
This document discusses capital budgeting decisions for multinational corporations (MNCs). It explains that MNCs use the same framework as domestic firms but international projects face additional complexities. These include multiple currencies and tax systems, political risk, and restrictions on cash flow repatriation. The document outlines the capital budgeting process and key differences for MNCs, such as evaluating projects from both a local subsidiary and parent company perspective due to tax/exchange rate issues. It also discusses tools for incorporating risks like adjusting required rates of return or cash flows.
This study examines the value effects of hedging foreign currency and interest rate risk with derivatives for firms in Italy, Spain and Portugal from 2006-2008. The authors find an overall hedging premium of 13% for the full sample, but this masks country-level variation. Separate analyses find a 12% premium for Italian firms and 20% premium for Spanish firms, but no significant premium for Portuguese firms. The authors aim to determine if hedging increases firm value, which could influence regulators' proposals to require central clearing of derivatives that may deter corporate hedging activities.
This document summarizes an agenda for the 7th annual conference on Liquidity and Cash Management for European Companies taking place on March 17-18, 2009 in Amsterdam. The conference will address responding to the financial crisis and embracing risk, with programming highlights such as the new banking landscape, fostering growth in a down market, and understanding counterparty risk with financial service providers. Over 270 finance and treasury professionals from across Europe attended the 2008 conference.
This document discusses the various types of risks faced by banks, including credit risk, liquidity risk, market risk, operational risk, capital risk, and others. It provides definitions and considerations for evaluating each type of risk, such as key ratios to examine for credit risk, balance sheet items that influence liquidity risk, and how changes in interest rates and exchange rates can impact market risk. The CAMELS framework for regulatory bank ratings is also summarized. Overall, the document provides an overview of fundamental risks in bank financial intermediation and how they can be assessed.
Similar to FAI-lT .1 Financing the Global FirmCost of Capital (d.docx (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.
Reimagining Your Library Space: How to Increase the Vibes in Your Library No ...Diana Rendina
Librarians are leading the way in creating future-ready citizens – now we need to update our spaces to match. In this session, attendees will get inspiration for transforming their library spaces. You’ll learn how to survey students and patrons, create a focus group, and use design thinking to brainstorm ideas for your space. We’ll discuss budget friendly ways to change your space as well as how to find funding. No matter where you’re at, you’ll find ideas for reimagining your space in this session.
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
How to Manage Your Lost Opportunities in Odoo 17 CRMCeline George
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
Leveraging Generative AI to Drive Nonprofit InnovationTechSoup
In this webinar, participants learned how to utilize Generative AI to streamline operations and elevate member engagement. Amazon Web Service experts provided a customer specific use cases and dived into low/no-code tools that are quick and easy to deploy through Amazon Web Service (AWS.)
Chapter wise All Notes of First year Basic Civil Engineering.pptxDenish Jangid
Chapter wise All Notes of First year Basic Civil Engineering
Syllabus
Chapter-1
Introduction to objective, scope and outcome the subject
Chapter 2
Introduction: Scope and Specialization of Civil Engineering, Role of civil Engineer in Society, Impact of infrastructural development on economy of country.
Chapter 3
Surveying: Object Principles & Types of Surveying; Site Plans, Plans & Maps; Scales & Unit of different Measurements.
Linear Measurements: Instruments used. Linear Measurement by Tape, Ranging out Survey Lines and overcoming Obstructions; Measurements on sloping ground; Tape corrections, conventional symbols. Angular Measurements: Instruments used; Introduction to Compass Surveying, Bearings and Longitude & Latitude of a Line, Introduction to total station.
Levelling: Instrument used Object of levelling, Methods of levelling in brief, and Contour maps.
Chapter 4
Buildings: Selection of site for Buildings, Layout of Building Plan, Types of buildings, Plinth area, carpet area, floor space index, Introduction to building byelaws, concept of sun light & ventilation. Components of Buildings & their functions, Basic concept of R.C.C., Introduction to types of foundation
Chapter 5
Transportation: Introduction to Transportation Engineering; Traffic and Road Safety: Types and Characteristics of Various Modes of Transportation; Various Road Traffic Signs, Causes of Accidents and Road Safety Measures.
Chapter 6
Environmental Engineering: Environmental Pollution, Environmental Acts and Regulations, Functional Concepts of Ecology, Basics of Species, Biodiversity, Ecosystem, Hydrological Cycle; Chemical Cycles: Carbon, Nitrogen & Phosphorus; Energy Flow in Ecosystems.
Water Pollution: Water Quality standards, Introduction to Treatment & Disposal of Waste Water. Reuse and Saving of Water, Rain Water Harvesting. Solid Waste Management: Classification of Solid Waste, Collection, Transportation and Disposal of Solid. Recycling of Solid Waste: Energy Recovery, Sanitary Landfill, On-Site Sanitation. Air & Noise Pollution: Primary and Secondary air pollutants, Harmful effects of Air Pollution, Control of Air Pollution. . Noise Pollution Harmful Effects of noise pollution, control of noise pollution, Global warming & Climate Change, Ozone depletion, Greenhouse effect
Text Books:
1. Palancharmy, Basic Civil Engineering, McGraw Hill publishers.
2. Satheesh Gopi, Basic Civil Engineering, Pearson Publishers.
3. Ketki Rangwala Dalal, Essentials of Civil Engineering, Charotar Publishing House.
4. BCP, Surveying volume 1
How to Add Chatter in the odoo 17 ERP ModuleCeline George
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
How to Setup Warehouse & Location in Odoo 17 InventoryCeline George
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
FAI-lT .1 Financing the Global FirmCost of Capital (d.docx
1. FAI-lT .1 Financing the Global Firm
Cost of Capital ('/d
30
28
26
24
20
1B
16
14
12
10
B
6
4
2
The Cost of Capital and Financial Structure
2. ke = cost of equity
k'vncc = weighted
average after-tax
cost of capital
ka r x) = after-iax
cost of debt
Total Debt (D)
Debt Ratio (o/" =
-
Total Assets (V)
Partly offsetting the favorable effect of more debt is an increase
in the cost of equity (k"),
because investors perceive greater financial risk. Nevertheless,
the overall lveighted average
after-tax cost of capital (kwacc) continues to decline as the debt
ratio increases, until finan-
cial risk becomes so serious that investors and management
alike pierceive a real danger of
insoivency. This result causes a sharp increase in the cost of
new debt and equity, thus increas-
ing the weighted average cost of capital. The lou,point on the
resulting U-shaped cost of cap-
ital curve. which is at 14"/" in Exhibit 13.2. defines the debt
ratio range in which the cost of
capital is minimized.
Most theorists believe that the low point is actually a rather
broad flat area encompass-
ing a wide range of debt ratios, 30% to 60% In Exhibit 13.2,
3. rvhere little difference exists in
the cost of capital. They also believe that, at least in the United
States, the range of the flat
area and the location of a particular firm's debt ratio rvithin that
range are determined by
such variables as 1) the industry in which it competes;2)
volatility of its sales and operating
income; and 3) the collateral value of its assets.
*ptirt:;:l Finasreial Strer*t*r* and the MfdH
The domestic theory of optimal financial structures needs to be
modified by four more vari-
ables in order to accommodate the case of the MNE. These
variables, in order of appearance,
are 1) availability of capital; 2) diversification of cash flows; 3)
foreign exchange risk; and
4) expectations of international portfoiio investors.
Availability of Capital. Chapter 12 demonstrated that access to
capital in global markets allows
an MNE to lower its cost of equity and debt compared rvith
most domestic firms. It also per-
mits an MNE to maintain its desired debt ratio, even when
significant amounts of new funds
must be raised. In other wordq a multinational firm's marginal
cost of capital is constant for
considerable ranges of its capital budget. This statement is not
true for most small domestic
k").
1ge
an-
'of
4. ras-
ap-
.of
firms because they do not have access to the national
equity or debt markets' They must either
rely on internally generated funds or borrow for
the short and medium terms from commel-
cial banks. : r ^^-:+-r *^.lzatc are
Multinational firms domiciled in countries that have illiquid
capital markets ale rn
almost the same ,it,ruiion u, small domesri" tlt*t uniess they
have
gained a global cost and
availability of capital. They must rely on l"t"t"u!V generated
funds and bank borrowing' If
they need to raise significant u*o,rrrt. of new iunO--t
to finance growth opportunities' they
may need to borrow more than would be optimal from
the viewpoint of minimizing their cost
of capital.This is equivalentio saying tttut tfteir murginal
cost of capital is increasing at higher
budget levels'
Diversification of cash Flows. As explained in chapter
12, the-theoretical possibility exists
5. that multinational firms ur" in u bettlr position than domestic
firms to support higher debt
ratios because their "u*t
no*" are diveriified internationally' The probability
of a firm's cov-
ering fixed charges uoo", uuryirrg conditions ir product,
fila.ncjal,
and foreign exchange mar-
kets should increase it tfre vaiiaillity of its cash flows
is minimized'
By diversifyirrg "u*t
flo*' ini"'oationaffy' the MNE might be able to achieve
the
same kind of reductitn lo ,urt ftow uariaJlity asportfolio
investors receive from diver-
sifying their security holdings internationaily. R"tu'n' are not
perfectly correlated
between countries.
Incontrast'adomesticGermanfirmwouldnotenjoythebenefitofcash
flowinterna-
tional diversification but would have to rely entirely
on-iti own net cash inflow from domes-
tic operations. Perceived financial risk for the German
firm would be greater than for a
6. multinational firm because ifre variaUility of its German
domestic cash flows could not be off-
set by positive cash flows elsewbere in the world' L-^-
^haltcnoe^ hv e-n
As i.ntroduc"d i.A;;;; lz,thediversification argument has been
challenged
by empr-
ical research findings ttrai traNgs in tire united StateJ
actually have lower debt ratios than
their domestic counterparts. The agency costs of debt
were higher for the MNEs' as were
p"riiur risks, foreigr"l"rtuog" riski and asymmetric information'
Foreign Exchange Risk and the Cost of Debt
When a firm issues foreign currency denominated debt,
its effective cost equals the after-tax
cost of repaying the principal and interest, in terms
of the firm's own culfency' This amount
includes the nominal;;;i principal and interest in foreign
currency terms'
adjusted for any
foreign exchange gains or losses'
For example, if a U.S.-based firm borrows Sfr1,500,000
for one year at 5.00"/" interest' and
7. during the year the Swiss franc appreciut"t r.o* un initial rate of
-Sfr1'50001$
to Sfrl'4400/$'
what is the dollar cost of this debt (kd$)? Th; Joitu' p'o"""ds
of the initial borrowing are cal-
culated at the current spot rate of Sfrl'5000/$:
sfrl'5oo'ooo
= $1,ooo,ooo
Sfr].5000/$
At the end of one year the u.S.-based firm is responsible for
repaying the sfr1,500,000 prin-
cipal plus 5.00% i,,t*,",t, o. a total-of Sfr1,5r5,000. This
repayment,
however, must be made
aian ending spot rate of Sfrl'4400/$:
CHAPTER 1 3 Sourcing Equiiyand Debt Globally
355
Sfr1,500,000 x 1.05
ISS-
;in
llat
by
ing
8. Lnd
rws
rds
for
iiic Sfr1.4400/$
= 91,093,750
356 PA FT 4 Financing the Global Firm
The actual dollar cost of the loan's repayment is not the nominal
5.00o/o paid in Swiss franc
interest, but 9.37 5"/" :
l- sr.oq:.zso I
Lffirp*l - 1 = o'oe37s
: e'3'15"/"
The dollar cost is higher than expected due to appreciation of
the Swiss franc against the U.S.
dollar.
This total home-currency cost is actually the result of the
combined percentage cost of
debt and percentage change in the foreign currency's value. We
can find the total cost of bor-
rowing Swiss franJs by a U.S.-dollar based firm,k4$,by
multiplying one plus the Swiss franc
interest expense, katt',by one plus the percentage change in the
Sfri$ exchange rate,,t:
9. kl : I(1 + kaso) x (1 + s)l - 1
where kott' : 5.00% and s : 4.1667c./".The percentage change in
the value of the Swiss franc
versus the U.S. dollar, when the home currency is the U.S.
dollar, is
Sr - Sz Sfr1..5000/$ --!!11440qq x 100: +4.1667%s2 xloo:
srrt.++ool$
The total expense, combining the nominal interest rate and the
percentage change in the
exchange rate, is
ft,1$: [(1 + .0500) x (1 + .A41.667)] - 1 - .A%75 - 9.375o/o
The total percentage cost of capital is 9.3750/",not simply the
foreign currency interest pay-
ment of 5%. The after-tax cost of this Swiss franc denominated
debt, when the U.S. income
taxrate is 34%, is
tra$(I - t) : 9.375"/" x 0.66 : 6.1,875%
The firm would report the added 4.1667% cost of this debt in
terms of U.S. dollars as a foreign
exchange transaction loss, and it would be deductible for tax
purposes.
Fx g-te*tati *ns *f E nternati€3ffi al Foc"tf * I i a { nvest*rs
Chapter 12 highlighted the fact that the key to gaining a global
cost and availability of capital
is atiracting and retaining international portfolio investors.Their
expectations for a firm's debt
10. ratio and overall financial structures are based on global norms
that have developed over the
past 30 years. Because a large proportion of international
portfolio investors are based in the
most liquid and unsegmented capital markets, such as the
United States and the United King-
dom, thiir expectations tend to predominate and override
individual national norms. There-
fore, regardless of other factors, if a firm wants to raise capital
in global markets, it must adopt
global norms that are close to the U.S. and U.K. nonns. Debt
ratios up to 60% appear to be
acceptable. Any higher debt ratio is more difficult to sell to
international portfolio investors.
Fieraa-?eial Strasc{atne *fl Foreigru Sutrsieliaries
If we accept the theory that minimizing the cost of capital for a
given level of business risk and
capital budget is an objective that should be implemented from
the perspective of the consol-
idated MNE, then the financial structure of each subsidiary is
relevant only to the extent that
364 PA RT 4 Financing the Global Firm
attractive regulatory and tax environments, and low levels of
corruption. Location and the
use of English, increasingly acknowledged as the language of
global finance, are also
important factors.
11. Global Derivatives
With respect to the global derivatives, Chicago continues to be
the dominant location for
derivative creation and trading. This lead was reinforced
recently with the merger of the
Chicago Mercantile Exchange (CME) with the Chicago Board of
Tiade (CBOT). Eurex
(Frankfurt) and Euronext LIFFE (London) are also important
liquid derivative markets. Other
derivative exchanges are actively considering mergers to gain
competitiveness and liquidity.
Flectronic Trading
Most exchanges have moved heavily into electronic trading in
recent years. For example, the
role of the specialist on the floor of the NYSE has been greatly
reduced with a corresponding
reduction in employment by specialist firms. They are no longer
responsible for ensuring an
orderly movement for their stocks, but are still important in
making more liquid markets for
the less-traded shares. The same fate has reduced the
importance of market makers on the
London Stock Exchange. Now the U.S. stock market is actually
a network of 50 different
venues connected by an electronic system of published quotes
and sales prices.
Hedge funds and other high frequency traders dominate the
market. High frequency
traders now account for 60% of daily volumes. Equity volume
controlled by the NYSE fell
from 807o in 2005 to 25"k in 2010. Tiades are executed
immediately by computer. Spreads
12. between buy and sell orders are in decimal points as low as a
penny a share instead of an
eighth of a point. Liquidity has greatly increased but so has the
risk of unexpected swings in
prices. For example, on May 6,2010,the Dow Jones Average fell
9.2Yo at one point but even-
tually recovered by the end of the day. Nineteen billion shares
were bought and sold.
Effect of Cross-l-isting ancl Equity lssuance
on Share Price
Although cross-listing and equity issuance can occur together,
their impacts are separable
and significant in and of.themselves.
eross-Listing
Does merely cross-listing on a foreign stock exchange have a
favorable impact on share
prices? It depends on the degree to which markets are
segmented.
If a firm's home capital market is segmented, the firm could
theoretically benefit by
cross-listing in a foreign market if that market values the firm
or its industry more than does
the home market. This was certainly the situation experienced
by Novo when it listed on the
NYSE in 1981 (see Chapter 12). However, most capital markets
are becoming more inte-
grated with global markets. Even emerging markets are less
segmented than they were just a
few years ago.
13. A more comprehensive study consisted of 181 firms from 35
countries that instituted
their first ADR program in the United States over the period
from 1985 to 1995.1The author
measured the stbck price impact of the announcement of a
cross-listing in the United States
lDarius p. Miller, "The Market Reaction to International Cross-
Listings: Evidence from Depositary Receipts,"
Journal of Financial Economics, Vol. 51, 1999, pp. 102-723.
CHAPTER 1 3 Sourcing Equityand DebtGlobally 365
I the
also
r for
. the
urex
)ther
.v.
, the
ding
o 2n
s far
: the
- :_
tc,-
14. :ad.
; --t dt:
:s ii
;e:"
and found significant positive abnormal retulns around the
announcement date'
These were
retained in the immediate following period. As expected, the
study showed that the abnormal
returns were greater for firms resident in emerging markets with
a low level of legal barriers
to capital flois, than for firms resident in developed markets.
Rrms resident in emerging
marklts with heavy restrictions on capital flows received some
abnormal returns, but not as
high as firms resident in the other maikets. This was due to the
perceived limited liquiditv of
firms resident in markets with too many restrictions on capital
flows'
Fquity issuance
It is well known that the combined impact of a new equity issue
undertaken simultane-
ously with a cross-listing has a more favorable impact on stock
price than cross-listing
alone. This occurs beca1ie the new issue creates an instantly
enlarged shareholder base'
15. Marketing efforts by the underwriters prior to the issue
engender higher levels of.visibil-
ity. post-is'sue efforti by the underwriters to support at least the
initial offering price also
reduce investor risk.
The study of 181 firms cross-listing in the United States
contained 30 firms that initiated
new equity iisues (Level III ADRs). The author found a
statistically significant abnormal
return for these firms, even higher tlan for the firms that just
cross-listed (Levels I and II)'
Furthermore, the highest abnormal return was for Chilean firms
(8'23%)'Th" Chilean
market has one of the highest levels of restrictions affecting
foreign investors. Since it is well
known that stock prices.ieact negatively to new domestic issues
in the United States' some-
thing truly significant must be happening when foreign ADRs
are sold in the United States'
Even U.S. firms can benefit uy issuing equity abroad. A study
of u.S. firms that issued
equity abroad concluded that increased name recognition and
accessibility from global
equity issues leads to increased investor recognition and-
participation in both the primary
and slcondary markets.2 Moreover, the abilityio issue global
16. shares can validate firm quality
by reducing tle information asymmetry between insiders and
investors' Another conclusion
was that U.S. firms may seize a window of opportunity to
switch to global offerings when
domestic demand for their shares is weak. finatiy, the study
found that U.S' firms announcing
global equity offerings have significantly fewer negative market
reactions by about one per-
Jentage point than *hut *o,r1O have been expected had they
limited their issues to the
domestic market.
lncreasing Visibility and Political Acceptance. MNEs list in
markets where they have sub-
stantial physical operations. Commercial objectives are to
enhance corporate image, adver-
tise trademarks and products, get better local press coverage,
and become more familiar
with
the local financial community in order to raise working capital
locally.
Political objectives mighi include the need io meet local
ownership requirements for a
multinational firm's foreigi joint venture' Local ownership of
the parent firm's shares might
17. provide a forum for puUticiiing the firm's activities and how
they support the host country'
this objective is the most important one for Japanese firms. The
Japanese domestic market
has both low-cost capital unO ftlgtr availability. Therefore,
Japanese firms are not trying to
increase the stock priie, the liquidity of their shares, or the
availability of capital'
lncreasing Potential for Share Swaps with Acquisitions. Firms
that follow a strategy of
growth by acquisition are always looking for creative ways to
fund these acquisitions rather
ii,un puying cash. Offering their shares as partial payment is
considerably more attractive
if
zCongsheng Wu and Chuck C.y. Krvok, "Why Do U.S. Firms
Choose Global Equity Offerings?"' Financial
M anagement,Summer 2002, pp. 47 -65.
366 PA F T .i Financing the Global Firm
those shares have a liquid secondary market. In that case, the
target's shareholders have an
easy wav to convert their acquired shares to cash if they do not
prefer a share swap. However,
a share swap is often attractive as a tax-free exchange.
18. Compensating Management and Employees, If an MNE wishes
to use stock options and
share purchase compensation plans for local management and
employees, local listing would
enhance the perceived value of such plans. It should reduce
transaction and foreign exchange
costs for the local beneficiaries.
Barriers to Crass-Listing arxl Sclling fiquity Abroad
Although a firm may decide to cross-list and/or sell equity
abroad, certain barriers exist.
The most serious barriers are the future commitment to
providing fuli and transparent
disclosure of operating results and balance sheets as well as a
continuous program of
investor relations.
The Snr*mitment to Sisclosure and lnvestcr fielations
A decision to cross-list must be balanced against the implied
increased commitment to full
disclosure and a continuing investor relations program. For
firms resident in the Anglo-
American markets, listing abroad might not appear to be much
of a barrier. For example, the
SEC's disciosure rules for listing in the United States are so
stringent and costly that any
other market's rules are mere child's play. Reversing the logic,
however, non-lJ.S. firms must
really think twice before cross-listing in the United States. Not
only are the disclosure
requirements breathtaking, but also continuous timely quarterly
19. information is required by
U.S. regulators and investors. As a result, the foreign firm must
provide a costly continuous
investor relations program for its U.S. shareholders, including
frequent "road shows" and the
time-consuming personal involvement of top management'
Disclosure ls a Fouble-Sdged Sward
The U.S. school of thought is that the worldwide trend torn'ard
requiring fuller, more transpar-
ent, and more standardized financial disclosure of operating
results and financial positions
may have the desirable effect of lowering the cost of equity
capital. As we observed tn 2002
und 2008, lack of full and accurate disclosure, and poor
transparency worsened the U.S' stock
market decline as investors fled to safer securities such as U.S.
government bonds'This action
increased the equity cost of capital for all firms. The other
school of thought is that the ll.S-
level of required^ diiclosure is an onerous, costly burden. It
chases away many potential listers,
thereby narrowing the choice of securities available to U.S.
investors at reasonable trans-
action costs.
A study of 203 internationally traded shares concluded that
20. there is a statistically signifi-
cant relationship between the level of financial disclosure
required and the markets on which
the firms chose io list.3 The higher the level of disclosure
required, the less likely a firm would
be to list in that market. Howiver, for those firms that do list
despite the disclosure and cost
barriers, the payoff could be needed access to additional equity
funding of a large factory or
an acquisition in t6" United States. Daimler Benz took the
painful step of crossJisting on the
NYSE prior to raising equity in the United States to fund a new
auto plant and, as it turned
out later, to merge with Chrysler Corporation.
3Saudagaran, Shahrokh M. and Gary Biddle, "Foreign Listing
Location: A Study of MNEs and Stock Exchanges in
Eight Countrie s," Journcl of International Business
sndies,Yohtme26'No' 2' Second Quarter 1995'pp'319141'
370 PART 4 Financing the Global Firm
Hs'a{ex"seafi*na! Debt k!arkets
The international debt markets offer the borrower a variety of
different
21. maturities, repay-
ment structures, and currencies of denomination. The markets
and their many
different
instruments vary by source of funciing, pricing structure,
maturity, and
subordination or link-
age to other debt and equity instrumelnti.
pxtriUlt 13.7 provides an overview of the three basic
lit"gori", described in itre fotlowing sections, along with their
primary components as issued
or tradetj in the international debt markets today. The three
major sources
of debt funding on
the international markets are international bank loans and
syndicated credits,the
Ettonote
market,and the international bond market
Eank Lsans and Syndicated Gredits
lnternational Bank Loans. Internationai bank loans have
traditionally
been sourced in the
Eurocurrency markets. Furodollar bank loans are also called
"Eurodollar
credits" or simply
22. ,,Eurocredits." The latter title is broader because it encompasses
nondollar loans in the
Eurocurrency market. The key factor attracting both depositors
and
borrowers to the
Eurocurrency loan market is the narrow interest iate spread
within
that market' The differ-
ence between deposit and loan rates is often less lhan L"/o '
Eurocredits. Eurocredits are bank loans to MNEs, sovereign
governments,
international
institutions, and banks denominated in Furocurrencies and
extended
by banks in countries
other than the countrf in *hos" currency the loan is
denominated'
The basic borrowing inter-
est rate for Eurodolia. loans has long been tied to the London
Interbank
offered Rate
(LIBoR), which is ttre deposit rate app'iicable to interbank
loans within London'
Eurodollars
are lent for both short- and medium-term maturities, with
transactions
for six months or less
23. regarded as routine. Most Eurodollar loans are for a fixed term
with no provision for early
repayment.
Y
o'
Br
At
Te
Bank Loans and
Syndications
(floating-rate'
short- to mediumterm)
lnternational Bank Loans
Eurocredits
Syndicated Credits
Euronotes and Euronoie Facilities
Eurocommercial Paper (ECP)
Euro Medium-Term Notes (EMTNs)
l
24. Eurobond
. straight fixed-rate issue
. {loating-rate note {FRN)
. equitY-related issue
Foreign Bond
A
Lt
al
Euronote
Market
(lloating-rate'
short- to mediumierm)
lnternational
Bond Market
(f ixed and f loaiing-rate
medium- to long{erm)
CHAPTf R 1 3 Sourcing Equityand DebtGlobally 371
Syndicated Credits. The syndication of loans has enabled banks
to spread the risk of very
large loans among a number of banks. Syndication is
particularly important because many
large MNEs need credit in excess of a single bank's loan limit.
A syndicated bank credit is
25. arranged by a lead bank on behalf of its client. Before finalizing
the loan agreement, the lead
bank seeks the participation of a group of banks, with each
participant providing a portion of
the total funds needed.The lead manager bank will work with
the borrower to determine the
amount of the total credit, the floating-rate base and spread over
the base rate, maturity, and
fee structure for managing the participating banks. The periodic
expenses of the syndicated
credit are composed of two elements:
1. The actual interest expense of the loan, normally stated as a
spread in basis points over a
variable-rate base such as LIBOR.
2. Te commitment fees paid on any unused portions of the
credit. The spread paid over
LIBOR by the borrowir is considered the risk premium,
reflecting the general business
and financial risk applicable to the borrower's repayment
capability.
Gtobal Finance in Practice 13.1 illustrates the pricing common
to the syndicated loan mar-
kets, including interest expenses and the commitment and
investment banking fees'
$Eearonote fu4arket
The Euronote market is the collective term used to describe
short- to medium-term debt
instruments sourced in the Eurocurrency markets. Although a
multitude of differentiated
26. financial products exists, they can be divided into two major
groups-underwritten facilities
and nonirfderwritten facititiis.TJnderwritten facilities are used
for the sale of Euronotes in a
-
- 13J Ty^::l^til"j sroups:
1) the lead arranser bank(s), which
organizes the loan and participants; 2) the lead managing
pricing and Structure and underwriting banks, which aid in the
svndication of the
of a syndicated Eurocredit loan; and 3)the participating banks,
which actmllv provide
the capital.
Borrower:
Amount:
lrish Aerospace, GPA Airbus, GPA
Fokker, GPA Jetprop, GPA Rolls
US$l ,25 billion; Revolving loanV
guaraniees lletters of credit
Terms: Eight years at 93.75 basis points over
LIBOR, with a margin of 7/8% for GPA
Arranger:
Airbus drawings
Citicorp lnvestment Bank
Lead Managers
and Underwriters: Citibank, Chase lnvestment Bank,
27. Toronio-Dominion Bank, Citibank
(Channel lslands) for a syndicate of
Japanese leasing companies,
Credit Suisse,- Soci6t6 G6n6rale
(London), Amsterdam-Fotterdam
Bank, Bank o{ Nova Scotia, Bank of
Tokyo lnternational, Daiwa Bank, lBJ,
lrish lntercontinental
lf the 1.5% total fee was subdivided equally among the
three groups, the proceeds of the loan after expenses of
issuance and arrangement
$1,2s0,000,000 - [(0.005 + 0.005 + 0.005) x
$1 ,25o,ooo,oool : $1,231,250,000
The debt service payments over the B-year period prior to
principal repayment are LIBOFI + 93.75 basis points; assum-
ing an initial LIBOR rate of 9.00% (reset every six monihs for
semiannual debi service payments):
0.0900 + 0.0093751
I x $1,250,000,000 : $62'109'375
The effective annual cost is thus
x2x100=10.490/o
A typical syndicated loan of this type would have up-front The
syndicated credit will cost lrish Aerospace 10.09% ai the
fees totaling 1 .5% of the principal. The fees would be divided
culent LIBOR rate of 9.000o/o.
[ $oz,rog,szs I
28. Ls, B., e..p*J
372 PA R-i 4 Financing the Global Firm
number of different forms. Nonunderwritten facilities are used
for the sale and distribuiion
of Euro-commercial paper (ECP) and Euro medium-term nores
(EMTNs),
Euronote Facilities. A major development in international
money markets was the establish-
ment of facilities for sales of short-term, negotiable, promissory
notes-euronotes. Among
the facilities for their issuance were revolving underwriting
facilities (rufs), note issuance
facilities (nifs), and standby note issuance facilities (snifs).
These facilities were provided by
international investment and commercial banks. The euronote
was a substantially cheaper
source of short-term funds than were syndicated loans because
the notes were placed directly
with the investor public, and the securitized and underwritten
form allowed the ready estab-
lishment of liquid secondary markets. The banks received
substantial fees initially for their
underwriting and placement services.
Euro-Commercial Paper (ECP). Euro-commercial paper
(ECP),like commercial paper issued
in domestic markets around the world, is a short-term debt
obligation of a corporation or
bank. Maturities are typically one, three, and six months. The
paper is sold normally at a dis-
count or occasionally with a stated coupon. Although the market
29. is capable of supporting
issues in any major currency, over 907" of issues outstanding
are denominated in U.S. dollars.
Euro Medium-Term Notes (EMTNs). The Euro medium-term
note (EMTN) market effec-
tively bridges the maturity gap between ECP and the longer-
term and less flexible interna-
tional bond. Although many of the notes were initially
underwritten, most EMTNs are now
nonunderwritten.
The rapid initial growth of the EMTN market followed directly
on the heels of the same
basic instrument that began in the U.S. domestic market when
the U.S. Securities and
Exchange Commission (SEC) instituted Rule #415, allowing
compapies to obtain shelf regis-
trations for debt issues. What this meant was that once the
registration was obtained, the cor-
poration could issue notes on a continuous basis without having
to obtain new registrations
for each additional issue. This, in turn, allowed a firm to sell
short- and medium-term notes
through a much cheaper and more flexible issuance facility than
ordinary bonds.
The EMTN's basic characteristics are similar to those of a bond,
with principal, maturity,
and coupon structures and rates being comparable. The EMTN's
typical maturities range
from as little as nine months to a maximum of 10 years.
Coupons are typically paid semiannu-
ally, and coupon rates are comparable to similar bond
issues.The EMTN does, however, have
three unique characteristics. 1) the EMTN is a facility, allowing
30. continuous issuance over a
period of time, unlike a bond issue which is essentially sold all
at once1'z) because EMTNs are
sold continuously, in order to make debt service (coupon
redemption) manageable, coupons
are paid on set calendar dates regardless of the date of issuance;
3) EMTNs are issued in rel-
atively small denominations, from $2 million to $5 million,
making medium-term debt acqui-
sition much more flexible than the large minimums customarily
needed in the international
bond markets.
i nt*rg'latia*al *ar:d fdiarket
The international bond market sports a rich array of innovative
instruments created by imag-
inative investment bankers, who are unfettered by the usual
controls and regulations govern-
ing domestic capital markets.Indeed, the international bond
market rivals the international
banking market in terms of the quantity and cost of funds
providedto international borrow-
ers. All international bonds fall within two generic
classifications, Eurobonds and lbreign
bonds. The distinction between categories is based on whether
the borrower is a domestic or
a foreign resident, and whether the issue is denominated in the
local currency or a foreign
currency.
C l-1 r F j'I i] 'l li Sourcing Equity and Debt Globally 373
Eurobonds. A Eurobond is underwritten by an international
31. syndicate of banks and other
securities firms, and is sold exclusively in countries other than
the country in whose currency
the issue is denominated. For example, a bond issued by a firm
resident in the United States,
denominated in U.S. dollars, but sold to investors in Europe and
Japan (not to investors in the
United States), is a Eurobond.
Eurobonds are issued by MNEs, large domestic corporations,
sovereign governments,
governmental enterprises, and international institutions.They
arc offered simultaneously in a
number of different national capital markets, but not in the
capital market or to residents of
the country in whose currency the bond is denominated. Almost
all Eurobonds are in bearer
form with call provisions and sinking funds'
The syndicate that offers a n"*lsu" of Eurobonds might be
composed of underwriters
from a number of countries, including European banks, foreign
branches of U'S' banks' banks
from offshore financial centers, investment and merchant banks,
and nonbank securities firms'
t The Straight Fixed-Rate Issue. The sftaight fixed-rate issue is
structured like most domestic
bonds, wiitr a fixed coupon, set maturity date, and full principal
32. repayment upon final matu-
rity. Coupon, ur" nor*ully paid annually, rather than
semiannually, primarily because-the
bonds are bearer bonds and-annual coupon redemption is more
convenient for the holders.
t The Floating-Rate Note (FRN). The FRN normally pays a
semiannual coupon which is
determined
-using
a variable-rate base. A typical coupon would be set at some
fixed spread
over LIBOR. This structure, like most variable-rate interest-
bearing instruments, was
designed to allow investors to shift more of the interest-rate risk
of a financial investment
to the borrower. Although many FRNs have fixed maturities, a
number of major issues
since 1985 are perpetuitiEs. The principal will never be repaid.
Thus, they provide many of
the same financial functions as equity.
g The Equity-Related Issue. The equity-related international
bond resembles the straight
fixed-rate issue in practically all price and payment
characteristicq with the added feature
that it is convertible to stoci prior to maturity at a specified
33. price per share (or alterna-
tively, number of shares per bond). The borrower is able to
issue debt with lower coupon
payments due to the added value of the equity conversion
feature'
Foreign Bonds. A foreign bond isunderwritten by a syndicate
composed of members
frgm a
single-country, sold prirrcipally within that country, and
denominated in the currency of that
.o,intry. The lssuer,-however, is from another country. A bond
issued by a firm resident in
Sweden, denominated in dollars, and sold in the United States
to U.S. investors by U.S. invest-
ment bankers, is a foreign bond. Foreign bonds have nicknames:
foreign bonds sold in the
United States are "Yankie bonds"; foreign bonds sold in Japan
are "samurai bonds"; and for-
eign bonds sold in the United Kingdom are "Bulldogs'"
l.J n iq u* f; hara*teri sti** *f Eurobond fvlarket*
Although the Eurobond market evolved at about the same time
as the Eurodollar market'
the twomarkets exist for different reasons, and each could exist
independently of the other.
The Eurobond market owes its existence to several unique
34. factors. They are the absence of
regulatory interference, less stringent disclosure practices, and
favorable tax treatment.
Absence of Regulatory lnterference. National governments often
impose tight controls on
foreign issuers of ,""uiiti", denominated in the local currency
and sold within their national
boundaries. However, governments in general have less
stringent limitations for securities
denominated in foreigri currencies and sold within their markets
to holders of those foreign
currencies. In effect, Eurobond sales fall outside the regulatory
domain of any single nation'
374 PA R T 4 Financing the Global Firm
Less Stringent Disclosure, Disclosure requirements in the
Eurobond market are much less
stringent than those of the Securities and Exchange Commission
(SEC) for sales within the
United States. U.S. firms often find that the registration costs of
a Eurobond offering are less
than those of a domestic issue and that less time is needed to
bring a new issue to market. Non-
U'S' firms often prefer Eurodollar bonds over bonds sold within
the United States because ther
!9lot wish to undergo the costs, and disclosure, needed to
register with the SEC. However, the
SEC has relaxed disclosure requirements for certain private
35. placements (Rule #1444), which
has improved the attractiveness of the U.s. domestic bond and
equity markets.
Favorable Tax Status. Eurobonds offer tax anonymity and
flexibility. Interest paid on
Eurobonds is generally not subject to an income withholding
tax. As one might expect.
Eurobond interest is not always reported to tax authorities.
Eurobonds are usually issued in
bearer form, meaning that the name and country of residence of
the owner is not on the cer-
tificate. To receive interest, the bearer cuts an interest coupon
from the bond and turns it in at
a banking institution listed on the issue as a paying agent.
European investors are accus-
tomed to the privacy provided by bearer bonds and are very
reluctant to purchase registered
bonds, which require holders to reveal their names before they
receive interest. Bear-er bond
status, of course, is also tied to tax avoidance.
ffiating *f Hur*b*nds and *ther tnternati*na! issLres
Purchasers of Eurobonds do not rely only on bond-rating
services or on detailed analyses of
financial statements. The general reputation of the issuing
corporation and its underwriters
has been a major factor in obtaining favorable terms. For this
reason, larger and better-
known MNEs, state enterpriseg and sovereign governments are
able to obtain the lowest
interest rates. Firms whose names are better known to the
general public, possibly because
they manufacture consumer goods, are often believed to have an
advantage over equally
qualified firms whose products are less widely known.
36. Rating agencies, such as Moody's and Standard and Poor's
(S&Ps), provide ratings for
selected international bonds for a fee. Moody's ratings for
international bonds imply the
same creditworthiness as for domestic bonds of U.S. issuers.
Moody's limits its evaluation to
the issuer's ability to obtain the necessary currency to repay the
issue according to the origi-
nal terms of the bond. The agency excludes any assessment of
risk to the investor caused by
changing exchange rates.
Moody's rates international bonds upon request of the issuer.
Based on supporting finan-
cial statements and other material obtained from the issuer, it
makes a preliminary rating and
then informs the issuer who has an opportunity to comment.
After Moody's determines its
final rating, the issuer may decide not to have the rating
published. Consequently, a dispro-
portionately large number of published international ratings fall
into the highest categories,
since issuers about to receive a lower rating do not allow
publication.
Moody's review of political risk includes study of the
government system, the social envi-
ronment, and the nation's external relations. Its review of
economic risk looks at debt bur-
den. international liquidity, balance of payments flexibility,
economic structure, growth
performance, economic management, and economic outlook.
Moody's also evaluates the
bonds of sovereign-supported entities by tooking first at their
creditworthiness on a stand-
37. alone basis and then at the extent to which sovereign support
either enhances or diminishes
the borrower's financial strength. Credit ratings are critical to
borrowers and investors alike.
An MNE's credit rating determines its cost of funds.
Access to debt capital is, however, in the end, still a function of
basic societal norms. Reli-
gion itself, may play a part in the use and availability of debt
capital. Global Finance in prac-
tice 13.2 illustrates one area rarely seen by westerners, Islamic
Finance.
u
*si
t-.s
lcr,
,;,ai-
c4€
f€
ini
bir
tn{
an
th
38. a.l
q
1],
+
+
tit
A
sc
t
I
t
t
:!
CHAir T EH 1.1 Multinational Tax Management 387
completely neutral in its effect on private decisions and
completely equitable amongtax'
puy"rr. However, other theorists cLim that national policy
objectives such as balance of
puy*"ntt or investment in developing countries should be
encouraged through an aclive tax
39. inientive policy rather than requiring taxes to be neutral and
equitable. Most tax systems
compromise between these two viewpoints.
br" *uy to view neutrality is to require that the burden of
taxation on each dollar' euro,
-^,,-.{ ^f nrnfir ^^---,{ in hnme n^rrn!r' nnerrlinns ht' an MNE
be eqUal tO the bUf-pouiici, uj ycii ui PiuiiL uciiiitru iii itviiiu
uvurtrrJ "J *'^ '
den of taxation on each currency-equivalent of profit earned by
the same firm in its foreign
operations. This is called domeitic ieutrality. A second way to
view neutrality is to require
that the tax burden on each foreign subsidiary of the firm be
equal to the tax burden on its
competitors in the same country. This is called /o reign
neutratity .Te latter interpretation is
often supported by MNEs because it focuses more on the
competitiveness of the individual
firm in individual country-markets.
The issue of tax equiiy is also difficult to define and measure.
In theory, an equitable tax
is one that imposes the same total tax burden on all taxpayers
who are similarly situated and
located in the same tax jurisdiction. In the case of foreign
investment income, the U' S'
Tieasury argues that sinie the United States uses the nationality
principle to claim tax
jurisdiciion,t s.-owned foreign subsidiaries are in the same tax
40. jurisdiction as U.S' domestic
iubsidiaries. Therefore, a dollar earned in foreign operations
should be taxed at the same rate
and paid at the same time as a doiiar earned in domestic
operations.
f{atlonal Tsx f; nvircnsnent$
Despite the fundamental objectives of national tax authorities, it
is widely agreed that taxes
do affect economic decisioni made by MNEs. Tax treaties
between nations' and differential
tax structures, rates, and practices all result in a less than level
playing field for the MNEs
competing on world markets.
bxniUit 14.1 provides an overview of corporate tax rates as
applicable to the United
States, Germany, and Japan. Th e eategorrzationi of income
(e.g., distributed versus undistrib-
uted profits), the differences in iax raies, and the discrimination
in tax raies applicable to
income earned in specific countries serve to introduce the
critical dimensions of tax planning
for the MNE.
Nations typically structure their ta,x systenns along one of two
basic approaches: the
worldwide approach at the territorial approach. Both approaches
are attempts to determine
41. which firms, fbreign or domestic by inCorporation, or which
incomes, foreign or domestic in
origin, are subject to the taxation of host country tax
authorities'
Worldwide Approach. Tlte worldwide approach, also referred to
as the residential or
national approach,levies taxes on the income earned by firms
that are incorporated in the
host couniry-, regardless of where the income rvas earned
(domestically or abroad). An MNtr
earning incbme bottr at home and abroad would therefore find
its worldwide income taxed
by its host-country tax authorities. For example, a country like
the United States taxes the
income earned by firms based in the United States regardless of
whether the income
earned by the firm is domestically sourced or foreign sourced.
In the case of the United
States, oidinury foreign-sourced income is taxed only as
remitted to the parent firm' As
with all questions of tax. however, numerous conditions and
exceptions exist. The primary
problemis that this does not address the income earned by
foreign firms operating within
th" Urrit"d States. Countries like the United States then apply
the principle of territorial
taxation to foreign firms within their legal jurisdiction, taxing
42. all income earned by foreign
firms in the United States.
388 IrA RT 4 Financing the Global Firm
Taxable lncome Category
Cor[oiate income tax rates
Withholding taxes on dividends (portfolio):
with Japan
with Germany
with United States
Withholding taxes on dividends (substantial holdings):
with Japan
with Germany
with United States
Withholding taxes on interest:
with Japan
with Germany
with United States
43. Withholding taxes on royalties:
with Japan
with Germany
with United States
Comparison of corporate rax nates io; J;;;;, C"rr"ny,
and the United States
Japan
4i,;l;
15%
1Oo/o
tv70
0/5o/o
10%
10o/o
1Oo/o
Oolo
Germany United States
29.5o/o 40%
15% 5%
5o/o
44. O/5/ 15o/o
15olo 1a/o
5o/o
O/5/15o/o
10o/o lOo/o
Oo/o
ato/eJ /o
10% O%
Oo/o
0o/o
Source: Coporate income tax rates drawn from "KPMG'S
Corpoiate and lndirect Tax Rate Survey, 2008,' KPMG.com. Tax
rates as ol
April 1, 2008. Withholding tax rates extracled from Price
Waterhouse Coopers, Corporate Taxes: A Worldwide Summary
2009.
Territorial Approach. The territorial approach. also termed the
source approach,focuses on
the income earned by firms within the legal jurisdiction of the
host country, not on the
country of firm incorporation. Countries like Germany, that
follow the territorial
approach, apply taxes equally to foreign or 'jor-nesiic firrns on
income earned wiihin ihe
country, but in principle not on income earned outside the
country. The territorial
approach,like the worldwide approach, results in a major gap in
45. coverage if resident firms
earn income outside the country', but are nct taxed by the
country in which the profits are
earned. In this case, tax authorities extend tax coverage to
income earned abroad ifit is not
currently covered by foreign tax jurisdictions. Once again, a
mix of the two tax approaches
is necessary for full coverage of income.
Tax Deferral, If the worldwide approach to international
taxation is followed to the letter, it
would end the tax-deferral privilege for many MNEs. Foreign
subsidiaries of MNEs pay host-
ccuntry corporate income taxes, but many parent couniries defer
claiming a,idiiionai inc,cine
taxes on that foreign-source income until it is remitted to the
parent firm. For example, U.S.
corporate income taxes on some types of foreign-source income
of U.S.-owned subsidiaries
incorporated abroad are deferred until the earnings are remitted
to the U.S. parent. How-
ever, the ability to defer corporate income taxes is highly
restricted and has been the subject
of many of the tax law changes in the past three decades.
The deferral privilege was challenged once again in the2004
U.S. presidential campaign by
Senator Kerry the Democratic candidate for President. Senator
Kerry claimed that tax deferrals
create an incentive for outsourcing abroad-so called offshoring-
of certain manufacturing
CH/PT ER 1 4 MultinationalTax Management
46. and service activities by U.S. firms. The added concern to the
potential loss of American jobs
was the potential reduction in tax collections in the United
States, enlarging the already siz-
able U.S. government's fiscal deficit.
Tax Treaties
A network of bilateral tax treaties, many of which are modeled
after one proposed by the
Organization for Economic Cooperation and Development
(OECD), provides a means of
reducing double taxation. Tax treaties normally define whether
taxes are to be imposed on
income earned in one country by the nationals of another, and if
so, how. Tax treaties are
bilateral, with the two signatories specifying what rates are
applicable to which types of
income between themselves alone. Exhibit 14.1's specification
of withholding taxes on divi-
dends, interest, and royalty payments between resident
corporations of the United States,
Germany, and Japan, is a classic example of the structure of tax
treaties. Note that Germany,
for example, imposes a10"/o withholding tax on royalty
payments to Japanese investors, while
royalty payments to U.S. investors are withheld at a 0o/o rate.
The individual bilateral tax jurisdictions as specified through
tax treaties are particularly
important for firms that are primarily exporting to another
country rather than doing busi-
ness there through a "permanent establishment." The latter
would be the case for manufac-
turing operations. A firm that only exports would not want any
of its other worldwide income
taxed by the importing country. Tax treaties define what is a
47. "permanent establishment" and
what constitutes a limited presence for tax purposes. Tax
treaties also typically result in
reduced'withholding tax rates between the two signatory
countries, the negotiation of the
treaty itself serving as a forum for opening and expanding
business relationships between the
two countries.
Tax "f-ypes
Taxes are classified on the basis of whether they are applied
directly to income, called direct
taxes, or on the basis of some other measurable performance
characteristic of the firm,
called indirect taxes. Exhibit 14.2 illustrates the wide range of
corporate income taxes in the
world today.
lncome Tax. Many governments rely on income taxes, both
personal and corporate, for their
primary revenue source. Corporate income taxes are widely
used today. Some countries
impose different corporate tax rates on distributed income
versus undistributed income. Cor-
porate income tax rates vary over a relatively wide range, rising
as high as 45% in Guyana
and falling as low as 160/" in Hong Kong, 157" in the British
Virgin Islands, 10% in Cyprus,
and effectively 0% in a number of offshore tax havens.
Withholding Tax. Passive income (dividends, interest, royalties)
earned by a resident of one
country within the tax jurisdiction of a second country are
normally subject to a withholding
tax in the second country. The reason for the institution of
48. withholding taxes is actually quite
simple: governments recognize that most international investors
will not file a tax return in
each country in which they invest, and the government therefore
wishes to assure that a min-
imum tax payment is received. As the term "withholding"
implies, the taxes are withheld by
the corporation from the payment made to the investor, and the
taxes withheld are then
turned over to government authorities. Withholding taxes are a
major subject of bilateral tax
treaties, and generally range between 0 and 25o/o .
Value'Added Tax. One type of tax that has achieved great
prominence is the value-added
tax.The value-added tax is a type of national sales tax collected
at each stage of production
or sale of consumption goods in proportion to the value added
during that stage. In general,
389
5
390 PA R-f 4 Financing the Global Firm
Corporate lncome Tax Rates for Selected Countries
Rate Country Rate
Gibraltar
Greece
Guatemala
59. United Arab Emirates
United Kingdom
United States
Uruguay
Venezuela
Vietnam
Yernen
Zambia
Zimbabwe
Kuwait
Latvia
Libya
Lithuania
Luxembourg
Macau
Macedonia
Malaysia
Malta
62. religious activities, a.rd ihe postal service are usually exempt or
taxed at lower rates'
The
value-added tax has been adopted as the main source of revenue
from indirect taxation
by all
members of the European tinion, most other countries in
Western Europe, a number
of
Latin American countiies, canada, and scattered other countries.
A numerical example of
a
value-added tax computation is shown in Exhibit 14'3'
Other National Taxes. There are a variety of other national
taxes, which vary in importance
from country to country. The turnover tax (taxon the purchase
or sale of securities in some
country stock markets) and the tsx on undistributed profits were
mentioned before'
Propeity and inheritanc'e taxes,also termed transfer taxes,ate
imposed in a variety of ways
to aihieve intended social redistribution of income and wealth
as much as to raise revenue'
There are a number of red-tape charges for public services that
are in reality user taxes'
63. Sometimes foreign exchange purchas& or sales are in effect
hidden taxes inasmuch
as the
government earns revenuJrutn"t than just regulates imports and
exports for balance
of
payments reasons.
Foreign Tax Credits. To prevent double taxation of the same
income, most countries
grant a
forei{n tux creditfor income taxes paid to the host country.
Countries differ on how-they chl-
"utate
the foreign tax credit and what kinds of limitations they place
on the total dmount
claimed. Normally foreign tax credits are also available for
withholding taxespaid to other
countries on dividends,"royaities, intetest, and other income
remitted to the parent'
The
value-added tax and other sales taxes are not eligible for a
foreign tax creditbut are typically
deductible from pretax income as an expense.
CHAPTER 1 4 MultinationalTax Management
64. Value-Added Tax Applied to the Sale of a Wooden Fence Post
This is an example of how a wooden fence post would be
assessed for value-added
taxes in the course of its
production and subsequent sale. A value-added tax of loyo is
assumed'
Step 1
Step 2
Sales Price Value Added
Value-Added Cumulalive
Tax at 10% Value-Added Tax
391
So.oZ
$0.04
$o'os
$o oB
Stage of Production
Tree owner
Lumber mill
Lumber wholesaler
Lumber retailer
65. The original tree owner sells to the lumber mill, for $0 20, that
part of a tree that ultimately
becomls the fence post. The grower has added $0.20 in value up
to this
point by planting
and raising ihe tree. while collJcting $0,20 from the lumber
mill, the grower must sel
aside
$0.02 to pay the value-added tax to the government
The lumber mill processes the tree into fence posts and sells
each post for $O'+O to the
lum-
ber wholesaler. ihe lumber mill has added $O.ZO in value
($0,40 less $0 20) through its
pro-
cessing activities. Therefore, the lumber mill owner must set
aside $0.o2 io pay the
mill's
value-idded tax to the government. in practice, the owner would
probrably calculate
the mill3
t* flnifity
"r
i0% of Sd.40, or $0.04, with a tax credit of $0.02 for the value-
added tax
66. already paid by the tree owner'
steps 3 and 4 The lumber wholesaler and retailer also add value
to the fence post through their selling and
distribution activities. They are assessed $0.01 and $0.03
respectively, making the
cumulative
value-added iax collected by the government $0.08, or 10% of
the final sales
price.
$0.20
$0.40
$0.20
$0.20
$0.10
$0.30
$0.02
$0.02
$o.ot
$0.03
$0.50
$0.80
67. 392 PA RT 4 Financing the Global Firm
Foreign Tax Credits
Without loreign
tax credits
With foreign
tax credits
Before{ax foreign income
Less foreign tax @ 30%
Available to parent and paid as dividend
Less additional parent-country tax at 35%
Less incremental tax (after credits)
Profit after all taxes
Total taxes, both jurisdictions
Effective overall tax rate (total taxes paid + foreign income)
$10,000
-3,000
$10,000
-3,000
68. $ 7,000
*2,450
$ 7,000
-500
$ 4,550
$ 5,450
$ 6,500
$ 3,500
54.Se/o 35.Oo/o
A tax credit rs a direct reduction of taxes that would otherwise
be due
and payable' It differs
from a deductible expense,which is an expense used to reduce
taxable income before the tax
rate is applied. A $100 tax credit reduces taxes payable by
the.fuU $100' whereas
a $100
deductible expense reduces taxable income by $100 and taxes
payable by $100 X t' wiere / is the
tax rate. Thx credits are more valuable on a dollar-for-dollar
basis
than are deductible expenses'
If there were no credits for foreign taxes paid, sequential
taxation by the host
govern-
69. ment and then by the home government would result in a very
high
cumulative tax rate' To
illustrate, assume the wholly 6wned foreign subsidiary of an
MNE
earns $10'000 before local
income taxes and puy, u Olnia"nd equal tJ at of its after-tax
income'The
host country income
tax rate is 30%, and the home countiy of the parent tax rate
ifll:'assuming no
withholding
taxes.Total taxation with and without tax credits is shown in
Exhibit 14'4'
If tax credi.ts ur" ,roi utto*ed, sequential levying olboth a 307o
host
country tax and then a
35% home country tax on the income that remains results in an
effective 54'5% tax' a cumula-
tive rate that would render many MNEs uncompetitive with
single-country
local firms' The
effect of allowing tax credits is to tlmit total taxation on the
original
before-tax income to no
more than ttre trlgrrest single rate among jurisdictions. In the
70. case depicted in Exhibit 1'4'4'the
effective overall tax rate of 35o/o with foreign tax credits is
equivalent
to the higher tax rate of
the home country (and is the tax rate payable if the income had
been earned at home)'
The $500 of additional home country tax under the tax
credit system in Exhibit 14'4 is the
amount needed to urlog;ul taxation i$:,ooo already paid plus.the
additional $500)
up to
but not beyond 35% of lhe original $10,000 of before-tax
foreign
income'
Traxrsfer Fricing
The pricing of goods, services, and technology tralsferred to
a foreign subsidiary from an
affiliated company, t*rtl"r pridng, is the first-and foremost
method of transferring
funds out
of a foreign subsidiary.Tirese costJenter directly into the cost
of goods sold component of the
subsidiary's income statement.This is a particularly sensitive
problem for MNEs' Even purely
domestic firms find it difficutt to reach agreement on the best
71. method for setting prices on
transactions betrveen related units. In the multinational case,
managers must balance conflict-
ingconsiderations.Theseincludefundpositioningandincometaxes.
* Fund Positioning Effect. A parent wishing to transfer funds
out of a particular country
can
charge higher prices on goods sola to its subsidiary in that
country-to
the degree that govern-
ment regulations attori. A foreign subsidiary can be financed by
the reverse
technique'