This document studied the effects of water quality factors like turbidity, total organic carbon (TOC), and salinity on the inactivation and repair of two microalgae - Microcystis viridis and Tetraselmis suecica - following medium-pressure UV irradiation. It found that increased turbidity, TOC and salinity levels generally reduced UV disinfection efficiency for both microalgae. TOC in particular promoted higher levels of photoreactivation and dark repair for M. viridis. T. suecica showed more sensitive responses to changes in the three water quality factors than M. viridis.
Presentation at the ESPP stakeholder meeting concerning the use on farmland of sewage biosolids (04/12/2018) organised by the European Sustainable Phosphorus Platform (ESPP, www.phosphorusplatform.eu)
All outcomes of the meeting can be found here https://www.phosphorusplatform.eu/activities/conference/meeting-archive/1788-espp-meeting-sludge-2018
Determinar la toxicitat dels sediments en els ecosistemes aquàtics és un repte, i és necessari per a una adequada avaluació del risc toxicològic en aquests ecosistemes. En les darreres dècades s’han estudiat i aplicat diferents eines (ex. tests de laboratori amb diferents concentracions, tests amb l’aigua intersticial, estudis de bioacumulació, índexs de toxicitat). Actualment es recomana l'aplicació conjunta d'eines químiques, ecològiques i toxicològiques per a una adequada avaluació. En aquest treball utilitzem l’aproximació de les Toxic Units, tests de toxicitat amb l’aigua intersticial (Vibrio fischeri, Pseudokirchneriella subcapitata i Daphnia magna) i tests d'exposició amb el sediment (V. fischeri, Chironomus riparius), juntament amb l’estudi de la comunitat d'invertebrats, per detectar respostes a curt i llarg termini en quatre rius de la Península Ibèrica: el Llobregat, l’Ebre, el Xúquer i el Guadalquivir.
by Núria de Castro-Català, Maja Kuzmanovic, Neus Roig, Jordi Sierra, Antoni Ginebreda, Damià Barceló, Sandra Pérez, Mira Petrovic, Yolanda Picó, Marta Schumacher and Isabel Muñoz
Mutagenic and genotoxic assessment of atrazine-based herbicide to freshwater ...Taqprimer institute
Mutagenic and genotoxic assessment of atrazine-based
herbicide to freshwater fishChanna punctatus(Bloch) using
micronucleus test and single cell gel electrophoresis
TIE microplastics immersed in Muskegon Lake, Michiganjeanniekane
Toxicity analysis of three different types of microplastics - polyethylene, polypropylene, and polystyrene - immersed in the benthic and pelagic regions of Muskegon Lake, Michigan
Presentation at the ESPP stakeholder meeting concerning the use on farmland of sewage biosolids (04/12/2018) organised by the European Sustainable Phosphorus Platform (ESPP, www.phosphorusplatform.eu)
All outcomes of the meeting can be found here https://www.phosphorusplatform.eu/activities/conference/meeting-archive/1788-espp-meeting-sludge-2018
Determinar la toxicitat dels sediments en els ecosistemes aquàtics és un repte, i és necessari per a una adequada avaluació del risc toxicològic en aquests ecosistemes. En les darreres dècades s’han estudiat i aplicat diferents eines (ex. tests de laboratori amb diferents concentracions, tests amb l’aigua intersticial, estudis de bioacumulació, índexs de toxicitat). Actualment es recomana l'aplicació conjunta d'eines químiques, ecològiques i toxicològiques per a una adequada avaluació. En aquest treball utilitzem l’aproximació de les Toxic Units, tests de toxicitat amb l’aigua intersticial (Vibrio fischeri, Pseudokirchneriella subcapitata i Daphnia magna) i tests d'exposició amb el sediment (V. fischeri, Chironomus riparius), juntament amb l’estudi de la comunitat d'invertebrats, per detectar respostes a curt i llarg termini en quatre rius de la Península Ibèrica: el Llobregat, l’Ebre, el Xúquer i el Guadalquivir.
by Núria de Castro-Català, Maja Kuzmanovic, Neus Roig, Jordi Sierra, Antoni Ginebreda, Damià Barceló, Sandra Pérez, Mira Petrovic, Yolanda Picó, Marta Schumacher and Isabel Muñoz
Mutagenic and genotoxic assessment of atrazine-based herbicide to freshwater ...Taqprimer institute
Mutagenic and genotoxic assessment of atrazine-based
herbicide to freshwater fishChanna punctatus(Bloch) using
micronucleus test and single cell gel electrophoresis
TIE microplastics immersed in Muskegon Lake, Michiganjeanniekane
Toxicity analysis of three different types of microplastics - polyethylene, polypropylene, and polystyrene - immersed in the benthic and pelagic regions of Muskegon Lake, Michigan
As our environment is degrading day by day it's an important tool for the study of environmental health. Ecological indicators provide us information about the sudden change in the environment. So that we can take appropriate steps for its protection.
DEVELOPMENT OF MATHEMATICAL MODEL TO PREDICT THE TRANSPORT OF E.COLI IN A NAT...IAEME Publication
Development of mathematical model to predict the rate of microbial depositions (E.coli) in a natural pond has been carried out. The models were developed to monitor the rate of concentration at different periods, with respect to the length of the pond at various sample station. Results of the theoretical values were compared with the experimental analysis. The analysis was thoroughly done to determine the physiochemical parameters of the pond. Microbial traces were found from the experimental analysis at different periods up to hundred days. The developed model compared favourably well with the experimental values. The values explain the rate of microbial growth and level of lag phase condition. The growth rate of the microbes were found to be higher because there is high deposition of substrate for growth and energy, while at some periods it degrades showing that the substrates have reduced in concentration including the inhibition from the pH. In some cases when the microbes developed lag phase condition it may be as a result of other environmental factors. Finally, the growth rates are between fifty and hundred days, showing that there is constant regeneration of the microbes including other environmental factors.
Effects of Fungicides for Non Target Fungi Alternaria cassiaeIJEAB
The fungicides are used to control of pathogenic fungi in several tilth but they can affect negatively the microorganisms diversity of soil. The aim of this research was to evaluate the toxicity and environmental risk of tebuconazoles: captan, tebuconazole and the mixture chlorothalonil + propamocarb hidrochloride for fungi Alternaria cassiae. Each fungicide were performed three experiments in completely randomized design with three repetitions and the growth was evaluated daily. Inhibition concentration (IC50;7d) of tebuconazole was 3.49 mg L-1, the captan was 47.36 mg L-1 and of mixture chlorothalonil + propamocarb hidrochloride, 64.04 mg L-1. Tebuconazole is classified as moderately toxic and sensitivity, captan, low toxicity and sensitivity and the mixture, non toxic and insensitive but only captan showed possibility of adverse effect for A. cassiae.`
Slides from the Deschutes Land Trust's Nature Night presentation by Dr. Susanne Brander, researcher at Oregon State University considering the impacts of microplastic pollution on our environment.
Effects of Electromagnetic Fields on the Microbial Load of Waste Water Sample...IJEAB
Wastewater is any water that has been adversely affected in quality by anthropogenic influence which can serve as habitat for pathogenic microbes and can constitute to health hazard of the populace. The present study was designed to enumerate and identify microorganisms in wastewaters and to investigate the effect of Electromagnetic Field (EMF) on the populations and identities of bacteria in the wastewaters from selected industries in Akure Metropolis. Wastewater samples were collected from two different industries in Akure Metropolis. The waste water samples were subjected to microbiological analyses before and after exposure to Electromagnetic field (EMF) at 1150nT, 1310nT, 3000nT, 5000nT. The presence of some bacteria in the waste water collected from different companies showed their occurrence at different hours during the treatment of the wastewater sample with different EMF strength. It was observed that at the early part (hours) of the experiment the heavy presence of microbes were seen but as the experiment progresses the microbial population were observed been reduced. It is therefore recommended that wastewater from industries should be treated with EMF before discharging them to the other water bodies so as to avoid contamination. This will help reduce microbial population that constitute a serious hazard to public health. And could also help protect other life forms inhabiting the water body and thus guard against ecological imbalance of the microbiota.
Environmental Indicators: Measuring Urban Development in Mountains of India. Presented by Kashinath Vajpai at the "Perth II: Global Change and the World's Mountains" conference in Perth, Scotland in September 2010.
— The formation, species composition and functional role of red algae were studied in the Black Sea's coastal zone. In sublittoral plant communities, red algae are dominant both by their number of species in the phytocenosis and by their active thallus-the one that ensures their high metabolism. Algae with a large specific surface area of thallus can accumulate heavy metals in higher concentrations. In the paper, we discuss possibilities of using red algae as biomarkers of marine pollution, and as bio filters in the processes of water natural.
For those who know us...we are sharing a refresher to tell you about our capability as an Emirati company.
For those who are new, here is a quick peak to show you how we can enhance your business
As our environment is degrading day by day it's an important tool for the study of environmental health. Ecological indicators provide us information about the sudden change in the environment. So that we can take appropriate steps for its protection.
DEVELOPMENT OF MATHEMATICAL MODEL TO PREDICT THE TRANSPORT OF E.COLI IN A NAT...IAEME Publication
Development of mathematical model to predict the rate of microbial depositions (E.coli) in a natural pond has been carried out. The models were developed to monitor the rate of concentration at different periods, with respect to the length of the pond at various sample station. Results of the theoretical values were compared with the experimental analysis. The analysis was thoroughly done to determine the physiochemical parameters of the pond. Microbial traces were found from the experimental analysis at different periods up to hundred days. The developed model compared favourably well with the experimental values. The values explain the rate of microbial growth and level of lag phase condition. The growth rate of the microbes were found to be higher because there is high deposition of substrate for growth and energy, while at some periods it degrades showing that the substrates have reduced in concentration including the inhibition from the pH. In some cases when the microbes developed lag phase condition it may be as a result of other environmental factors. Finally, the growth rates are between fifty and hundred days, showing that there is constant regeneration of the microbes including other environmental factors.
Effects of Fungicides for Non Target Fungi Alternaria cassiaeIJEAB
The fungicides are used to control of pathogenic fungi in several tilth but they can affect negatively the microorganisms diversity of soil. The aim of this research was to evaluate the toxicity and environmental risk of tebuconazoles: captan, tebuconazole and the mixture chlorothalonil + propamocarb hidrochloride for fungi Alternaria cassiae. Each fungicide were performed three experiments in completely randomized design with three repetitions and the growth was evaluated daily. Inhibition concentration (IC50;7d) of tebuconazole was 3.49 mg L-1, the captan was 47.36 mg L-1 and of mixture chlorothalonil + propamocarb hidrochloride, 64.04 mg L-1. Tebuconazole is classified as moderately toxic and sensitivity, captan, low toxicity and sensitivity and the mixture, non toxic and insensitive but only captan showed possibility of adverse effect for A. cassiae.`
Slides from the Deschutes Land Trust's Nature Night presentation by Dr. Susanne Brander, researcher at Oregon State University considering the impacts of microplastic pollution on our environment.
Effects of Electromagnetic Fields on the Microbial Load of Waste Water Sample...IJEAB
Wastewater is any water that has been adversely affected in quality by anthropogenic influence which can serve as habitat for pathogenic microbes and can constitute to health hazard of the populace. The present study was designed to enumerate and identify microorganisms in wastewaters and to investigate the effect of Electromagnetic Field (EMF) on the populations and identities of bacteria in the wastewaters from selected industries in Akure Metropolis. Wastewater samples were collected from two different industries in Akure Metropolis. The waste water samples were subjected to microbiological analyses before and after exposure to Electromagnetic field (EMF) at 1150nT, 1310nT, 3000nT, 5000nT. The presence of some bacteria in the waste water collected from different companies showed their occurrence at different hours during the treatment of the wastewater sample with different EMF strength. It was observed that at the early part (hours) of the experiment the heavy presence of microbes were seen but as the experiment progresses the microbial population were observed been reduced. It is therefore recommended that wastewater from industries should be treated with EMF before discharging them to the other water bodies so as to avoid contamination. This will help reduce microbial population that constitute a serious hazard to public health. And could also help protect other life forms inhabiting the water body and thus guard against ecological imbalance of the microbiota.
Environmental Indicators: Measuring Urban Development in Mountains of India. Presented by Kashinath Vajpai at the "Perth II: Global Change and the World's Mountains" conference in Perth, Scotland in September 2010.
— The formation, species composition and functional role of red algae were studied in the Black Sea's coastal zone. In sublittoral plant communities, red algae are dominant both by their number of species in the phytocenosis and by their active thallus-the one that ensures their high metabolism. Algae with a large specific surface area of thallus can accumulate heavy metals in higher concentrations. In the paper, we discuss possibilities of using red algae as biomarkers of marine pollution, and as bio filters in the processes of water natural.
For those who know us...we are sharing a refresher to tell you about our capability as an Emirati company.
For those who are new, here is a quick peak to show you how we can enhance your business
Conceptos, características y su aplicación. Es importante su comprensión para la aplicación adecuada en las organizaciones.
Presentación Final, Maestría en Recursos Humanos, USAC. 2016. Autor: Karla Ixcot.
In recent years, nanoparticles that have size of 1-100 nm is widely used for textile, pharmacy,
cosmetic and treatment of industrial wastewater. Producing and using of nanoparticles widely, causes
important accumulation in nature and toxicity on ecosystem. Knowledge of potential toxicity of nanoparticles is
limited. In this study, six different nanoparticles nano-zinc oxide, nano-silicon dioxide, nano-cerium oxide,
nano-aluminum oxide, nano-hafnium oxide, and nano-tantalum oxide which used commonly, were studied to
investigate toxic impacts on organisms. We studied nine different acute toxicity test (bacteria – Escherichia coli
(gram negative bacteria) ; bacteria – Bacillus cereus (gram positive bacteria) ; bacteria – Vibrio fischeri
(bioluminescences bacteria) ; methane Archae Bacteria ; yeast – Candida albicans ; mold – Aspergillus niger ;
algae – Chlorella sp. ; Crustacea – Daphnia magna ; lepistes - Poecillia reticula) for the effect of
nanoparticles to different trophic levels. In general, the most toxic nanoparticle is nano-zinc oxide and the least
toxic nanoparticle is nano-hafnium oxide. Among the used organisms in acute toxicity test; the most sensitive
organism is algae - Chlorella sp ;the most resistant organism is fish- Poecillia reticula.
Formation of chlorinated breakdown products during degradation of sunscreen a...Maciej Przybyłek
In this study, a new degradation path of sunscreen active ingredient, 2-ethylhexyl-4-methoxycinnamate (EHMC) and 4-methoxycinnamic acid (MCA) in the presence of sodium hypochlorite (NaOCl), was discussed. The reaction products were detected using gas chromatography-mass spectrometry (GC-MS). Since HOCl treatment leads to more polar products than EHMC, application of polar extracting agents, dichloromethane and ethyl acetate/n-hexane mixture, gave better results in terms of chlorinated breakdown products identification than n-hexane. Reaction of EHMC with HOCl lead to the formation of C=C bridge cleavage products such as 2-ethylhexyl chloroacetate, 1-chloro-4-methoxybenzene, 1,3-dichloro-2-methoxybenzene, and 3-chloro-4-methoxybenzaldehyde. High reactivity of C=C bond attached to benzene ring is also characteristic for MCA, since it can be converted in the presence of HOCl to 2,4-dichlorophenole, 2,6-dichloro-1,4-benzoquinone, 1,3-dichloro-2-methoxybenzene, 1,2,4-trichloro-3-methoxybenzene, 2,4,6-trichlorophenole, and 3,5-dichloro-2-hydroxyacetophenone. Surprisingly, in case of EHMC/HOCl/UV, much less breakdown products were formed compared to non-UV radiation treatment. In order to describe the nature of EHMC and MCA degradation, local reactivity analysis based on the density functional theory (DFT) was performed. Fukui function values showed that electrophilic attack of HOCl to the C=C bridge in EHMC and MCA is highly favorable (even more preferable than phenyl ring chlorination). This suggests that HOCl electrophilic addition is probably the initial step of EHMC degradation.
Effects of Fungicides for Non Target Fungi Alternaria cassiaeIJEAB
The fungicides are used to control of pathogenic fungi in several tilth but they can affect negatively the microorganisms diversity of soil. The aim of this research was to evaluate the toxicity and environmental risk of tebuconazoles: captan, tebuconazole and the mixture chlorothalonil + propamocarb hidrochloride for fungi Alternaria cassiae. Each fungicide were performed three experiments in completely randomized design with three repetitions and the growth was evaluated daily. Inhibition concentration (IC50;7d) of tebuconazole was 3.49 mg L-1, the captan was 47.36 mg L-1 and of mixture chlorothalonil + propamocarb hidrochloride, 64.04 mg L-1. Tebuconazole is classified as moderately toxic and sensitivity, captan, low toxicity and sensitivity and the mixture, non toxic and insensitive but only captan showed possibility of adverse effect for A. cassiae.
Triclosan Persistence in Environment and Its Potential Toxic Effects on AlgaeAJASTJournal
Triclosan (TCS) is widely used as an antibacterial agent in various industrial products, such as textile goods, soap, shampoo, liquid toothpaste and cosmetics, and often detected in wastewater effluent. Triclosan is highly toxic to aquatic animals, and is particularly highly toxic to the algae, which was used as a test organism in this study. Algae represent the first nutritional base on the aquatic food chain due to their ability to synthesize organic molecules using sunlight and carbon dioxide. Thus, the cultivation of algae has been an integral part for the production of commercially important species on aquaculture. This has been the reason to make great efforts in order to understand effect of triclosan to natural periphyton communities (algae). However, there is a paucity of data on the toxicity of triclosan and its effects on aquatic organisms. In this study, the toxicity of triclosan to a microalga was examined. The present investigation showed that “chlorophyll a” pigment in control algae was 5.92 mg/L and it decreased, when algae was treated with different concentration of triclosan (10-50 ppm). The study revealed that, as the concentration of triclosan increased then algae growth declined. It was observed that conductivity also increased because of decreased “chlorophyll a” and decreased phytoplankton levels. This result indicates that triclosan exerts a marked influence on algae, which are important organisms being the first-step producers in the ecosystem; therefore, the possible destruction of the balance of the ecosystem is expected if triclosan is discharged into the environment at high levels. The bioaccumulation of TCS in human impregnation from foodstuff exposure (in particular fish) and likely risk for human population also.
A Comprehensive Research Resource.
UVC has a long history of harmful pathogen destruction, including Salmonella. We did the hard work of gathering research and compiling into a digestible resource.
A Comprehensive Research Resource.
UVC has a long history of harmful pathogen destruction, including E. coli. We did the hard work of gathering research and compiling into a digestible resource.
Effects of UVR and CO2 on phytoplankton on a temperate coastal lagoonRita Domingues
Similar to effects of water quality on inactivation and repair of Microcystis viridis and tetraselmis suecica following medium pressure UV irradiation (20)
2. vector for transference of various species with bacteria and virus-
like particles (VLPs) dominating ballast water biota around the
world (Kim et al., 2015), which has negative impacts on the envi-
ronment through factors such as competition for food, altered
substrate/ambient temperature and light availability (Sutherland
et al., 2001). For example, Cholera infections could result from
discharge of ballast water (McCarthy and Khambaty, 1994). Nearly
all known harmful algal bloom species have been documented in
viable form from ship's ballast water (Hallegraeff, 2015). Some
species carried in ballast water may survive the voyage and thrive
in their new environment, which may have negative ecological,
economic and public health impacts on the receiving environment
(Tsolaki and Diamadopoulos, 2010). The introduction of invasive
marine species into new environments by ships' ballast water has
been identified by the Global Environment Facility (GEF) as one of
the four greatest threats to the world's oceans.
Ultraviolet (UV) radiation, a tried, tested method in water/waste
water management has been adopted, accounting for almost 25% of
the current installations (Lloyd's Register, 2010). It is very effective
to kill most of the organisms carried by the ballast water: in-
vertebrates and their eggs (Raikow et al., 2007), viruses (Guo et al.,
2010; Hijnen et al., 2006), bacteria (Hijnen et al., 2006; Rubio et al.,
2013), protozoan (oo)cysts (Hijnen et al., 2006), phytoplankton (Tao
et al., 2013) and other microbes. The two most commonly used UV
lamps are medium-pressure (MP) and low-pressure (LP) mercury
UV lamps, the former emitting a broad spectrum of wavelengths in
the UV radiation region ranging from 200 to 400 nm (Masschelein,
2002), whereas the latter emits monochromatic UV radiation at
254 nm. Malley (1999) found that a single MP UV lamp has the
same disinfection capacity as 25 LP UV lamps with the same size
because of its higher intensity, which makes the MP UV lamps
become a cost-effective alternative to LP UV lamps. Since the 1990s,
MP UV lamps have become more and more popular and the
number of water treatment plants applying MP UV lamps continues
to increase.
However, repair capability of microorganisms via photoreacti-
vation or dark repair is one of the limitations of UV disinfection
technology (Schwartz et al., 2003). DNA repair is a potential
drawback of UV disinfection, which is prevalent among many or-
ganisms such as bacteria (Goosen and Moolenaar, 2008; Hu and
Quek, 2008), cyanobacteria (Levine and Thiel, 1987), plants (Britt,
1996) and can deteriorate the disinfection performance of UV ra-
diation. In addition, several factors have been reported to affect UV
inactivation and repair after inactivation, such as turbidity
(Passantino et al., 2004), salinity (Oguma et al., 2013; Rubio et al.,
2013) and organic matters (Cantwell et al., 2008; Ou et al., 2011).
However, the effects of these factors on the UV inactivation and
repair of microalgae have little been studied, and there could be
difference between algae and bacteria in terms of water quality
effects due to their different cellular sizes and compositions. Given
a different sensitivity to environmental stressors between species
(Liu and Zhang, 2006) and within a species (Gao and Williams,
2013), there is a need for elucidating the effects of several factors
such as turbidity, TOC and salinity on the inactivation and repair of
microalgae for comparison with the previous works. Hence, the
limitations of UV technology such as poor penetration and high
requirements for pretreatment can be better addressed when
treating ballast water.
Microcystis viridis (5 mm in diameter) and Tetraselmis suecica
(9.5 mm in diameter) were selected as indicators of cyanobacteria
and chlorophyta respectively to highlight potential different re-
sponses between species. At present there is no discharge standard
for the majority of bacteria and eukaryotes 10 mm in ballast water.
However, microalgae is very resistant to UV radiation (Holzinger
and Lutz, 2006) and if it is not treated well, algal bloom can
break out, which will cause undesirable odour to the water and
generate algal toxin (Babaran et al., 1998). Hence, the aims of the
present work were to point out the efficiency of MP UV toward
inactivation of M. viridis and T. suecica, and the effects of turbidity,
TOC and salinity on inactivation efficiency and reactivation phe-
nomena for better control of the growth of these two microalgae.
2. Materials and methods
2.1. Microorganisms
M. viridis was obtained from Freshwater and Invasion Biology
Lab (FIBL) and T. suecica was provided by Tropical Marine Science
Institute (TMSI) at National University of Singapore. The cultivation
medium for M. viridis and T. suecica were MLA (Bolch and
Blackburn, 1996) and F2 medium (Guillard and Ryther, 1962),
respectively. These two microalgae were cultured in cell culture
flask on the cultivation shelf at 25 ± 1 C under a photoperiod of
12 h of light and 12 h of dark (12 L:12 D) at 3000e4000 lux.
Log-phase microalgae culture was used to study the UV disin-
fection and repair performance in this study. The cells were
collected by centrifugation (4500 g, 5 min), washed twice with 9 ml
of distilled water, and subsequently suspended in distilled water or
natural or synthetic water under different levels of turbidity, TOC
and salinity, achieving a concentration of approximately 106
cells/
mL.
2.2. UV irradiation experiments
UV irradiation was carried out using the Rayox®
bench-scale
collimated beam apparatus (Model PS1-1-220, Calgon Carbon
Corporation) equipped with a MP (1 kW) UV lamp. 10 mL of the
diluted microalgal suspension was dispensed into a 6 cm diameter
sterile plastic Petri dish and exposed to MP UV radiation. The
investigated UV doses ranged from 25 to 500 mJ/cm2
and were
determined as previously described by Zimmer and Slawson
(2002). Microalgal suspensions were stirred throughout the irra-
diation process. Triplicate 100 mL samples were taken before and
after irradiation for microalgae viability quantification via real-time
polymerase chain reaction (RT-PCR), while the rest of the sample
was covered and used for photoreactivation and dark repair studies.
(i) Turbidity effect study. Kaolin clay (mean particle size:
2.649 mm) with tendency to swell and active surface was chosen as
the representative of inorganic particles and a potential worst
particle for shielding. Generally, the most turbid waters naturally
encountered are in the range of 10e15 NTU (Waite et al., 2003),
whereas the variability in the turbidity of seawater between loca-
tions and over time has been reported in previous studies (2e30
NTU, Desormeaux et al., 2009; 10 NTU, Lauri et al., 2010). There-
fore, UV exposure was performed in three levels of turbid water (1,
10 and 30 NTU) which were obtained by seeding different amount
of kaolin clay to sterile water. Turbidity was measured with HACH
2100N turbidimeter (Hach Co, Loveland, Colo.).
(ii) TOC effect study. Humic substances are one of the principal
organic constituents in natural water with concentrations in the
range of several mg/L to several tens of mg/L (Wang et al., 2012).
The concentration of humic substance in natural water is in the
range of 0.03e30 mg C/L (Shinozuka, 1996). In the present study,
the concentration of humic acid was from 3 to 15 mg/L and within
the limit of 30 mg C/L. Humic acid (Sigma-Aldrich, Switzerland)
stock solution was prepared by stirring the humic acid solution
overnight, and followed by filtration with 0.45 mm membrane. After
that, the solution was diluted to get 3, 6, and 15 mg/L TOC. TOC-VCSH
Total Organic Carbon (TOC) analyzer (Shimadzu, Japan) was
employed to measure TOC of samples.
L. Liu et al. / Chemosphere 163 (2016) 209e216210
3. (iii) Salinity effect study. The effects of salinity on UV inactiva-
tion were studied with artificial seawater (ASW) and natural
seawater (NSW). ASW with 1% and 3% salinity were prepared as
described by Lleo et al. (2005). Two levels of salinity (1% and 3%)
were achieved to represent a hyperosmotic environment of natural
seawater down to a hyposmotic environment of brackish water (Lin
et al., 2003). NSW was taken from the west coast of Singapore and
passed through a 0.45 mm sterile filter (Millipore, Co., USA). Agilent
3200M Multi-Parameter Analyzer (Agilent Technologies Inc., USA)
was used to measure the salinity of samples.
2.3. Photoreactivation and dark repair
Photoreactivation and dark repair were carried out after irra-
diation at a UV dose of 200 mJ/cm2
. For photoreactivation, 10 ml
irradiated microalgal suspensions were magnetically stirred to
ensure that they were well mixed and placed under fluorescent
light using two 24 W fluorescent light lamps (National, Matsushita
Electrical Industrial Co. Ltd, Japan) with an intensity of 6000 lux for
12 h. The light intensity was measured using a digital luxmeter
(Model E2, B. Hagner AB, Sweden). The temperature for the repair
experiments was maintained at 25 ± 1 C. For dark repair, the
samples were kept in the dark and covered with aluminum foil to
avoid light exposure, and other procedures were the same as for
photoreactivation. In the preliminary experiments, 12 h to 7 days
repair performance were compared, and the results showed no
significant difference between different repair periods, and there-
fore 12 h incubation time was used for the photoreactivation and
dark repair studies. To quantify microalgae viability, 100 mL samples
were taken before and after 12 h incubation for RT-PCR.
2.4. RT-PCR
For M. viridis, DNA was isolated and purified by DNeasy Blood
Tissue Kit (Qiagen). For T. suecica, DNA was extracted with DNeasy
Plant Mini Kit (Qiagen) according to the manual. The isolated DNA
was used as a template for RT-PCR reaction with QuantiTech SYBR
Green RT-PCR Kit (Qiagen) using an iCycler™ standard thermo-
cycler (BioRad).
The primers for the RT-PCR were listed in Table 1. For both
M. viridis and T. suecica, 50 mL reaction volumes contained 25 mL of
2ÂQuantiTech SYBR Green Master Mix (Qiagen) and 0.1 mM of each
primer. For M. viridis, amplification was performed as follows:
initial template denaturation (95 C for 10 min); 40 amplification
cycles (94 C for 1 min; 60 C for 1 min; 72 C for 1 min) and a final
extension step (72 C for 10 min). Fluorescence was measured after
72 C of each cycle. For T. suecica, amplification was performed as
follows: initial template denaturation (95 C for 15 min); 40
amplification cycles (94 C for 30 s; 52 C for 30 s; 72 C for 30 s;
78 C for 2 s) and a final extension step (72 C for 10 min). Fluo-
rescence was measured after 72 C of each cycle.
2.5. Data analysis
The Log reduction of the test microorganisms was calculated as:
Log reduction ¼ logðNi=N0Þ (1)
where Ni is the initial concentration of microalgae before UV
disinfection (log cells/mL), and N0 is the concentration of micro-
algae immediately after UV disinfection (log cells/mL).
The % repair of the test microorganisms was calculated as:
repairð%Þ ¼
Nt À N0
Ni À N0
(2)
where Nt is the concentration of microalgae at time of exposure, t,
after UV irradiation (log cells/mL).
All experiments were repeated three times to ensure the validity
and reproducibility of the experimental data. Data were presented
in mean ± standard deviation. One-way ANOVA with post hoc least
significant difference (LSD) was conducted to assess the signifi-
cance of effects of environmental conditions at the significance
level of 0.05.
3. Results and discussion
3.1. UV inactivation of M. viridis and T. suecica
The effects of turbidity, TOC and salinity on log removal of
M. viridis and T. suecica by MP UV disinfection were shown in Fig. 1
and Fig. 2 respectively.
3.1.1. Distilled water
For M. viridis, as shown in Fig. 1A, log reduction values ranged
from 0.7 to 3.3 logs as the UV dose increased from 25 to 500 mJ/cm2
in distilled water (the controls). For T. suecica, UV doses between 25
and 500 mJ/cm2
resulted in about 0.8e4.4 log reduction in distilled
water (the controls) (Fig. 2A). For these two microalgae, at high UV
doses (!100 mJ/cm2
for M. viridis and !300 mJ/cm2
for T. suecica),
the inactivation rate decreased (from 0.0218 to 0.0031 sÀ1
for
M. viridis, and from 0.0148 to 0.0021 sÀ1
for T. suecica) and tailed off,
which was possibly due to shielding or clumping of the cells
(Mamane, 2008). Tailing effect was also observed previously by
Carney (2011), who reported the log reduction of T. suecica was 1.06
log and 0.96 log after irradiated with 1700 and 2200 mJ/cm2
MP UV,
and their lower disinfection efficiency was due to the presence of
suspended particles in the sand filtered seawater.
In terms of the UV sensitivity between these two microalgal
strains, higher UV dose of 400 mJ/cm2
was needed to achieve 3-log
reduction of M. viridis compared to a UV dose of 200 mJ/cm2
to
achieve the same inactivation for T. suecica, revealing that T. suecica
was more UV sensitive than M. viridis. One plausible interpretation
for the lower sensitivity of M. viridis was its smaller size (M. viridis
(5 mm in diameter) and T. suecica (9.5 mm in diameter)) made its
larger surface: volume ratio which sustained greater amount of
damage per unit of DNA and tended to have higher D37 values
(average fluence to kill one cell) indicative of greater UV resistance,
as is the case for Antarctic diatoms (Karentz et al., 1991).
Table 1
List of the RT-PCR primers for qPCR amplification of 16S rRNA gene of M. viridis and 18S rRNA gene of T. suecica.
Strain Primers Sequences (50
/30
) Size of amplicon (bp) Source
M. viridis 16SF GGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAG 1025 Baque et al., 2013
16SR CGGGCGGTGTGTACAAGGCCCGGGAACGTATTCACC 1025
T. suecica 18SF AAACTYAAAGRAATTGACGG 523 Simonelli et al., 2009
18SR GACGGGCGGTGTGTRC 523
L. Liu et al. / Chemosphere 163 (2016) 209e216 211
4. 3.1.2. Turbidity effects
In terms of turbidity effect, it was noted that for M. viridis, at low
UV doses (25e200 mJ/cm2
), lower UV inactivation levels were
obtained when turbidity was higher than 1 NTU (Fig. 1A). However,
when UV dose was increased to 300 mJ/cm2
, the protective effect of
turbidity on M. viridis inactivation efficiency became less notice-
able, indicating that in turbid water, MP UV doses applied should be
increased to obtain the same disinfection performance of M. viridis.
The turbidity affected UV inactivation performance of M. viridis
more at low UV doses than at high UV doses. UV-protective effect
by clay may be covered up by the increase of UV doses, which will
compensate the disinfection effect. Compared with M. viridis,
increased turbidity levels had no consistent influence on the inac-
tivation efficiency of T. suecica at low UV doses (25e100 mJ/cm2
),
whereas hindered MP UV disinfection at high UV doses
(200e500 mJ/cm2
) (Fig. 2A). It seemed that T. suecica was more
resistant than M. viridis with regard to the negative effects of
turbidity on MP UV inactivation performance, which was suspected
Fig. 1. Effects of turbidity (A), TOC (B) and salinity (C) on UV inactivation of M. viridis
by MP UV lamp. Error bars represented standard deviations of three experiments.
ASW: artificial seawater, NSW: natural seawater.
Fig. 2. Effects of turbidity (A), TOC (B) and salinity (C) on UV inactivation of T. suecica
by MP UV lamp. Error bars represented standard deviations of three experiments.
ASW: artificial seawater, NSW: natural seawater.
L. Liu et al. / Chemosphere 163 (2016) 209e216212
5. to be due to the different size of them. The clay's particle size was
about 2.65 mm, which was closer to the size of M. viridis, and hence
affected its UV performance more partly by shielding.
Turbidity affects UV disinfection process in two ways: they may
decrease the UV transmittance of the water and affect delivered
dose or may shield microorganisms from UV light, thus altering the
characteristics of the dose response curve (Passantino et al., 2004).
Gullian et al. (2012) studied the effect of turbidity on the UV
effectiveness of removing heterotrophic bacteria (HB) from two
commercial recirculating aquaculture systems (RAS) and found that
the effectiveness of UV disinfection decreased with increasing
turbidity levels from 8 to 30 NTU. Dehghani et al. (2013) investi-
gated the effect of turbidity on inactivation efficiency of larva and
adult Rhabitidae in municipal water, and reported that following a
LP UV dose of 14.4 mJ/cm2
the increase of turbidity up to 25 NTU
reduced UV inactivation efficiency of larvae and adult nematodes
from 100% to 66% and 64% respectively. In the present study, it was
demonstrated that the presence of turbidity (above 1 NTU)
adversely affected the overall removal of M. viridis at low doses
(25e200 mJ/cm2
) and T. suecica at high doses (200e500 mJ/cm2
)
after MP exposure, which agrees well with the results from Gullian
et al. (2012) and Dehghani et al. (2013).
3.1.3. TOC effects
The log reduction of M. viridis was decreased with the addition
of 3 mg/L or higher TOC when the lower UV doses were applied
(25e200 mJ/cm2
) (Fig. 1B), which was suspected to be due to the
added humic acids. It is well known that humic acids can not only
absorb UV light (Wright and Cairns, 1998), but also act as a reactive
oxygen species (ROS) scavenger (Ou et al., 2011), and thus adding
humic acid may decrease the bactericidal effect of UV. However, at
higher UV doses (200e500 mJ/cm2
), there was no consistent dif-
ference between the log reduction of M. viridis with and without
TOC addition, suggesting that TOC had a negative impact on MP UV
disinfection only at lower UV doses ( 200 mJ/cm2
). It is also known
that organic matters and inorganic ions exposed to UV light can not
only absorb UV light (Wright and Cairns, 1998) but also form rad-
icals (Buschmann et al., 2005). Regarding the results in this study,
humic acids may have been decomposed into radicals after being
irradiated by higher UV doses (200e500 mJ/cm2
), and therefore the
negative impact of TOC on MP UV disinfection was offset by the
radicals which may disinfect microalgae as well.
For T. suecica, the suppressive effect of TOC on UV inactivation
was more significant at higher UV doses (50e500 mJ/cm2
)
compared to that at 25 mJ/cm2
(Fig. 2B). Similar results were re-
ported for bacteria (Escherichia coli and Bacillus subtilis) (Cantwell
et al., 2008). The study by Cantwell et al. (2008) showed that
Aldrich humic acid (AHA) and Suwannee River natural organic
matter (SRNOM) were found to offer statistically significant pro-
tection of both E. coli and B. subtilis at a high UV dose. The plausible
interpretation is associated with the interaction between humic
matter and the bacterial surfaces. Further investigation is needed to
better understand the potential for a humic coating phenomenon.
Different inactivation behaviors of T. suecica at higher UV doses
with TOC compared with M. viridis may be related with the larger
size of T. suecica (9.5 mm in diameter) which may increase tolerance
to the disinfected radicals.
3.1.4. Salinity effects
For M. viridis, lower log reduction levels were observed at
salinity levels above 1%. However, the detrimental influence of
salinity on M. viridis survival was less pronounced at higher salinity
(3%) than at lower salinity (1%) (Fig. 1C). M. viridis as freshwater
blue-green algae is considered non-halophile because this organ-
ism can tolerate low saline concentrations and the growth of
M. viridis normally decreases with the increase of salt concentra-
tion. However, in this study, higher salt concentrations (1e3%) may
affect positively the osmotic forces at the membrane level and
generate more favorable conditions for M. viridis, making them less
vulnerable against the UV light (Nygard and Ekelund, 2006). Such
adverse impact of salinity on UV inactivation has been reported by
Rubio et al. (2013) in which the disinfection efficiency of E. coli by
UV radiation was decreased when increasing the solution salt
concentration.
For T. suecica, compared with the log removal in distilled water
at MP UV doses higher than 200 mJ/cm2
, significant inhibitory ef-
fects of salinity were found in 1% ASW, whereas the suppressive
effect of salinity on UV inactivation was observed in 3% ASW at 50
and 200 mJ/cm2
and 3% NSW at 100e300 mJ/cm2
(Fig. 2C).
3.2. Photoreactivation and dark repair of M. viridis and T. suecica
after UV disinfection
The effects of turbidity, TOC and salinity on the photoreactiva-
tion and dark repair of M. viridis and T. suecica for 12 h after 200 mJ/
cm2
of UV treatment were shown in Figs. 3 and 4 respectively.
3.2.1. Turbidity effects
In our hypothesis, high turbidity may decrease the intensity of
photoreactivating light delivered to targeted organisms, thus
inhibiting photoreactivation. This hypothesis has been confirmed
by the findings of repressive effects of turbidity on the achieved
photoreactivation after MP UV exposure for T. suecica, although the
correlation between turbidity and photoreactivation was not sta-
tistically significant, which was in line with previous studies
(Lindenauer and Darby, 1994). However, photoreactivation levels of
M. viridis did not change with increasing turbidity. As shown in
Figs. 3A and 4A, it is evident that for these two microalgae, dark
repair levels were consistently much lower than those of photo-
reactivation in both distilled water and turbid water in the range of
1e30 NTU (except for 30 NTU case for T. suecica). Dark repair did not
occur for T. suecica in distilled water. For M. viridis, the effect of
turbidity on dark repair was negligible when turbidity was higher
than 1 NTU. The cells number of T. suecica was decreased during
incubation in the dark after MP UV disinfection at turbidity of 1
NTU, indicating that dark repair was even more suppressed. Lower
dark repair (not significantly different) levels were observed in the
presence of turbidity (10 and 30 NTU) compared to those in
distilled water. Based on the results, it seemed that photoreacti-
vation of M. viridis and T. suecica may potentially occur in low
turbidity water, whereas the effect of turbidity on the dark repair
levels was however dependent upon species of microalgae.
3.2.2. TOC effects
For M. viridis, 3 mg/L of TOC did not induce a significant differ-
ence in the extent of photoreactivation and dark repair, whereas
6 mg/L or higher TOC resulted in 6e25% higher repair levels after
12 h fluorescence light exposure and in the dark compared with
those in distilled water (Fig. 3B). The stimulated cells repair was
suspected to be due to the removal of cyclobutane pyrimidine di-
mers (CPDs). CPDs were reported to be the most abundant photo-
product, accounting for ~75% of the damaged DNA (Sakai et al.,
2007). To verify such a hypothesis, an ELISA assay was used to
determine the accumulation of CPDs, and the results were shown in
Fig. S1. After 12 h of incubation with or without light following MP
UV exposure, more CPDs were repaired as TOC increased, indicating
that M. viridis was mainly repaired through the CPDs repairing
processes, not via DNA damage tolerance mechanisms, namely
translesion DNA synthesis (TLS) (Lv et al., 2013). The humic acids or
other organic chemicals may stimulate CPDs repair by inducing the
L. Liu et al. / Chemosphere 163 (2016) 209e216 213
6. activity of the enzyme in the DNA repair process (Farre et al., 2013).
Therefore, the TOC content of ballast water should be decreased
before it passes through UV disinfection unit in actual operation.
An inverse relationship between TOC (3e15 mg/L) and photo
repair levels was observed for T. suecica. There was no significant
change in dark repair levels with increased TOC (3e15 mg/L)
(Fig. 4B). No correlation between repaired CPDs and cell numbers
was found after exposure to light or in the dark (Fig. S2), which
indicated that for T. suecica, there may be other mechanisms such as
the effect of TOC on the responses of photosynthetic system, given
that it has been reported that T. suecica is capable of repairing its
UV-damaged photosynthetic system (Park and Han, 2009), which
needs further evaluation.
3.2.3. Salinity effects
As shown in Fig. 3C, for M. viridis, it seems there is no obvious
trend or correlation between salinity and levels of photoreactiva-
tion and dark repair, implying that photo and dark repair levels are
independent of salinity. However, in terms of T. suecica, as the
salinity increased, the log repair decreased after 12 h incubation
with or without light (Fig. 4C).
The repressive effect of salinity on photoreactivation has been
reported in previous studies. Chan and Killick (1995) found that the
photoreactive capability of E. coli declined sharply above more than
30% in synthetic seawater (0.9%) and leveled off at 70% of the
maximum salinity (2.1%). Additionally, Baron and Bourbigot (1996)
also observed that when the salinity of effluent reached an average
of 2.4% after 3 h incubation, the photo repair rates of E. coli were
very low and no repair was observed for enterococci. Hence, they
Fig. 3. Effects of turbidity (A), TOC (B) and salinity (C) on 12 h photoreactivation and
dark repair of M. viridis with a MP UV dose of 200 mJ/cm2
. ASW: artificial seawater,
NSW: natural seawater.
Fig. 4. Effects of turbidity (A), TOC (B) and salinity (C) on 12 h photoreactivation and
dark repair of T. suecica with a MP UV dose of 200 mJ/cm2
. ASW: artificial seawater,
NSW: natural seawater.
L. Liu et al. / Chemosphere 163 (2016) 209e216214
7. concluded that photoreactivation would not pose high risk in ma-
rine water environment. Oguma et al. (2013) reported that photo-
reactivation of E. coli was significantly suppressed in NaCl solution
at 2.4% or higher salinity but not affected in NaCl solution at 1.9% or
lower salinity. However, in this study, such inhibitory effects on
photoreactivation were not found in M. viridis, which has not been
studied prior to our knowledge, and the reason underneath needs
to be further explored. This study also revealed that the effect of
salinity on dark repair seemed to be related with species of
microalgae. It can be inferred that M. viridis in UV-treated ballast
water may possess a potential risk by performing photoreactivation
and dark repair after being discharged to brackish water or
seawater, whereas high salinity can suppress the occurrence of
photoreactivation and dark repair for T. suecica.
4. Conclusions
In conclusion, T. suecica was more sensitive to UV inactivation
than M. viridis, and tailing effect occurred at high UV doses for both
of them. After 12 h light repair following 200 mJ/cm2
UV treatment,
28.9% of M. viridis and 4.9% of T. suecica were reactivated. M. viridis
exhibited dark repair after MP UV exposure, although it was less
(5.3%) than that of photo repair, whereas dark repair did not occur
for T. suecica. In general, the repressive effect of turbidity and TOC
on the inactivation of these two organisms was found to be more
significant at low doses (25e200 mJ/cm2
) for M. viridis and high
doses (200e500 mJ/cm2
) for T. Suecica, respectively. Salinity had a
more profound detrimental effect on M. viridis than T. suecica. In
term of photoreactivation and dark repair, for M. viridis, the effects
of turbidity and salinity were less significant, whereas high TOC
levels (6e15 mg/L) could promote photoreactivation and dark
repair. For T. suecica, increased levels of these three factors pre-
vented the photoreactivation, and no dark repair was observed
across a range of turbidity (1, 10, 30 NTU), TOC (3, 6, 15 mg/L) and
salinity (1%, 3%). Ballast water turbidity, TOC and salinity should be
decreased before it passes through MP UV disinfection unit in
actual operation to better control the growth of microalgae. Results
of this study provide significant implications for the management
of public health associated with ballast water treatment and
discharge, and can also be applied in water quality monitoring of
seawater and freshwater aquaculture. Further mechanism studies
such as the association of UV-induced DNA damage and photo-
synthetic capacity with cell number reduction should be conducted
for better understanding the effect of environmental factors on the
inactivation/reactivation of microalgae.
Acknowledgments
This study was supported by the Economic Development Board
(SPORE, COY-15-EWI-RCFSA/N197-1) and the Maritime and Port
Authority of Singapore (MPA) (R-706-000-028-490).
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.chemosphere.2016.08.027.
References
Babaran, R.P., Espinosa, R.A., Abalos, T.U., 1998. Initiating and triggering mechanisms
causing harmful algal blooms. J. Shellfish Res. 17, 1623e1626.
Baque, M., Viaggiu, E., Scalzi, G., Billi, D., 2013. Endurance of the endolithic desert
cyanobacterium Chroococcidiopsis under UVC radiation. Extremophiles 17,
161e169.
Baron, J., Bourbigot, M.M., 1996. Repair of Escherichia coli and enterococci in sea
water after ultraviolet disinfection quantification using diffusion chambers.
Water Res. 30, 2817e2821.
Bolch, C.J.S., Blackburn, S.I., 1996. Isolation and purification of Australian isolates of
the toxic cyanobacterium Microcystis aeruginosa Kutz. J. Appl. Phycol. 8, 5e13.
Britt, A.B., 1996. DNA damage and repair in plants. Ann. Rev. Plant. Physiol. Mol. Biol.
47, 75e100.
Buschmann, J., Canonica, S., Lindauer, U., Hug, S.J., Sigg, L., 2005. Photoirradiation of
dissolved humic acid induces arsenic(III) oxidation. Environ. Sci. Technol. 39,
9541e9546.
Cantwell, R.E., Hofmann, R., Templeton, M.R., 2008. Interactions between humic
matter and bacteria when disinfecting water with UV light. J. Appl. Microbiol.
105, 25e35.
Carney, K., 2011. Marine bioinvasion Prevention: Understanding Ballast Water
Transportation Conditions and the Development of Effective Treatment Sys-
tems. Doctoral dissertation. Newcastle University, UK.
Chan, Y.Y., Killick, E.G., 1995. The effect of salinity, light and temperature in a
disposal environment on the recovery of E. coli following exposure to ultraviolet
radiation. Water Res. 29, 1373e1377.
Dehghani, M.H., Jahed, G.-R., Zarei, A., 2013. Investigation of low-pressure ultravi-
olet radiation on inactivation of Rhabitidae nematode from water. Iran. J. Public
Health 42, 314e319.
Desormeaux, et al., 2009. Comparing biological filtration and ultrafiltration pre-
treatment for seawater desalination. In: Proceedings of AWWA Membrane
Technology Conference, March 2009.
Farre, M.J., Day, S., Neale, P.A., Stalter, D., Tang, J.Y.M., Escher, B.I., 2013. Bioanalytical
and chemical assessment of the disinfection by-product formation potential:
role of organic matter. Water Res. 47, 5409e5421.
Gao, W., Williams, A., 2013. Response of different strains of Enterococcus faecalis to
UV inactivation after freezing. Int. J. Environ. Sci. Dev. 255e257.
Goosen, N., Moolenaar, G.F., 2008. Repair of UV damage in bacteria. DNA Repair 7,
353e379.
Guillard, R.R., Ryther, J.H., 1962. Studies of marine planktonic diatoms. I. Cyclotella
nana Hustedt, and Detonula confervacea (cleve) Gran. Can. J. Microbiol. 8,
229e239.
Gullian, M., Espinosa-Faller, F.J., Nunez, A., Lopez-Barahona, N., 2012. Effect of
turbidity on the ultraviolet disinfection performance in recirculating aquacul-
ture systems with low water exchange. Aquac. Res. 43, 595e606.
Guo, H.L., Chu, X.N., Hu, J.Y., 2010. Effect of host cells on low- and medium-pressure
UV inactivation of adenoviruses. Appl. Environ. Microb. 76, 7068e7075.
Hallegraeff, G.M., 2015. Transport of harmful marine microalgae via ship's ballast
water: management and mitigation with special reference to the Arabian Gulf
region. Aquatic Ecosyst. Health Manag. 18, 290e298.
Hijnen, W.A.M., Beerendonk, E.F., Medema, G.J., 2006. Inactivation credit of UV ra-
diation for viruses, bacteria and protozoan (oo)cysts in water: a review. Water
Res. 40, 3e22.
Holzinger, A., Lutz, C., 2006. Algae and UV irradiation: effects on ultrastructure and
related metabolic functions. Micron 37, 190e207.
Hu, J.Y., Quek, P.H., 2008. Effects of UV radiation on photolyase and implications
with regards to photoreactivation following low- and medium-pressure UV
disinfection. Appl. Environ. Microb. 74, 327e328.
Karentz, D., Cleaver, J.E., Mitchell, D.L., 1991. Cell-survival characteristics and mo-
lecular responses of antarctic phytoplankton to ultraviolet-B radiation. J. Phycol.
27, 326e341.
Kim, Y., Aw, T.G., Teal, T.K., Rose, J.B., 2015. Metagenomic investigation of viral
communities in ballast water. Environ. Sci. Technol. 49, 8396e8407.
Levine, E., Thiel, T., 1987. UV-inducible DNA repair in the cyanobacteria Anabaena
spp. J. Bacteriol. 169, 3988e3993.
Lin, Y.M., Chen, C.N., Lee, T.H., 2003. The expression of gill Na, K-ATPase in milkfish,
Chanos chanos, acclimated to seawater, brackish water and fresh water. Comp.
Biochem. Physiol. A Mol. Integr. Physiol. 135, 489e497.
Lauri, et al., 2010. Comprehensive results of west basin municipal water district's
ocean water desalination pilot program. In: Proceedings Annual WaterReuse
Symposium, Seattle, WA.
Lindenauer, K.G., Darby, J.L., 1994. Ultraviolet disinfection of wastewater: effect of
dose on subsequent photoreactivation. Water Res. 28, 805e817.
Liu, W., Zhang, Y.J., 2006. Effects of UV intensity and water turbidity on microbial
indicator inactivation. J. Environ. Sci. China 18, 650e653.
Lleo, M.D., Bonato, B., Benedetti, D., Canepari, P., 2005. Survival of enterococcal
species in aquatic environments. Fems Microbiol. Ecol. 54, 189e196.
Lloyd's Register Report, 2010. Ballast Water Treatment Technology. Current Status.
February 2010, third ed., pp. 7e35
Lv, L., Wang, F., Ma, X., Yang, Y., Wang, Z., Liu, H., Li, X., Liu, Z., Zhang, T., Huang, M.,
Friedberg, E.C., Tang, T.-S., Guo, C., 2013. Mismatch repair protein MSH2 regu-
lates translesion DNA synthesis following exposure of cells to UV radiation.
Nucleic. acids. Res. 41, 10312e10322.
Malley Jr., J.P., 1999. Control of disinfection by-product formation using ultraviolet
light. In: Singer, P.C. (Ed.), Formation and Control of Disinfection By-products in
Drinking Water. American Water Works Association, USA.
Mamane, H., 2008. Impact of particles on UV disinfection of water and wastewater
effluents: a review. Rev. Chem. Eng. 24, 67e157.
Masschelein, W.J., 2002. In: Rice, R.G. (Ed.), Ultraviolet Light in Water and Waste-
water Sanitation. Lewis Publishers, Boca Raton, London.
McCarthy, S., Khambaty, F., 1994. International dissemination of epidemic Vibrio
cholerae by cargo ship ballast and other nonpotable waters. Appl. Environ.
Microb. 60, 2597e2601.
Nygard, C.A., Ekelund, N.G.A., 2006. Photosynthesis and UV-B tolerance of the
L. Liu et al. / Chemosphere 163 (2016) 209e216 215
8. marine alga Fucus vesiculosus at different sea water salinities. J. Appl. Phycol. 18,
461e467.
Oguma, K., Izaki, K., Katayama, H., 2013. Effects of salinity on photoreactivation of
Escherichia coli after UV disinfection. J. Water Health 11, 457e464.
Ou, H., Gao, N., Deng, Y., Wang, H., Zhang, H., 2011. Inactivation and degradation of
Microcystis aeruginosa by UV-C irradiation. Chemosphere 85, 1192e1198.
Park, J.S., Han, T., 2009. The effect of UV-B on photosynthesis and motility of marine
phytoplankton, Tetraselmis suecica. Phycologia 48, 102e102.
Passantino, L., Malley Jr., J., Knudson, M., Ward, R., Kim, J., 2004. Effect of low
turbidity and algae on UV disinfection performance. J. Am. Water Works Assoc.
96, 128e137.
Raikow, D.F., Reid, D.F., Blatchley, E.R., Jacobs, G., Landrum, P.F., 2007. Effects of
proposed physical ballast tank treatments on aquatic invertebrate resting eggs.
Environ. Toxicol. Chem. 26, 717e725.
Rubio, D., Nebot, E., Casanueva, J.F., Pulgarin, C., 2013. Comparative effect of simu-
lated solar light, UV, UV/H2O2 and photo-Fenton treatment (UV-Vis/H2O2/
Fe2þ,3þ
) in the Escherichia coli inactivation in artificial seawater. Water Res. 47,
6367e6379.
Sakai, H., Oguma, K., Katayama, H., Ohgaki, S., 2007. Effects of low- or medium-
pressure ultraviolet lamp irradiation on Microcystis aeruginosa and Anabaena
variabilis. Water Res. 41, 11e18.
Schwartz, T., Hoffmann, S., Obst, U., 2003. Formation of natural biofilms during
chlorine dioxide and u.v. disinfection in a public drinking water distribution
system. J. Appl. Microbiol. 95, 591e601.
Shinozuka, N., 1996. The global environment and analyses isolation and
characterization of aquatic humic substances. Kikan Kagaku Sosetsu 29, 73e83.
Simonelli, P., Troedsson, C., Nejstgaard, J.C., Zech, K., Larsen, J.B., Frischer, M.E., 2009.
Evaluation of DNA extraction and handling procedures for PCR-based copepod
feeding studies. J. Plankton. Res. 31, 1465e1474.
Sutherland, T.F., Levings, C.D., Elliott, C.C., Hesse, W.W., 2001. Effect of a ballast
water treatment system on survivorship of natural populations of marine
plankton. Mar. Ecol. Prog. Ser. 210, 139e148.
Tao, Y., Mao, X., Hu, J., Mok, H.O.L., Wang, L., Au, D.W.T., Zhu, J., Zhang, X., 2013.
Mechanisms of photosynthetic inactivation on growth suppression of Micro-
cystis aeruginosa under UV-C stress. Chemosphere 93, 637e644.
Tsolaki, E., Diamadopoulos, E., 2010. Technologies for ballast water treatment: a
review. J. Chem. Technol. Biot. 85, 19e32.
Waite, T.D., Kazumi, J., Lane, P.V.Z., Farmer, L.L., Smith, S.G., Smith, S.L., Hitchcock, G.,
Cap, T.R., 2003. Removal of natural populations of marine plankton by a large-
scale ballast water treatment system. Mar. Ecol. Prog. Ser. 258, 51e63.
Wang, C.Y., Zhu, L.Y., Wei, M.C., Chen, P., Shan, G.Q., 2012. Photolytic reaction
mechanism and impacts of coexisting substances on photodegradation of
bisphenol A by Bi2WO6 in water. Water Res. 46, 845e853.
Wright, H.B., Cairns, W.L., 1998. In: “Ultraviolet Light,” Regional Symposium on
Water Quality: Effective Disinfection. CEPIS OPS, Lima, pp. 1e26. http://www.
bvsde.paho.org/bvsacg/i/fulltext/symposium/ponen10.pdf.
Zimmer, J.L., Slawson, R.M., 2002. Potential repair of Escherichia coli DNA following
exposure to UV radiation from both medium- and low-pressure UV sources
used in drinking water treatment. Appl. Environ. Microb. 68, 3293e3299.
L. Liu et al. / Chemosphere 163 (2016) 209e216216