CS 201 Assignment #5: Synchronization and Deadlocks
Assigned Wednesday, 10/24; due Monday, 11/5 at 11:59 pm.
Implement the Dining Philosophers.
Part I: in a naive fashion, in order to cause a deadlock
Part II: in a way that prevents deadlocks
Here are the dining philosophers:
philosopher 1
philosopher 2 philosopher 3
philosopher 4
philosopher 0
fork 0fork 1
fork 2
fork 3
fork 4
food
The processing is like this:
each philosopher picks up his left fork
each philosopher picks up his right fork
he eats for EAT_TIME
he puts down his left fork
he puts down his right fork
he thinks for THINK_TIME
And all five philosophers do this simultaneously. So for a Linux implementation, we can put each
philosopher in a separate pthread.
Here are some constants for your program:
#define NUM_PHILOSOPHERS 5
#define RUNTIME 10
#define EAT_TIME 2
#define THINK_TIME 1
Here's a global variable -- the array of forks (which are mutex locks):
pthread_mutex_t forks[NUM_PHILOSOPHERS];
The basic idea is to create NUM_PHILOSOPHERS pthreads, by calling pthread_create() five times.
1
Each philosopher function will look like this:
void *philosopher(void *param);
and the param will be a pointer to an integer value in the range 0..NUM_PHILOSOPHERS-1, which
will uniquely identify the thread.
Here's the processing inside the philosopher function:
int *myID;
myID = (int *) param;
leftIdx = *myID;
rightIdx = (*myID + 1) % NUM_PHILOSOPHERS;
printf("P %d start\n", *myID);
while ( 1 ) {
pthread_mutex_lock(&(forks[leftIdx]));
usleep(1000);
pthread_mutex_lock(&(forks[rightIdx]));
printf("P %d, eating for %d secs\n", *myID, EAT_TIME);
sleep(EAT_TIME);
pthread_mutex_unlock(&(forks[leftIdx]));
pthread_mutex_unlock(&(forks[rightIdx]));
printf("P %d, thinking for %d secs\n", *myID, THINK_TIME);
sleep(THINK_TIME);
}
The usleep(1000) says "sleep for 1000 microseconds" (i.e., 1 millisecond). This gives all of the
philopher threads the chance to pick up their left fork when they first start, thus increasing the
chances of deadlock.
There is no true or TRUE constant in C. That's why I have "while ( 1 )".
Initialize the mutexes like this:
int rtnval;
for (i=0; i<NUM_PHILOSOPHERS; ++i) {
rtnval = pthread_mutex_init(&(forks[i]), NULL);
if (rtnval != 0) {
printf("error initializing mutex\n");
return(8);
}
}
Start each philosopher thread as you did in the multithreaded sorting assignment:
int id[NUM_PHILOSOPHERS];
thread_t tid[NUM_PHILOSOPHERS];
for (i=0; i<NUM_PHILOSOPHERS; ++i) {
id[i] = i;
pthread_create(&(tid[i]), &attr, philosopher_good_2, &(id[i]));
}
2
and then sleep for RUNTIME seconds.
After that, kill the threads:
for (i=0; i<NUM_PHILOSOPHERS; ++i) {
pthread_kill(tid[i], 0);
}
Part I
Build out the rest of the code to implement this. When you run it, you should see a deadlock.
Here's what I get when I run:
$ a.out
P 0 start
P 3 start
P 2 start
P 4 start
P 1 start
(and then it just sits the.
The document summarizes several management theories and theorists:
1. Frederick Taylor's Principles of Scientific Management focused on efficiency, identifying the "one best way" to complete tasks, and using time and motion studies.
2. Elton Mayo's Hawthorne Studies found that social and emotional factors like recognition and participation impacted productivity more than physical working conditions.
3. Frank and Lillian Gilbreth's motion and time studies identified ways to reduce unnecessary motions and find the most efficient ways to complete tasks.
4. Douglas McGregor proposed Theory X and Theory Y, with Theory X assuming employees dislike work and Theory Y assuming work can be satisfying.
The document summarizes the Technology Acceptance Model (TAM) and Technology-Organization-Environment (TOE) framework for understanding technology adoption. TAM models how users come to accept new technologies based on perceived usefulness and ease of use. It is built on expectancy-value theory and the theory of reasoned action. TOE framework examines how three contexts - technological, organizational, and environmental - influence organizations' decisions to adopt innovations. The document provides details on the key constructs of each model and examples of how they have been applied to study different technologies and industries.
Prosepctus employee retention wilfred brown_finalWilfred Brown
This document outlines a study that examined the relationship between employee perceived external prestige and employee retention. The study surveyed 50,000 employees across multiple industries and companies. It found that approximately 41% of respondents mentioned prestige as a reason for staying with their employer. The study provides insights for human resource professionals and company leaders seeking to improve employee retention. It suggests that enhancing a company's external prestige through marketing and branding may positively impact an employee's desire to remain with the organization.
Prosepctus employee retention wilfred brown_finalWilfred Brown
This document outlines a study that examined the relationship between employee perceived external prestige and employee retention. The study surveyed 50,000 employees across multiple industries and companies. It found that approximately 41% of respondents mentioned prestige as a reason for staying with their employer. The study provides insights for human resource professionals and company leaders seeking to improve employee retention. It suggests that enhancing a company's external prestige through marketing and branding may positively impact an employee's desire to remain with the organization.
1. The relationship between wages and productivity is complex, depending on factors like time horizon, market structure, and wage-setting mechanisms. In the short-run, standard theory suggests wages correspond to marginal productivity, but efficiency wage models reject this.
2. In the medium-run, bargained wages may differ from warranted wages due to changes in other factor prices, potentially leading to unemployment. Real and nominal wage rigidities also affect realignment of wages and productivity.
3. In the long-run, endogenous growth theory suggests moderate wage increases may not necessarily increase employment if technological change depends on capital investment influenced by wages.
IHP 501 Final Project Two Milestone One Guidelines and Rubr.docxadkinspaige22
IHP 501 Final Project Two Milestone One Guidelines and Rubric
Policy Proposal and Interview
Overview: Health professionals should be familiar with existing policies related to health, recognize when policy initiatives are necessary, and advocate for or
against policies being proposed or currently in place.
Prompt: Begin this assignment by selecting a state, national, or international healthcare policy and briefly describing it.
When choosing your policy, remember the focus of the assignment is to identify a legal or governmental healthcare policy, which is different from an
organizational (e.g., hospital) policy. To clarify, an organization like a hospital may have developed a “care of a central line policy” specific to that particular
organization, but the Patient Protection and Affordable Care Act is an example of a legal or governmental policy that all individuals and organizations, regardless
of function, must observe.
After identifying a legal or governmental healthcare policy for analysis, develop a narrative that explains why you chose the selected policy, lists three key
stakeholders you would like to interview about the policy, and explains how each individual is related to or affected by the policy. Your instructor will approve
your policy and interview suggestions for use in your final project.
Specifically, the following critical elements must be addressed:
Summarize the policy that is the focus of your evaluation. Include the name, its purpose, and when it was created.
Explain your rationale for choosing the policy. Does it have personal or professional relevance?
Identify at least three stakeholders of the policy that you might interview, and discuss how they are affected by or related to the policy.
Rubric
Guidelines for Submission: Your paper must be a 1- to 2-page (not including title and reference pages) Microsoft Word document with 12-point Times New
Roman font, double spacing, and use of the most recent APA standards for formatting and referencing. Include a minimum of three peer-reviewed sources.
Critical Elements Proficient (100%) Needs Improvement (75%) Not Evident (0%) Value
Policy Summarizes the policy that is the focus of the
evaluation, including the purpose of the policy,
its scope and main points, its stakeholders and
constituents, and its relation to other policies
(if applicable)
Summarizes the policy that is the focus of the
evaluation, including the purpose of the policy,
its scope and main points, its stakeholders and
constituents, and its relation to other policies
(if applicable), but summary is missing key
elements, is cursory, or contains inaccuracies
Does not summarize the policy that is the focus
of the evaluation
20
Rationale Explains rationale for choosing the policy Explains rationale for choosing the policy, but
explanation is cursory or illogical or
unsupported or contains inaccuracies
Does not explain the rationale .
IHP 501 Final Project Two Milestone One Guidelines and Rubr.docxShiraPrater50
IHP 501 Final Project Two Milestone One Guidelines and Rubric
Policy Proposal and Interview
Overview: Health professionals should be familiar with existing policies related to health, recognize when policy initiatives are necessary, and advocate for or
against policies being proposed or currently in place.
Prompt: Begin this assignment by selecting a state, national, or international healthcare policy and briefly describing it.
When choosing your policy, remember the focus of the assignment is to identify a legal or governmental healthcare policy, which is different from an
organizational (e.g., hospital) policy. To clarify, an organization like a hospital may have developed a “care of a central line policy” specific to that particular
organization, but the Patient Protection and Affordable Care Act is an example of a legal or governmental policy that all individuals and organizations, regardless
of function, must observe.
After identifying a legal or governmental healthcare policy for analysis, develop a narrative that explains why you chose the selected policy, lists three key
stakeholders you would like to interview about the policy, and explains how each individual is related to or affected by the policy. Your instructor will approve
your policy and interview suggestions for use in your final project.
Specifically, the following critical elements must be addressed:
Summarize the policy that is the focus of your evaluation. Include the name, its purpose, and when it was created.
Explain your rationale for choosing the policy. Does it have personal or professional relevance?
Identify at least three stakeholders of the policy that you might interview, and discuss how they are affected by or related to the policy.
Rubric
Guidelines for Submission: Your paper must be a 1- to 2-page (not including title and reference pages) Microsoft Word document with 12-point Times New
Roman font, double spacing, and use of the most recent APA standards for formatting and referencing. Include a minimum of three peer-reviewed sources.
Critical Elements Proficient (100%) Needs Improvement (75%) Not Evident (0%) Value
Policy Summarizes the policy that is the focus of the
evaluation, including the purpose of the policy,
its scope and main points, its stakeholders and
constituents, and its relation to other policies
(if applicable)
Summarizes the policy that is the focus of the
evaluation, including the purpose of the policy,
its scope and main points, its stakeholders and
constituents, and its relation to other policies
(if applicable), but summary is missing key
elements, is cursory, or contains inaccuracies
Does not summarize the policy that is the focus
of the evaluation
20
Rationale Explains rationale for choosing the policy Explains rationale for choosing the policy, but
explanation is cursory or illogical or
unsupported or contains inaccuracies
Does not explain the rationale ...
This document discusses the concept of rating in time study. It defines rating as the assessment of a worker's rate of working relative to the observer's concept of the standard rate. The standard rate is equivalent to walking at 4 miles per hour without a load, which is considered a brisk but sustainable pace.
The document also discusses the concept of the average or standard worker. While no single worker is truly average, a large group of workers on a task will follow a normal distribution curve in their performance times. The time taken by the worker in the largest group is considered the average.
Setting the standard time is aimed at a time that is achievable by the average qualified worker over a full shift with adequate motivation, without
The document summarizes several management theories and theorists:
1. Frederick Taylor's Principles of Scientific Management focused on efficiency, identifying the "one best way" to complete tasks, and using time and motion studies.
2. Elton Mayo's Hawthorne Studies found that social and emotional factors like recognition and participation impacted productivity more than physical working conditions.
3. Frank and Lillian Gilbreth's motion and time studies identified ways to reduce unnecessary motions and find the most efficient ways to complete tasks.
4. Douglas McGregor proposed Theory X and Theory Y, with Theory X assuming employees dislike work and Theory Y assuming work can be satisfying.
The document summarizes the Technology Acceptance Model (TAM) and Technology-Organization-Environment (TOE) framework for understanding technology adoption. TAM models how users come to accept new technologies based on perceived usefulness and ease of use. It is built on expectancy-value theory and the theory of reasoned action. TOE framework examines how three contexts - technological, organizational, and environmental - influence organizations' decisions to adopt innovations. The document provides details on the key constructs of each model and examples of how they have been applied to study different technologies and industries.
Prosepctus employee retention wilfred brown_finalWilfred Brown
This document outlines a study that examined the relationship between employee perceived external prestige and employee retention. The study surveyed 50,000 employees across multiple industries and companies. It found that approximately 41% of respondents mentioned prestige as a reason for staying with their employer. The study provides insights for human resource professionals and company leaders seeking to improve employee retention. It suggests that enhancing a company's external prestige through marketing and branding may positively impact an employee's desire to remain with the organization.
Prosepctus employee retention wilfred brown_finalWilfred Brown
This document outlines a study that examined the relationship between employee perceived external prestige and employee retention. The study surveyed 50,000 employees across multiple industries and companies. It found that approximately 41% of respondents mentioned prestige as a reason for staying with their employer. The study provides insights for human resource professionals and company leaders seeking to improve employee retention. It suggests that enhancing a company's external prestige through marketing and branding may positively impact an employee's desire to remain with the organization.
1. The relationship between wages and productivity is complex, depending on factors like time horizon, market structure, and wage-setting mechanisms. In the short-run, standard theory suggests wages correspond to marginal productivity, but efficiency wage models reject this.
2. In the medium-run, bargained wages may differ from warranted wages due to changes in other factor prices, potentially leading to unemployment. Real and nominal wage rigidities also affect realignment of wages and productivity.
3. In the long-run, endogenous growth theory suggests moderate wage increases may not necessarily increase employment if technological change depends on capital investment influenced by wages.
IHP 501 Final Project Two Milestone One Guidelines and Rubr.docxadkinspaige22
IHP 501 Final Project Two Milestone One Guidelines and Rubric
Policy Proposal and Interview
Overview: Health professionals should be familiar with existing policies related to health, recognize when policy initiatives are necessary, and advocate for or
against policies being proposed or currently in place.
Prompt: Begin this assignment by selecting a state, national, or international healthcare policy and briefly describing it.
When choosing your policy, remember the focus of the assignment is to identify a legal or governmental healthcare policy, which is different from an
organizational (e.g., hospital) policy. To clarify, an organization like a hospital may have developed a “care of a central line policy” specific to that particular
organization, but the Patient Protection and Affordable Care Act is an example of a legal or governmental policy that all individuals and organizations, regardless
of function, must observe.
After identifying a legal or governmental healthcare policy for analysis, develop a narrative that explains why you chose the selected policy, lists three key
stakeholders you would like to interview about the policy, and explains how each individual is related to or affected by the policy. Your instructor will approve
your policy and interview suggestions for use in your final project.
Specifically, the following critical elements must be addressed:
Summarize the policy that is the focus of your evaluation. Include the name, its purpose, and when it was created.
Explain your rationale for choosing the policy. Does it have personal or professional relevance?
Identify at least three stakeholders of the policy that you might interview, and discuss how they are affected by or related to the policy.
Rubric
Guidelines for Submission: Your paper must be a 1- to 2-page (not including title and reference pages) Microsoft Word document with 12-point Times New
Roman font, double spacing, and use of the most recent APA standards for formatting and referencing. Include a minimum of three peer-reviewed sources.
Critical Elements Proficient (100%) Needs Improvement (75%) Not Evident (0%) Value
Policy Summarizes the policy that is the focus of the
evaluation, including the purpose of the policy,
its scope and main points, its stakeholders and
constituents, and its relation to other policies
(if applicable)
Summarizes the policy that is the focus of the
evaluation, including the purpose of the policy,
its scope and main points, its stakeholders and
constituents, and its relation to other policies
(if applicable), but summary is missing key
elements, is cursory, or contains inaccuracies
Does not summarize the policy that is the focus
of the evaluation
20
Rationale Explains rationale for choosing the policy Explains rationale for choosing the policy, but
explanation is cursory or illogical or
unsupported or contains inaccuracies
Does not explain the rationale .
IHP 501 Final Project Two Milestone One Guidelines and Rubr.docxShiraPrater50
IHP 501 Final Project Two Milestone One Guidelines and Rubric
Policy Proposal and Interview
Overview: Health professionals should be familiar with existing policies related to health, recognize when policy initiatives are necessary, and advocate for or
against policies being proposed or currently in place.
Prompt: Begin this assignment by selecting a state, national, or international healthcare policy and briefly describing it.
When choosing your policy, remember the focus of the assignment is to identify a legal or governmental healthcare policy, which is different from an
organizational (e.g., hospital) policy. To clarify, an organization like a hospital may have developed a “care of a central line policy” specific to that particular
organization, but the Patient Protection and Affordable Care Act is an example of a legal or governmental policy that all individuals and organizations, regardless
of function, must observe.
After identifying a legal or governmental healthcare policy for analysis, develop a narrative that explains why you chose the selected policy, lists three key
stakeholders you would like to interview about the policy, and explains how each individual is related to or affected by the policy. Your instructor will approve
your policy and interview suggestions for use in your final project.
Specifically, the following critical elements must be addressed:
Summarize the policy that is the focus of your evaluation. Include the name, its purpose, and when it was created.
Explain your rationale for choosing the policy. Does it have personal or professional relevance?
Identify at least three stakeholders of the policy that you might interview, and discuss how they are affected by or related to the policy.
Rubric
Guidelines for Submission: Your paper must be a 1- to 2-page (not including title and reference pages) Microsoft Word document with 12-point Times New
Roman font, double spacing, and use of the most recent APA standards for formatting and referencing. Include a minimum of three peer-reviewed sources.
Critical Elements Proficient (100%) Needs Improvement (75%) Not Evident (0%) Value
Policy Summarizes the policy that is the focus of the
evaluation, including the purpose of the policy,
its scope and main points, its stakeholders and
constituents, and its relation to other policies
(if applicable)
Summarizes the policy that is the focus of the
evaluation, including the purpose of the policy,
its scope and main points, its stakeholders and
constituents, and its relation to other policies
(if applicable), but summary is missing key
elements, is cursory, or contains inaccuracies
Does not summarize the policy that is the focus
of the evaluation
20
Rationale Explains rationale for choosing the policy Explains rationale for choosing the policy, but
explanation is cursory or illogical or
unsupported or contains inaccuracies
Does not explain the rationale ...
This document discusses the concept of rating in time study. It defines rating as the assessment of a worker's rate of working relative to the observer's concept of the standard rate. The standard rate is equivalent to walking at 4 miles per hour without a load, which is considered a brisk but sustainable pace.
The document also discusses the concept of the average or standard worker. While no single worker is truly average, a large group of workers on a task will follow a normal distribution curve in their performance times. The time taken by the worker in the largest group is considered the average.
Setting the standard time is aimed at a time that is achievable by the average qualified worker over a full shift with adequate motivation, without
Dat 565 all discussions uop course guide uopstudy.comssuserd9bf9e
The document discusses the topics of several weekly discussions in an analytics course. It provides questions and prompts for students to discuss topics like data analytics vs statistics, descriptive vs predictive vs prescriptive analytics, hypothesis testing, linear regression modeling, and time series analysis and decomposition. Students are asked to post initial responses of at least 175 words and reply to two other classmates.
Dat 565 dat565 dat 565 discussions uopstudy.comssuserd9bf9e
The document discusses discussion prompts for an online course on data analytics and statistics (DAT 565). It includes prompts about data analytics vs statistics, descriptive vs predictive vs prescriptive analytics, hypothesis testing, linear regression modeling, and time series analysis. Students are asked to respond to the prompts in 175 words and reply to other students. The course materials are aimed at helping students understand and apply core analytics concepts.
This document summarizes theories related to employee job satisfaction, with a focus on wage comparison theories. It discusses social comparison theory, which posits that employees evaluate themselves by comparing to others. It also covers equity theory and discrepancy theory, both of which involve employees comparing their wages and outcomes to expectations and to other employees. The document indicates that comparing actual wages to reference levels like average wages can impact satisfaction levels, with wages below expectations generally leading to lower satisfaction.
This document provides a theoretical analysis of work-life balance as a tool for employee satisfaction and retention. It establishes the concepts of retention and employee satisfaction, and links them through empirical research. It defines work-life balance and discusses its historical context. The document argues that organizations can increase employee life satisfaction through work-life balance programs, creating a positive spill-over effect on job satisfaction. This can help with retention by increasing productivity and job satisfaction while reducing turnover intentions. Challenges to implementing work-life balance are also discussed.
Business Research Project Part 2 Literature ReviewArl.docxhumphrieskalyn
Business Research Project Part 2: Literature Review
Arlene Romero-Cruz, David Coleman, Felicia Clemons, Nicole Dulimba, Marchelle Lee and Matthew O'Leary
QNT 561
April 6, 2015
Kenneth Le Cour
Running head: BUSINESS RESEARCH PROJECT PART 2: LITERATURE REVIEW
1
BUSINESS RESEARCH PROJECT PART 2: LITERATURE REVIEW
4
Business Research Project Part 2: Literature Review
TTA is one of the leading telecommunications companies in the nation. The organization employs tens of thousands of employees and prides itself on recognition as one of the top 100 companies to work for in the United States. TTA wants all of its employees, from executive leaders to call center reps, to feel satisfied in their job and TTA takes an active role to ensure that this is the case.
The human resource management team at TTA is concerned about the level of job satisfaction between day shift employees and back shift employees. In an effort to address this potential problem, the team will look at the relationship between the dependent variable of job satisfaction and if it correlates to the independent variable of the employee shift.
Research Question - Revised
Are second shift (IV) employees less satisfied (DV) than first shift employees?
The human resource team conducted research relative to employee shift and job satisfaction. Peter Finn notes a couple of benefits to shift work which include flexibility in finding a job as well as increased income due to shift premiums. He also notes several drawbacks which include health concerns due to changes in sleep quality, less time spent with family, and a negative impact on social life (Finn, 1981). Additionally, according to Werling (2008), "compensation/pay, benefits, job security, flexibility to balance work/life issues and communication between employees and senior management were the top five contributors to job satisfaction, according to employees" (para 2). This detail will help guide the management team to determine overall job satisfaction for second shift employees at TTA.
Hypothesis Statements
1. There is no relationship between worker satisfaction (DV) and certain shifts (IV).
Employee dissatisfaction stems from a disconnection between ideals and work activities. Mundane and monotonous activities account for employee dissatisfaction. The dissatisfaction eventually affects an employee’s work ethic and production levels.
2. There is a relationship between worker satisfaction (DV) and certain shifts (IV).
Content employees are necessary for business representation. Offering alternative work schedules is helpful. Creative shift-schedule options and management-employee scheduling consensus coincide to address business needs, worker preferences and efficiently productive employees with work and home-life balance.
Conclusion
The human resources team can conclude that by using the formula f(x) the independent variable are the shifts because that is what can be changed to affect the dependent variable. The dependent v ...
Taylorism refers to principles of scientific management that aim to maximize efficiency in production. It involves breaking down jobs into small, simple tasks and establishing time and motion studies. Fordism built upon Taylorism by applying scientific management principles to mass production using assembly lines. Both Taylorism and Fordism transformed working conditions through increased productivity and higher wages, helping initiate mass consumption. While Taylor and Ford did not directly influence each other, their approaches still influence industry today through automation and emphasis on efficiency.
This document summarizes the key models of agency theory as it relates to work incentives and employment contracts. It begins with an overview of moral hazard models developed in the 1970s that examine the relationship between principal and agent. The document then presents a general principal-agent model of the employment relationship where the employer is the principal and employee is the agent. It analyzes the first-best and second-best solutions under conditions of both observable and unobservable effort. Specifically, it examines optimal compensation schemes and risk sharing under different assumptions about the risk preferences of the principal and agent. Extensions to the basic model are also discussed, including how they provide more insights into real employment practices.
The document discusses human capital theory and its key concepts. It defines human capital broadly as any stock of knowledge or characteristics that contribute to a worker's productivity. This includes formal education but also a variety of other skills. Three important caveats are discussed: (1) compensating differentials, where lower pay may be offset by better job characteristics; (2) labor market imperfections, where identical workers may receive different pay; and (3) taste-based discrimination. The document also outlines different views on how human capital contributes to productivity and different sources of heterogeneity in human capital between workers.
Running head RESEARCHED JUSTIFICATION REPORT 1RESEARCHED JUS.docxtoltonkendal
Running head: RESEARCHED JUSTIFICATION REPORT 1
RESEARCHED JUSTIFICATION REPORT 2
Researched Justification Report
Jaclyn Gosciak
Strayer university
April 29, 2015
RESEARCHED JUSTIFICATION REPORT
Problem Statement
Road works, late trains, broken alarm clocks; are examples of excuses that workers provide for coming late to work. However, within the business world, the competitiveness of the market does give space for legitimate or fake lateness. Continual staff lateness has the capacity to influence the productiveness and profitability of the company adversely. There are lots of companies which have bowed to competitors considering that they might no longer maintain up with strict timelines commonly observed in the higher circles of industry operations. Clearly, lateness is the scenario where employees fail to report to work early so as to start their respective working day shifts on time.
Overview of alternatives
There are several choices that the administration can undertake to get to the bottom of this predicament. The primary option is to provide a transparent lateness policy. The policy must have the right timekeeping requirements, clear shift patterns and the working hours. The policy must set out the consequences of reckless and persistent lateness. Additionally, the new rules should state the disciplinary measures to be undertaken within the event that the rules are violated. Any working time misused has to be compensated and so the policy must be explicit on how the employees will make up for the lost time. Any employee who foresees the likelihood of reporting late to work has to report this to the specified officer with duly explained motives. This would give the management or the officer in charge to plan in advance on how to cover up for this time (Benbow, 2011).
Criteria
There are two options that can be used in saving the situation. . The primary one is to have the workers sign a sheet every time they report on and off duty. Beneath this policy, every employee has to know of the existence of the policy and the enforcement needs to be fair and regular. This makes it hard for the implementation process to take root since it not always easy to manage this kind of program. A different option is to make use of a biometric computing device where the employees signs in with their finger prints each time they report to work. They're additionally supposed to log off after the end of their shifts/working day. This may be the easiest alternative seeing that it's particularly convenient to watch the staff when you consider that there's an automated recording and monitoring method. It's for this reason a favored choice over the manual signing which can with no trouble be manipulated. However, there is need for further research to determine the workability of this technology.. Although there is proof of its success in other areas like the registration and balloting techniques, it's vital that the success of this tech ...
PAGE
ASSIGNMENT 3
Developing Your Team
Your name here
Strayer University
DELETE THE INFORMATION IN THIS TEMPLATE BEFORE SUBMITTING YOUR PAPER!
Introduction
In this section, you will introduce what your paper is about. An introduction sets the stage for the topics your paper will discuss. Start by thinking about the question(s) you are trying to answer. Provide information about the company you are choosing to discuss for this assignment. Your introduction should conclude with your topic sentence. A topic sentence is a concise summary of the main topics of your paper, typically written as one sentence. For this paper, there are three main topics, so be sure to include them all in your topic sentence.
Creating a Diverse Team with Different Strengths
In this section, you are asked to explain how you could create a diverse team of employees with different strengths. We talked about diversity in Week 8 in our class. What were your thoughts on workplace diversity and its importance to a company’s culture and performance? Think about the steps or actions you would take to bring diversity to your company. Think about the strengths you would want your employees to have, such as attention to detail, good communication, excellent people skills, and so on. (You may want to refer to Assignment 1 where you discussed employee characteristics.) Then discuss how you find people with those characteristics. Use scenarios (examples) to convey your ideas.
Methods to Improve Team Dynamics and Employee Behaviors
In this section, you are asked to discuss methods you would adopt to improve team dynamics and employee behaviors. You can start off by talking about what team dynamics are, then go into discussing why a positive team dynamic is important. Discuss the team dynamics you want in your workplace and how you might ensure that those dynamics are in place. We talked about team work in Week 7. What are some of the things you discussed that you would put in place to help your employees be a better team? Sometimes to have a positive team dynamic, you need to give employees some guidance on what is expected of them and how they should behave at work. This can be done with various control systems – guidelines, procedures, rules, and so on. We talked about control systems in Week 9. What are some of the controls you might put in place to help your employees perform well as a team?
Two Management Techniques to Align Team Behaviors to the Company Mission
In this section, discuss two (2) management techniques you would implement to ensure that your new team aligns to your company’s mission. You can begin talking about a company’s mission and it’s importance. If employees don’t know the company mission statement, they may not understand the importance of their work or how what they do fits in the grand scheme of things. Reflect on all the aspects of management we .
PAGE
ASSIGNMENT 3
Developing Your Team
Your name here
Strayer University
DELETE THE INFORMATION IN THIS TEMPLATE BEFORE SUBMITTING YOUR PAPER!
Introduction
In this section, you will introduce what your paper is about. An introduction sets the stage for the topics your paper will discuss. Start by thinking about the question(s) you are trying to answer. Provide information about the company you are choosing to discuss for this assignment. Your introduction should conclude with your topic sentence. A topic sentence is a concise summary of the main topics of your paper, typically written as one sentence. For this paper, there are three main topics, so be sure to include them all in your topic sentence.
Creating a Diverse Team with Different Strengths
In this section, you are asked to explain how you could create a diverse team of employees with different strengths. We talked about diversity in Week 8 in our class. What were your thoughts on workplace diversity and its importance to a company’s culture and performance? Think about the steps or actions you would take to bring diversity to your company. Think about the strengths you would want your employees to have, such as attention to detail, good communication, excellent people skills, and so on. (You may want to refer to Assignment 1 where you discussed employee characteristics.) Then discuss how you find people with those characteristics. Use scenarios (examples) to convey your ideas.
Methods to Improve Team Dynamics and Employee Behaviors
In this section, you are asked to discuss methods you would adopt to improve team dynamics and employee behaviors. You can start off by talking about what team dynamics are, then go into discussing why a positive team dynamic is important. Discuss the team dynamics you want in your workplace and how you might ensure that those dynamics are in place. We talked about team work in Week 7. What are some of the things you discussed that you would put in place to help your employees be a better team? Sometimes to have a positive team dynamic, you need to give employees some guidance on what is expected of them and how they should behave at work. This can be done with various control systems – guidelines, procedures, rules, and so on. We talked about control systems in Week 9. What are some of the controls you might put in place to help your employees perform well as a team?
Two Management Techniques to Align Team Behaviors to the Company Mission
In this section, discuss two (2) management techniques you would implement to ensure that your new team aligns to your company’s mission. You can begin talking about a company’s mission and it’s importance. If employees don’t know the company mission statement, they may not understand the importance of their work or how what they do fits in the grand scheme of things. Reflect on all the aspects of management we .
BASIC CONCEPTS ON ORGANIZATIONAL THEORIES AND DEVELOPMENT.pptxssuser9cf4e3
This document provides an overview of organizational theories and development. It begins with an introduction and definitions of key terms. It then summarizes three main organizational theories: classical theory focuses on economic productivity; humanistic theory emphasizes employee motivation and relationships; and open-system theory uses a feedback loop for continuous improvement. The conclusion discusses using a hybrid approach combining aspects of each theory to optimize corporate effectiveness and encourage employee growth.
College of administration and finance sciences assignment (SONU61709
This document summarizes a research paper on strategic human capital and the need to ground emerging theories in practical business experiences. It provides an example of how academic research focused on theoretical assumptions rather than practical business problems. The emerging field of strategic human capital has an opportunity to develop theories that bridge this gap by systematically comparing assumptions to real-world phenomena. Doing so while the field is still developing could help establish a foundation of assumptions that reflect both academic rigor and practical relevance.
Fuzzy based approach for temporary objective identificationAlexander Decker
This document presents a new fuzzy-based approach for identifying the most effective temporary objective for an enterprise. The approach uses a fuzzy decision-making system to systematically analyze enterprise experts' opinions on various quantitative and qualitative factors that influence objective setting. It involves fuzzifying the factors, developing IF-THEN rules relating the factors to objectives, applying the rules via inference, and defuzzifying the results to determine the most important objective. A hypothetical example demonstrates how the approach can identify the optimal short-term objective for a business based on prevailing sales, costs, inventory levels, prices and competitive conditions.
11.fuzzy based approach for temporary objective identificationAlexander Decker
This paper presents a new fuzzy-based approach to identify the most effective temporary objective of an enterprise. The approach uses a fuzzy decision-making system to systematically incorporate the knowledge, intuition, and expertise of enterprise experts. It allows for both quantitative and qualitative factors to be considered. The key components of the approach are: (1) fuzzifying input factors and objectives, (2) developing IF-THEN rules relating inputs to objectives, (3) matching rules and inferring objectives, and (4) defuzzifying to determine the priority objective. The approach provides a scientific means to set temporary objectives compared to relying solely on management judgment. It can be applied to different industries and situations involving uncertainty.
CitationCorrect. All needed information is provided.Proc His.docxsleeperharwell
Citation
Correct. All needed information is provided.
Proc History
The procedural history should show how the case got before the appellate court. You get almost there! But don't forget to say that the doctor appeals the district court decision.
Issues
There are three issues. Identify each issue and the relevant law under which the issue arises.
You have all three issues, and you are essentially right in all three, but remember that issues in appellate cases ask whether the lower court made the right decision on key legal questions. So, issue two is a little too broad--whether a retaliation claim under FCRA is barred by the Florida statute immunizing public hospitals from suit is closer. And the third is right but could be more precise--what is the law/claim under which the interference with an employment relationship concern arises? But, overall, very strong.
Facts
These are facts of the underlying dispute.
Remember that you are assuming the reader of the brief has not read the opinion and giving all the information needed to understand the case in a concise form. Staying objective is the goal here. That means you include all the facts relevant to the decision--those that suggest he is an employee and those that suggest he is an independent contractor, and you don't draw legal conclusions.
So, is it accurate to say the doctor did not claim the existence of an employment relationship? No. that was your issue number 1, wasn't it? Also, you aren't describing allegations or claims here, you are setting out facts in an objective manner. You leave the arena of facts here somewhat.
Rule
Ask yourself whether someone who never read the case decision would understand the rule from reading this section. Or would he or she just say, "Huh, that's a nice list of laws. I wonder what it has to do with this case."
You must set out the ADEA and FCRA first, then the tests that courts have created under those laws to determine employee status. And don't forget to lay out the rule for issues 2 & 3.
Holdings
The holdings should state what the court determined on the legal issues. Do you actually say in Holding #1 whether the doctor is an employee or an IC?
Holding #2 Do you say whether the doctor's retaliation claim is barred or not?
Holding #3 Do you say whether the doctor provided adequate evidence of an employment relationship?
State the holdings directly--answer the questions represented by the issues.
Reasoning
Don't just restate the holding. Give the facts and logic that the court thought were important to reach its conclusion. If there are three issues, three holdings, there should be three reasoning sections.
Outcome
Correct.
Notes
The notes were optional, but it's a great opportunity to reflect on the process and what you learned. They were optional (and do not affect your grade), but they are great to read.
Journal of Management History
A view of entrepreneurship and innovation from the economist “for all seasons”: Joseph
S. Schumpete.
Temporal Knowledge, Temporal Ontologies, and Temporal Reasoning for Manageria...IDES Editor
The document discusses temporal knowledge representation and reasoning for analyzing changes in an economic environment over time. It provides an overview of how time is addressed in economics and artificial intelligence. Temporal knowledge representation methods like temporal conceptual graphs are described for representing dynamic economic concepts such as barriers to entry in a market. An example application of temporal conceptual graphs to analyze changing barriers is presented.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
More Related Content
Similar to CS 201 Assignment #5 Synchronization and DeadlocksAssigne.docx
Dat 565 all discussions uop course guide uopstudy.comssuserd9bf9e
The document discusses the topics of several weekly discussions in an analytics course. It provides questions and prompts for students to discuss topics like data analytics vs statistics, descriptive vs predictive vs prescriptive analytics, hypothesis testing, linear regression modeling, and time series analysis and decomposition. Students are asked to post initial responses of at least 175 words and reply to two other classmates.
Dat 565 dat565 dat 565 discussions uopstudy.comssuserd9bf9e
The document discusses discussion prompts for an online course on data analytics and statistics (DAT 565). It includes prompts about data analytics vs statistics, descriptive vs predictive vs prescriptive analytics, hypothesis testing, linear regression modeling, and time series analysis. Students are asked to respond to the prompts in 175 words and reply to other students. The course materials are aimed at helping students understand and apply core analytics concepts.
This document summarizes theories related to employee job satisfaction, with a focus on wage comparison theories. It discusses social comparison theory, which posits that employees evaluate themselves by comparing to others. It also covers equity theory and discrepancy theory, both of which involve employees comparing their wages and outcomes to expectations and to other employees. The document indicates that comparing actual wages to reference levels like average wages can impact satisfaction levels, with wages below expectations generally leading to lower satisfaction.
This document provides a theoretical analysis of work-life balance as a tool for employee satisfaction and retention. It establishes the concepts of retention and employee satisfaction, and links them through empirical research. It defines work-life balance and discusses its historical context. The document argues that organizations can increase employee life satisfaction through work-life balance programs, creating a positive spill-over effect on job satisfaction. This can help with retention by increasing productivity and job satisfaction while reducing turnover intentions. Challenges to implementing work-life balance are also discussed.
Business Research Project Part 2 Literature ReviewArl.docxhumphrieskalyn
Business Research Project Part 2: Literature Review
Arlene Romero-Cruz, David Coleman, Felicia Clemons, Nicole Dulimba, Marchelle Lee and Matthew O'Leary
QNT 561
April 6, 2015
Kenneth Le Cour
Running head: BUSINESS RESEARCH PROJECT PART 2: LITERATURE REVIEW
1
BUSINESS RESEARCH PROJECT PART 2: LITERATURE REVIEW
4
Business Research Project Part 2: Literature Review
TTA is one of the leading telecommunications companies in the nation. The organization employs tens of thousands of employees and prides itself on recognition as one of the top 100 companies to work for in the United States. TTA wants all of its employees, from executive leaders to call center reps, to feel satisfied in their job and TTA takes an active role to ensure that this is the case.
The human resource management team at TTA is concerned about the level of job satisfaction between day shift employees and back shift employees. In an effort to address this potential problem, the team will look at the relationship between the dependent variable of job satisfaction and if it correlates to the independent variable of the employee shift.
Research Question - Revised
Are second shift (IV) employees less satisfied (DV) than first shift employees?
The human resource team conducted research relative to employee shift and job satisfaction. Peter Finn notes a couple of benefits to shift work which include flexibility in finding a job as well as increased income due to shift premiums. He also notes several drawbacks which include health concerns due to changes in sleep quality, less time spent with family, and a negative impact on social life (Finn, 1981). Additionally, according to Werling (2008), "compensation/pay, benefits, job security, flexibility to balance work/life issues and communication between employees and senior management were the top five contributors to job satisfaction, according to employees" (para 2). This detail will help guide the management team to determine overall job satisfaction for second shift employees at TTA.
Hypothesis Statements
1. There is no relationship between worker satisfaction (DV) and certain shifts (IV).
Employee dissatisfaction stems from a disconnection between ideals and work activities. Mundane and monotonous activities account for employee dissatisfaction. The dissatisfaction eventually affects an employee’s work ethic and production levels.
2. There is a relationship between worker satisfaction (DV) and certain shifts (IV).
Content employees are necessary for business representation. Offering alternative work schedules is helpful. Creative shift-schedule options and management-employee scheduling consensus coincide to address business needs, worker preferences and efficiently productive employees with work and home-life balance.
Conclusion
The human resources team can conclude that by using the formula f(x) the independent variable are the shifts because that is what can be changed to affect the dependent variable. The dependent v ...
Taylorism refers to principles of scientific management that aim to maximize efficiency in production. It involves breaking down jobs into small, simple tasks and establishing time and motion studies. Fordism built upon Taylorism by applying scientific management principles to mass production using assembly lines. Both Taylorism and Fordism transformed working conditions through increased productivity and higher wages, helping initiate mass consumption. While Taylor and Ford did not directly influence each other, their approaches still influence industry today through automation and emphasis on efficiency.
This document summarizes the key models of agency theory as it relates to work incentives and employment contracts. It begins with an overview of moral hazard models developed in the 1970s that examine the relationship between principal and agent. The document then presents a general principal-agent model of the employment relationship where the employer is the principal and employee is the agent. It analyzes the first-best and second-best solutions under conditions of both observable and unobservable effort. Specifically, it examines optimal compensation schemes and risk sharing under different assumptions about the risk preferences of the principal and agent. Extensions to the basic model are also discussed, including how they provide more insights into real employment practices.
The document discusses human capital theory and its key concepts. It defines human capital broadly as any stock of knowledge or characteristics that contribute to a worker's productivity. This includes formal education but also a variety of other skills. Three important caveats are discussed: (1) compensating differentials, where lower pay may be offset by better job characteristics; (2) labor market imperfections, where identical workers may receive different pay; and (3) taste-based discrimination. The document also outlines different views on how human capital contributes to productivity and different sources of heterogeneity in human capital between workers.
Running head RESEARCHED JUSTIFICATION REPORT 1RESEARCHED JUS.docxtoltonkendal
Running head: RESEARCHED JUSTIFICATION REPORT 1
RESEARCHED JUSTIFICATION REPORT 2
Researched Justification Report
Jaclyn Gosciak
Strayer university
April 29, 2015
RESEARCHED JUSTIFICATION REPORT
Problem Statement
Road works, late trains, broken alarm clocks; are examples of excuses that workers provide for coming late to work. However, within the business world, the competitiveness of the market does give space for legitimate or fake lateness. Continual staff lateness has the capacity to influence the productiveness and profitability of the company adversely. There are lots of companies which have bowed to competitors considering that they might no longer maintain up with strict timelines commonly observed in the higher circles of industry operations. Clearly, lateness is the scenario where employees fail to report to work early so as to start their respective working day shifts on time.
Overview of alternatives
There are several choices that the administration can undertake to get to the bottom of this predicament. The primary option is to provide a transparent lateness policy. The policy must have the right timekeeping requirements, clear shift patterns and the working hours. The policy must set out the consequences of reckless and persistent lateness. Additionally, the new rules should state the disciplinary measures to be undertaken within the event that the rules are violated. Any working time misused has to be compensated and so the policy must be explicit on how the employees will make up for the lost time. Any employee who foresees the likelihood of reporting late to work has to report this to the specified officer with duly explained motives. This would give the management or the officer in charge to plan in advance on how to cover up for this time (Benbow, 2011).
Criteria
There are two options that can be used in saving the situation. . The primary one is to have the workers sign a sheet every time they report on and off duty. Beneath this policy, every employee has to know of the existence of the policy and the enforcement needs to be fair and regular. This makes it hard for the implementation process to take root since it not always easy to manage this kind of program. A different option is to make use of a biometric computing device where the employees signs in with their finger prints each time they report to work. They're additionally supposed to log off after the end of their shifts/working day. This may be the easiest alternative seeing that it's particularly convenient to watch the staff when you consider that there's an automated recording and monitoring method. It's for this reason a favored choice over the manual signing which can with no trouble be manipulated. However, there is need for further research to determine the workability of this technology.. Although there is proof of its success in other areas like the registration and balloting techniques, it's vital that the success of this tech ...
PAGE
ASSIGNMENT 3
Developing Your Team
Your name here
Strayer University
DELETE THE INFORMATION IN THIS TEMPLATE BEFORE SUBMITTING YOUR PAPER!
Introduction
In this section, you will introduce what your paper is about. An introduction sets the stage for the topics your paper will discuss. Start by thinking about the question(s) you are trying to answer. Provide information about the company you are choosing to discuss for this assignment. Your introduction should conclude with your topic sentence. A topic sentence is a concise summary of the main topics of your paper, typically written as one sentence. For this paper, there are three main topics, so be sure to include them all in your topic sentence.
Creating a Diverse Team with Different Strengths
In this section, you are asked to explain how you could create a diverse team of employees with different strengths. We talked about diversity in Week 8 in our class. What were your thoughts on workplace diversity and its importance to a company’s culture and performance? Think about the steps or actions you would take to bring diversity to your company. Think about the strengths you would want your employees to have, such as attention to detail, good communication, excellent people skills, and so on. (You may want to refer to Assignment 1 where you discussed employee characteristics.) Then discuss how you find people with those characteristics. Use scenarios (examples) to convey your ideas.
Methods to Improve Team Dynamics and Employee Behaviors
In this section, you are asked to discuss methods you would adopt to improve team dynamics and employee behaviors. You can start off by talking about what team dynamics are, then go into discussing why a positive team dynamic is important. Discuss the team dynamics you want in your workplace and how you might ensure that those dynamics are in place. We talked about team work in Week 7. What are some of the things you discussed that you would put in place to help your employees be a better team? Sometimes to have a positive team dynamic, you need to give employees some guidance on what is expected of them and how they should behave at work. This can be done with various control systems – guidelines, procedures, rules, and so on. We talked about control systems in Week 9. What are some of the controls you might put in place to help your employees perform well as a team?
Two Management Techniques to Align Team Behaviors to the Company Mission
In this section, discuss two (2) management techniques you would implement to ensure that your new team aligns to your company’s mission. You can begin talking about a company’s mission and it’s importance. If employees don’t know the company mission statement, they may not understand the importance of their work or how what they do fits in the grand scheme of things. Reflect on all the aspects of management we .
PAGE
ASSIGNMENT 3
Developing Your Team
Your name here
Strayer University
DELETE THE INFORMATION IN THIS TEMPLATE BEFORE SUBMITTING YOUR PAPER!
Introduction
In this section, you will introduce what your paper is about. An introduction sets the stage for the topics your paper will discuss. Start by thinking about the question(s) you are trying to answer. Provide information about the company you are choosing to discuss for this assignment. Your introduction should conclude with your topic sentence. A topic sentence is a concise summary of the main topics of your paper, typically written as one sentence. For this paper, there are three main topics, so be sure to include them all in your topic sentence.
Creating a Diverse Team with Different Strengths
In this section, you are asked to explain how you could create a diverse team of employees with different strengths. We talked about diversity in Week 8 in our class. What were your thoughts on workplace diversity and its importance to a company’s culture and performance? Think about the steps or actions you would take to bring diversity to your company. Think about the strengths you would want your employees to have, such as attention to detail, good communication, excellent people skills, and so on. (You may want to refer to Assignment 1 where you discussed employee characteristics.) Then discuss how you find people with those characteristics. Use scenarios (examples) to convey your ideas.
Methods to Improve Team Dynamics and Employee Behaviors
In this section, you are asked to discuss methods you would adopt to improve team dynamics and employee behaviors. You can start off by talking about what team dynamics are, then go into discussing why a positive team dynamic is important. Discuss the team dynamics you want in your workplace and how you might ensure that those dynamics are in place. We talked about team work in Week 7. What are some of the things you discussed that you would put in place to help your employees be a better team? Sometimes to have a positive team dynamic, you need to give employees some guidance on what is expected of them and how they should behave at work. This can be done with various control systems – guidelines, procedures, rules, and so on. We talked about control systems in Week 9. What are some of the controls you might put in place to help your employees perform well as a team?
Two Management Techniques to Align Team Behaviors to the Company Mission
In this section, discuss two (2) management techniques you would implement to ensure that your new team aligns to your company’s mission. You can begin talking about a company’s mission and it’s importance. If employees don’t know the company mission statement, they may not understand the importance of their work or how what they do fits in the grand scheme of things. Reflect on all the aspects of management we .
BASIC CONCEPTS ON ORGANIZATIONAL THEORIES AND DEVELOPMENT.pptxssuser9cf4e3
This document provides an overview of organizational theories and development. It begins with an introduction and definitions of key terms. It then summarizes three main organizational theories: classical theory focuses on economic productivity; humanistic theory emphasizes employee motivation and relationships; and open-system theory uses a feedback loop for continuous improvement. The conclusion discusses using a hybrid approach combining aspects of each theory to optimize corporate effectiveness and encourage employee growth.
College of administration and finance sciences assignment (SONU61709
This document summarizes a research paper on strategic human capital and the need to ground emerging theories in practical business experiences. It provides an example of how academic research focused on theoretical assumptions rather than practical business problems. The emerging field of strategic human capital has an opportunity to develop theories that bridge this gap by systematically comparing assumptions to real-world phenomena. Doing so while the field is still developing could help establish a foundation of assumptions that reflect both academic rigor and practical relevance.
Fuzzy based approach for temporary objective identificationAlexander Decker
This document presents a new fuzzy-based approach for identifying the most effective temporary objective for an enterprise. The approach uses a fuzzy decision-making system to systematically analyze enterprise experts' opinions on various quantitative and qualitative factors that influence objective setting. It involves fuzzifying the factors, developing IF-THEN rules relating the factors to objectives, applying the rules via inference, and defuzzifying the results to determine the most important objective. A hypothetical example demonstrates how the approach can identify the optimal short-term objective for a business based on prevailing sales, costs, inventory levels, prices and competitive conditions.
11.fuzzy based approach for temporary objective identificationAlexander Decker
This paper presents a new fuzzy-based approach to identify the most effective temporary objective of an enterprise. The approach uses a fuzzy decision-making system to systematically incorporate the knowledge, intuition, and expertise of enterprise experts. It allows for both quantitative and qualitative factors to be considered. The key components of the approach are: (1) fuzzifying input factors and objectives, (2) developing IF-THEN rules relating inputs to objectives, (3) matching rules and inferring objectives, and (4) defuzzifying to determine the priority objective. The approach provides a scientific means to set temporary objectives compared to relying solely on management judgment. It can be applied to different industries and situations involving uncertainty.
CitationCorrect. All needed information is provided.Proc His.docxsleeperharwell
Citation
Correct. All needed information is provided.
Proc History
The procedural history should show how the case got before the appellate court. You get almost there! But don't forget to say that the doctor appeals the district court decision.
Issues
There are three issues. Identify each issue and the relevant law under which the issue arises.
You have all three issues, and you are essentially right in all three, but remember that issues in appellate cases ask whether the lower court made the right decision on key legal questions. So, issue two is a little too broad--whether a retaliation claim under FCRA is barred by the Florida statute immunizing public hospitals from suit is closer. And the third is right but could be more precise--what is the law/claim under which the interference with an employment relationship concern arises? But, overall, very strong.
Facts
These are facts of the underlying dispute.
Remember that you are assuming the reader of the brief has not read the opinion and giving all the information needed to understand the case in a concise form. Staying objective is the goal here. That means you include all the facts relevant to the decision--those that suggest he is an employee and those that suggest he is an independent contractor, and you don't draw legal conclusions.
So, is it accurate to say the doctor did not claim the existence of an employment relationship? No. that was your issue number 1, wasn't it? Also, you aren't describing allegations or claims here, you are setting out facts in an objective manner. You leave the arena of facts here somewhat.
Rule
Ask yourself whether someone who never read the case decision would understand the rule from reading this section. Or would he or she just say, "Huh, that's a nice list of laws. I wonder what it has to do with this case."
You must set out the ADEA and FCRA first, then the tests that courts have created under those laws to determine employee status. And don't forget to lay out the rule for issues 2 & 3.
Holdings
The holdings should state what the court determined on the legal issues. Do you actually say in Holding #1 whether the doctor is an employee or an IC?
Holding #2 Do you say whether the doctor's retaliation claim is barred or not?
Holding #3 Do you say whether the doctor provided adequate evidence of an employment relationship?
State the holdings directly--answer the questions represented by the issues.
Reasoning
Don't just restate the holding. Give the facts and logic that the court thought were important to reach its conclusion. If there are three issues, three holdings, there should be three reasoning sections.
Outcome
Correct.
Notes
The notes were optional, but it's a great opportunity to reflect on the process and what you learned. They were optional (and do not affect your grade), but they are great to read.
Journal of Management History
A view of entrepreneurship and innovation from the economist “for all seasons”: Joseph
S. Schumpete.
Temporal Knowledge, Temporal Ontologies, and Temporal Reasoning for Manageria...IDES Editor
The document discusses temporal knowledge representation and reasoning for analyzing changes in an economic environment over time. It provides an overview of how time is addressed in economics and artificial intelligence. Temporal knowledge representation methods like temporal conceptual graphs are described for representing dynamic economic concepts such as barriers to entry in a market. An example application of temporal conceptual graphs to analyze changing barriers is presented.
Similar to CS 201 Assignment #5 Synchronization and DeadlocksAssigne.docx (19)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
How to Make a Field Mandatory in Odoo 17Celine George
In Odoo, making a field required can be done through both Python code and XML views. When you set the required attribute to True in Python code, it makes the field required across all views where it's used. Conversely, when you set the required attribute in XML views, it makes the field required only in the context of that particular view.
Reimagining Your Library Space: How to Increase the Vibes in Your Library No ...Diana Rendina
Librarians are leading the way in creating future-ready citizens – now we need to update our spaces to match. In this session, attendees will get inspiration for transforming their library spaces. You’ll learn how to survey students and patrons, create a focus group, and use design thinking to brainstorm ideas for your space. We’ll discuss budget friendly ways to change your space as well as how to find funding. No matter where you’re at, you’ll find ideas for reimagining your space in this session.
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
Walmart Business+ and Spark Good for Nonprofits.pdfTechSoup
"Learn about all the ways Walmart supports nonprofit organizations.
You will hear from Liz Willett, the Head of Nonprofits, and hear about what Walmart is doing to help nonprofits, including Walmart Business and Spark Good. Walmart Business+ is a new offer for nonprofits that offers discounts and also streamlines nonprofits order and expense tracking, saving time and money.
The webinar may also give some examples on how nonprofits can best leverage Walmart Business+.
The event will cover the following::
Walmart Business + (https://business.walmart.com/plus) is a new shopping experience for nonprofits, schools, and local business customers that connects an exclusive online shopping experience to stores. Benefits include free delivery and shipping, a 'Spend Analytics” feature, special discounts, deals and tax-exempt shopping.
Special TechSoup offer for a free 180 days membership, and up to $150 in discounts on eligible orders.
Spark Good (walmart.com/sparkgood) is a charitable platform that enables nonprofits to receive donations directly from customers and associates.
Answers about how you can do more with Walmart!"
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
CS 201 Assignment #5 Synchronization and DeadlocksAssigne.docx
1. CS 201 Assignment #5: Synchronization and Deadlocks
Assigned Wednesday, 10/24; due Monday, 11/5 at 11:59 pm.
Implement the Dining Philosophers.
Part I: in a naive fashion, in order to cause a deadlock
Part II: in a way that prevents deadlocks
Here are the dining philosophers:
philosopher 1
philosopher 2 philosopher 3
philosopher 4
philosopher 0
fork 0fork 1
fork 2
fork 3
fork 4
food
The processing is like this:
2. each philosopher picks up his left fork
each philosopher picks up his right fork
he eats for EAT_TIME
he puts down his left fork
he puts down his right fork
he thinks for THINK_TIME
And all five philosophers do this simultaneously. So for a
Linux implementation, we can put each
philosopher in a separate pthread.
Here are some constants for your program:
#define NUM_PHILOSOPHERS 5
#define RUNTIME 10
#define EAT_TIME 2
#define THINK_TIME 1
Here's a global variable -- the array of forks (which are mutex
locks):
pthread_mutex_t forks[NUM_PHILOSOPHERS];
The basic idea is to create NUM_PHILOSOPHERS pthreads, by
calling pthread_create() five times.
1
3. Each philosopher function will look like this:
void *philosopher(void *param);
and the param will be a pointer to an integer value in the range
0..NUM_PHILOSOPHERS-1, which
will uniquely identify the thread.
Here's the processing inside the philosopher function:
int *myID;
myID = (int *) param;
leftIdx = *myID;
rightIdx = (*myID + 1) % NUM_PHILOSOPHERS;
printf("P %d startn", *myID);
while ( 1 ) {
pthread_mutex_lock(&(forks[leftIdx]));
usleep(1000);
pthread_mutex_lock(&(forks[rightIdx]));
printf("P %d, eating for %d secsn", *myID, EAT_TIME);
sleep(EAT_TIME);
pthread_mutex_unlock(&(forks[leftIdx]));
pthread_mutex_unlock(&(forks[rightIdx]));
printf("P %d, thinking for %d secsn", *myID, THINK_TIME);
sleep(THINK_TIME);
}
The usleep(1000) says "sleep for 1000 microseconds" (i.e., 1
millisecond). This gives all of the
philopher threads the chance to pick up their left fork when they
first start, thus increasing the
4. chances of deadlock.
There is no true or TRUE constant in C. That's why I have
"while ( 1 )".
Initialize the mutexes like this:
int rtnval;
for (i=0; i<NUM_PHILOSOPHERS; ++i) {
rtnval = pthread_mutex_init(&(forks[i]), NULL);
if (rtnval != 0) {
printf("error initializing mutexn");
return(8);
}
}
Start each philosopher thread as you did in the multithreaded
sorting assignment:
int id[NUM_PHILOSOPHERS];
thread_t tid[NUM_PHILOSOPHERS];
for (i=0; i<NUM_PHILOSOPHERS; ++i) {
id[i] = i;
pthread_create(&(tid[i]), &attr, philosopher_good_2,
&(id[i]));
}
2
and then sleep for RUNTIME seconds.
After that, kill the threads:
5. for (i=0; i<NUM_PHILOSOPHERS; ++i) {
pthread_kill(tid[i], 0);
}
Part I
Build out the rest of the code to implement this. When you run
it, you should see a deadlock.
Here's what I get when I run:
$ a.out
P 0 start
P 3 start
P 2 start
P 4 start
P 1 start
(and then it just sits there).
Part II
Use some scheme to prevent deadlock. Create a different
function philosopher_good():
void *philosopher_good(void *param);
All of the infrastructure will be the same, but you'll do
something different in your while (1) { } loop
inside the philospher_good() function--specifically, something
to prevent a deadlock, while letting
all of the philophers make progress.
6. Here's what I get:
$ a.out
P 0 start
P 1 start
P 3 start
P 2 start
P 4 start
P 1, eating for 2 secs
P 3, eating for 2 secs
P 1, thinking for 1 secs
P 3, thinking for 1 secs
P 0, eating for 2 secs
P 2, eating for 2 secs
P 0, thinking for 1 secs
P 4, eating for 2 secs
P 2, thinking for 1 secs
P 1, eating for 2 secs
P 4, thinking for 1 secs
3
P 3, eating for 2 secs
P 1, thinking for 1 secs
P 0, eating for 2 secs
P 3, thinking for 1 secs
P 2, eating for 2 secs
P 0, thinking for 1 secs
P 4, eating for 2 secs
Here are a couple of things you can look at to give you ideas:
* pthread_mutex_trylock()
7. * Dijkstra's Resource Hierarchy
Solution
for deadlocks
Or, you can think up your own solution.
I've thrown in more C derefencing stuff into this (such as
&array[idx]). Don't panic. Build this out
slowly and carefully, and we can discuss in class any questions
you have.
4
Learning from the Past: Trends in Executive
Compensation over the 20th Century
Carola Frydman*
8. Abstract
In recent years, a large academic debate has tried to explain the
rapid rise in CEO pay
experienced over the past three decades. In this article, I review
the main proposed
theories, which span views of compensation as the result of a
competitive labor market
for executives to theories based on excess of managerial power.
Some of these hypoth-
eses have found support in cross-sectional evidence, but it has
proven more difficult to
determine which factors have caused the observed changes in
pay over time. An alterna-
tive strategy is to evaluate the fit of plausible explanations out
of sample by contrasting
them with the evolution in executive pay and the market for
9. managers during earlier time
periods. A case study of General Electric suggests that evidence
for earlier decades can
speak of the recent trends and reveals the limitations of current
explanations to address
the long-run data. (JEL codes: G30, J33, M52, N82)
Keywords: Executive compensation, managerial incentives,
corporate governance,
market for managers.
1 Introduction
As the main decision makers in large public corporations, top
executives
comprise an important albeit small part of the labor force. Thus,
the
compensation of these individuals is of special interest because
it influ-
10. ences their decision-making process. Since the 1980s, the
academic
research on executive pay has grown significantly (Murphy
1999). This
new interest on the topic is probably related to two main
reasons. First,
the level of executive compensation has soared since the 1970s,
due in part
to the increasing use of employee stock options (Hall and
Liebman 1998,
Murphy 1999). In consequence, both the high levels of pay and
the struc-
ture of compensation have come under intense scrutiny. Second,
compre-
hensive datasets with detailed information on the compensation
of top
11. managers are available for this period, allowing a precise
determination
of the stylized facts on pay over the past three decades.
The recent trends in executive pay have generated a
considerable debate
on the determinants of compensation. Proposed theories cover a
wide
spectrum, ranging from viewing the level of pay as the efficient
outcome
* MIT Sloan School of Management, 50 Memorial Drive Room
E52–436, Cambridge MA,
02142, USA, e-mail: [email protected] I thank the participants
at the CESifo Venice
Summer Institute Workshop on ‘‘Executive Pay’’ held on July
16–17 2008 for their
comments.
� The Author 2009. Published by Oxford University Press
on behalf of Ifo Institute for Economic Research, Munich. All
rights reserved.
For permissions, please email: [email protected] 458
12. CESifo Economic Studies, Vol. 55, 3-4/2009, 458–481
doi:10.1093/cesifo/ifp021
Advance Access publication 25 August 2009
from a competitive labor market for managers to arguing that
extremely
high pay is the result of managers inefficiently extracting rents
from the
firms they manage. While some of the proposed hypotheses
have found
support in cross-sectional evidence, identifying the drivers of
pay over time
has proven more difficult. Since the 1970s, the level of
executive pay has
exhibited a steady upward trend. The potential determinants of
pay sug-
13. gested by most of these theories have also changed mostly
monotonically
during this period, leading to a systematic correlation between
these vari-
ables and executive pay. Thus, it is difficult to disentangle
which of the
proposed explanations has mattered in a more causal manner
focusing
only on evidence for recent years (Frydman and Saks 2009).
An alternative strategy consists of verifying the predictions of
various
theories by using data for other countries or other time periods.
A sub-
stantial literature has established how compensation practices
vary across
countries and is now starting to evaluate different theories on
pay using
these data.
14. 1
Information on managerial pay from other periods in US
history is also a valuable addition because other periods provide
more
variation in the trends in pay and in the determinants to be
assessed
with arguably less variation in institutions than in cross-country
studies.
Frydman and Saks (2009) present such a study by setting forth
the long-
run changes in compensation in a systematic manner and
quantitatively
analyzing the contribution of several explanations to the trends
in pay
over time. In this article, I build on that work by focusing on
the evolution
of compensation and managerial backgrounds of the top
executives of
15. General Electric Corporation (GE). This qualitative case study
addresses
a larger set of theories for the recent changes in pay and
provides a more
involved view on the uses of historical data than was possible in
Frydman
and Saks (2009).
The lead explanations for the recent rise on executive pay can
be broadly
divided into two categories. First, a set of theories views
compensation as
the competitive outcome from the labor and product markets.
These
explanations encompass the role of demand for talent and scale
effects;
increase in the demand for generalist CEOs; the effects of trade
and prod-
16. uct market competition; and the emergence of alternative
outside options
for managers.
2
A second set of theories emphasizes the constraints that
institutions, either within or outside corporations, impose on
executive
pay. The main hypotheses in this group include managers’
ability to
1
See, for example, Abowd and Bognanno (1995) and Fernandes
et al. (2008) for a descrip-
tion of the international differences in executive compensation.
Llense (2008) applies the
Gabaix and Landier (2008) model to French data.
2
For a detailed review of optimal contracting theories applied to
CEO pay, see Edmans
and Gabaix (2009).
17. CESifo Economic Studies, 55, 3-4/2009 459
Executive Compensation over the 20th Century
extract rents from firms with weak corporate governance; the
monitoring
performed by large shareholders; the effects of peer
benchmarking; and
the role of social norms. I summarize these explanations,
making an
emphasis on the limitations that each one has in accounting for
the
changes in compensation over time using only data for the last
three
decades.
While earlier data provide an alternative ‘laboratory’ to analyze
the
18. different theories on executive compensation, a potential
concern is that
the organization of firms has evolved significantly over time.
However, the
experience of public corporations during earlier decades is
relevant for the
policies implemented in recent years. The role of top managers
has not
changed significantly since the separation of corporate
ownership from
corporate control at the turn of the 20th century (Chandler 1977,
Berle
and Means 1991). Thus, the main issues concerned with the
remuneration
of corporate executives have been prevalent over the longer run.
To provide an involved view of the changes and challenges
experienced
19. by firms over the longer run, I review the experience of GE.
The history of
this successful corporation serves to illustrate a significant
evolution in the
compensation and the labor market for top managers over time.
Relative
to the evidence for the past three decades, the level of pay of
GE’s execu-
tives was significantly lower and grew at a slower rate from the
1940s to
the 1970s.
3
The characteristics of GE’s managers have also changed, from
the executives having education mostly in engineering or law
earlier in the
century to a more diverse educational background since the
1960s.
20. Moreover, recent managers have worked in different sectors of
the firm,
potentially acquiring skills that are more general in nature. The
acquisition
of general human capital may have allowed internal candidates
for the
CEO position to leave the firm for corporations in different
industries
when passed up for the chief executive job.
Since the trends for GE are not unique to this corporation, the
historical
evidence suggests that assessing the mechanisms that determine
executive
pay is still an important challenge. Most of the proposed
theories for the
recent decades do not seem to fit well with the data on
compensation and
21. the characteristics of managers prior to the 1970s. Thus, future
work on
executive compensation can learn from the past to further our
understand-
ing of the present.
3
This pattern in the evolution of compensation for GE’s top
managers is similar to the
trend in pay of the larger sample of firms analyzed in Frydman
and Saks (2008).
460 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
2 The current debate on the determinants of the growth
in executive pay
22. Many different theories have been proposed to explain the
recent rise in
CEO pay. While difficult to categorize them, these explanations
can
broadly be divided between theories that view the level of
executive pay
as a result of competitive forces in the labor and product
markets and
theories that argue that institutions either within or outside the
firm influ-
ence the level of pay. I summarize the most popular
explanations within
these two groups and assess their limitations for explaining the
evolution
of executive compensation over time.
2.1 Competition and executive compensation
2.1.1 Demand for talent and scale effects
In recent years, the view that executive pay is the optimal
response to
supply and demand forces within a competitive labor market for
execu-
tives has gathered increasing support. Models such as Rosen’s
23. (1981, 1982)
propose that competition for scarce managerial talent leads to
relative
higher pay in larger firms in a given year. The marginal product
of a
CEO’s effort is higher in larger firms because the ability of the
chief exec-
utive trickles down a larger number of hierarchical layers.
Consequently,
competition leads to positive assortative matching between
managerial
ability and firm size.
More recently, this idea has been adapted to explain the growth
in
compensation over time (Tervio 2009). Within this framework,
Gabaix
and Landier (2008) argue that changes in the level
compensation over
time should be determined by the growth in the size of the
typical firm
in the economy. Indeed, they find a one-to-one correlation
between CEO
pay and the market capitalization of the median firm among the
largest
24. 500 since the 1970s. According to their view, an increase in the
scale of
firms completely explains the growth in CEO pay over time.
The assessment of this theory presents two main empirical
challenges.
First, a correlation between the level of CEO compensation and
median
firm size does not imply a causal relationship between these two
measures.
Moreover, the documented empirical relationship does not
establish that
the underlying mechanism generating this correlation is actually
caused by
the assignment of scarce managerial talent to firms in a
competitive
market.
2.1.2 Changes in the types of managerial skills
A related view that also relies on a competitive labor market for
executives
argues that the increase in compensation can be explained by a
shift in the
type of skills that firms demand, from firm-specific human
25. capital to
CESifo Economic Studies, 55, 3-4/2009 461
Executive Compensation over the 20th Century
general managerial skills (Murphy and Zábojnı́k 2004). This
theory pre-
dicts that, as general skills become relatively more important,
average pay
increases, more CEOs are hired from outside the firm, and the
disparity
between CEO pay and other top executives at the corporation
increases
(Murphy and Zábojnı́k 2004, Frydman 2007).
This explanation fits well the rising mobility of executives
experienced in
recent decades. While only 15% of new CEO appointments were
26. hired
from outside the firm in the 1970s, almost 33% of the chief
executives
selected from 2000 to 2005 were outsiders (Murphy and
Zábojnı́k 2007).
However, a main challenge for this theory is to quantify
managerial skills.
Moreover, changes in the demand for skills, which is most
likely related to
the production function of firms, probably occurred slowly over
time.
2.1.3 Trade and product market competition
Because labor markets receive a negative signal on the quality
of the man-
agerial team when a firm’s performance suffers, competition in
the prod-
27. uct market may serve as an alternative mechanism to explicit
wage
contracts in the disciplining of managers (Fama 1980).
However, recent
research argues instead that more high-powered incentives are
needed
when product markets are more competitive. In periods of
globalization,
technological innovation, and deregulation, the complexity of
the respon-
sibilities of top management increases, thereby increasing the
demand for
talented executives. Thus, higher performance pay is required to
attract
and provide incentives to top managers. Because a higher level
of pay is
needed to compensate risk-averse executives for the extra risk
28. added by
incentives, the recent growth in pay may be the result of more
competition
in product markets.
An advantage of this explanation is that allows for a cleaner
identifica-
tion strategy than most other theories on executive pay. For
example,
Cuñat and Guadalupe (2009b) find that the sensitivity of pay to
firm
performance, the inequality among top managers within the
firm, and
the probability of turnover increase when competition
(measured by
import penetration) becomes more pronounced. Moreover, pay-
performance sensitivities also increase when industries
deregulate
29. (Hubbard and Palia 1995, Cuñat and Guadalupe 2009a).
Although exog-
enous shocks to competition provide a valuable identification
strategy,
this methodology is more useful for identifying effects of
competition on
pay-to-performance than on the level of pay. Moreover, a
drawback of
using such a precise strategy is that it allows for identifying
only very
particular aspects of competition. Thus, a large fraction of the
variation
in pay over time remains unexplained within this framework.
462 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
30. 2.1.4 The rise of finance and outside options for corporate
managers
In most models proposing a competitive labor market for
executives, the
level of pay is positively associated with the outside option of
top man-
agers. Thus, the recent rise in executive pay could be related to
an increase
in the reward that CEOs can obtain in alternative activities. In
recent
decades, the opportunities and the gains in the financial sector
have devel-
oped dramatically (Kaplan and Rauh 2009). Thus, the increase
in CEO
pay may be an equilibrium effect if highly paid jobs in finance
are a
plausible alternative for top managers.
For this argument to hold, the skills to become a successful
leader in
large public companies and in the financial sector should be
close substi-
31. tutes. However, little is known about the relevant labor market
for CEOs
and other top executives. The supply of executives and the
alternative jobs
that these individuals could engage in is largely unknown,
making it extre-
mely difficult to quantitatively assess this hypothesis.
2.2 Institutional factors inside and outside the firm
2.2.1 Corporate governance and extraction of rents
A large literature has suggested that the high level in executive
compen-
sation is the result of CEOs ability to extract rents from the firm
(Bebchuk
and Fried 2003, 2004). When firms’ boards of directors are not
strong to
limit the power of CEOs, chief executives acting in a self-
interested manner
will skim the firm. According to this view, the level of
executive pay is
excessive and inefficient. Moreover, proponents of this view
argue that the
structure of pay is also the result of poor corporate governance,
32. as
entrenched executives find it easier to reward themselves with
lavish pay-
checks in forms of compensation that are less observable or
harder to
value, as employee stock options, pensions, perquisites, and
severance
payments.
Given some highly publicized cases of managerial power
leading to out-
rageous compensation packages and perks, this hypothesis has
some
merit. Moreover, differences in corporate governance seem to
influence
the specific behavior of executive pay. For example, CEOs in
firms with
weak boards are rewarded for lucky events that increase firm
value but
that are arguably independent of their actions. However, chief
executives
also receive hefty paychecks in firms with strong governance
with the
intent to provide incentives (Bertrand and Mullainathan 2001).
Thus,
33. managerial skimming may be the correct explanation for the
level of com-
pensation in a few firms, but it is less obvious that this theory
can account
for the changes in the median level of pay.
While rent extraction may help explain some of the variations in
pay in
the cross-section, it is more unlikely that the trend in pay over
time is due
CESifo Economic Studies, 55, 3-4/2009 463
Executive Compensation over the 20th Century
to governance practices alone. A steady worsening in the
corporate gov-
ernance of US corporations may help explain the explosion in
pay and in
stock option use since the 1980s, but most available proxies for
gover-
34. nance show no deterioration over this period.
4
Moreover, even a correla-
tion between governance measures and the level or structure of
pay does
not imply that the relationship between these variables is
causal. Since the
governance structure is an endogenous choice of corporations,
identifying
causality is particularly difficult in this context.
2.2.2 Direct monitoring of large shareholders
Although high levels of pay are usually linked to poor corporate
gover-
nance, an alternative view claims that this trend could be
associated with
improvements in governance. As corporate governance
35. strengthens,
boards become more diligent and independent. As a
consequence,
boards are more likely to fire underperforming CEOs who will
be less
able to become entrenched. Thus, the increase in CEO pay could
be a
response to the decline in job stability faced by top managers as
boards’
monitoring ability improves (Hermalin 2005).
Several pieces of evidence are consistent with this hypothesis.
The sta-
bility of top management positions has deteriorated, as
indicated by the
rising likelihood of forced turnover since the 1970s (Huson,
Parrino, and
Starks 2001) and the decline in CEO tenure since the mid-1990s
36. (Kaplan
and Minton 2006). Moreover, boards’ ability to monitor CEOs
has likely
improved in recent years.
5
However, arguments similar to those made in
Section 2.2.1 highlight the difficulties of empirically evaluating
this theory
with available data.
2.2.3 Peer benchmarking
Most corporations set CEO pay using as a benchmark the
compensation
at a peer group composed of similar companies. The practice of
com-
petitive benchmarking is regarded as generating a ratchet effect
that
37. leads to continuous growth in the level of pay (Murphy 1999).
To signal
to the market that the incumbent CEO is of high-quality, firms
award their
chief executives a level of compensation above median pay in
their rele-
vant peer group.
6
If boards set compensation in this manner, the median
4
For example, a comprehensive index based on corporate
governance provisions and state
laws indicates no change in shareholders’ rights for the median
or average firm among
1500 large corporations over the 1990s (Gompers et al. 2003).
5
For example, the presence of independent directors at boards
has increased over time
(Lehn et al. 2003).
38. 6
A pay level below the 50th percentile is often labeled ‘below
market’, perhaps providing a
negative signal to the market.
464 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
level of pay increases every year independent of the
performance of the
firm, leading to excessively high remuneration.
Arguably, the role of compensation consultants in the
determination of
CEO pay has increased since the 1970s (Khurana 2002).
However, this fact
alone does not validate peer benchmarking as a major force in
the growth
of compensation. Indeed, Bizjak, Lemmon and Naveen (2008)
suggest that
the practice of peer benchmarking may be an efficient way to
39. determine
the value of a CEO in a competitive market and retain
managerial talent.
In particular, they find that peer-group benchmarking is more
correlated
to economic factors (measured by the labor market conditions
and firm
performance) than to the corporate governance of firms.
2.2.4 Social norms
The growth in top management pay experienced in the USA
since the
1970s happened concurrently with a pronounced increase in
income
inequality. The disparity in pay was driven mostly by an
expansion in
income levels at the top of the distribution (Piketty and Saez
2003).
Thus, it is possible that the factors driving these two phenomena
are
related. I analyzed two of the main hypothesis for the change in
income
40. inequality (trade and skilled-biased technical change) and their
relevance
for executive pay in Section 2.1. However, a third main factor
to be con-
sidered is changes in social norms. According to this view, the
rise in
income inequality in the past three decades is a consequence of
the
removal of social norms that constrained the level of pay in the
postwar
period (Piketty and Saez 2003, Levy and Temin 2007).
A limitation of this hypothesis is that social norms are not
easily quan-
tifiable, making it difficult to assess the importance of this
explanation
empirically. Thus, the relevance of social norms for the trends
in executive
compensation is difficult to validate or disprove.
3 Learning from the past: executive compensation as a
longer-run concern
41. Using a cross-section of firms, the empirical evidence appears
to support
many of the theories discussed in Section 2. Which ones, then,
can account
for the changes in executive compensation over time? Most of
the pro-
posed arguments rely on measures that have changed
monotonically since
the 1970s. Because executive pay was mostly trending upward
during this
period, there is little evidence on a causal relationship between
each of the
relevant variables and the changes in compensation over time.
Thus, as
argued in more detail by Frydman and Saks (2009), the
determinants for
the time-series of executive pay are not well established.
CESifo Economic Studies, 55, 3-4/2009 465
Executive Compensation over the 20th Century
42. To better understand the mechanisms responsible for the
evolution in
the level and structure of pay over time, a viable channel is to
look for
alternative sources of variation to evaluate the validity of each
theory out
of sample.
7
One plausible source is to focus on an earlier time period,
when the changes in executive compensation were considerably
different.
This exercise is relevant because, as I argue in Section 3.1, the
compensa-
tion of top executives has been a main problem for corporations
ever since
the separation of corporate ownership from corporate control
during the
43. beginning of the 20th century (Berle and Means 1991).
Moreover, I show
in the next section that analyzing executive pay during earlier
decades is
possible because systematic data on the remuneration of top
managers is
available since the mid-1930s.
3.1 Earlier evidence on managerial pay
In the early 20th century, compensation practices were closely
guarded
secrets. In consequence, only scattered historical evidence
exists on execu-
tive salaries at that time.
8
Revelations regarding executive pay first
occurred during World War I, when railroad corporations
44. became man-
aged by the federal government and the exorbitant salaries of
railroad
officers were exposed. Public scrutiny intensified during the
1920s, and
information on the compensation of railroad and banking
executives was
published in the popular press.
9
By the early 1930s, the controversy surrounding the level of pay
had
extended to executives in all businesses. As the economy
slipped into the
Depression, the nation became increasingly troubled by the
‘‘lavish sti-
pends and bonuses’’ accruing to the managers of large public
corpora-
45. tions.
10
Prompted by these concerns, the Reconstruction Finance
Corporation, the Federal Trade Commission, and several other
institu-
tions requested information on the compensation of officials in
firms
under their respective jurisdictions.
11
These dispersed efforts to monitor
7
This argument follows Frydman and Saks (2009). In this article,
I extend their analysis to
a larger set of theories that can be studied in the context of a
case study.
8
Court records are a possible source of information for this
46. period, because they occa-
sionally reveal the remuneration of corporate officers (Baker
1938). Alternatively, one
could rely on payroll records from individual firms.
9
See, for example, ‘‘Explains Big Salary of Railroad Head.
Charles Frederick Carter Says
Competent President Earns it Many Times’’, New York Times,
24 December 1922;
‘‘Comptroller Seeks Salary Data From National Banks’’, Wall
Street Journal, 25 February
1921; ‘‘Commerce Commission Goes Into Executives’
Salaries’’, Wall Street Journal, 23
December 1922; ‘‘They Earn Their Salaries’’, Wall Street
Journal, 27 February 1923.
10
‘‘Inquiry into High Salaries Pressed by the Government’’, New
York Times, 29 October 1933.
11
For example, the Federal Trade Commission was directed to
collect information on the
salaries of executives from the companies listed in the NYSE in
47. 1933 (Senate Resolution
No. 75, 73rd Congress).
466 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
the compensation practices of major corporations were
centralized with
the establishment of the Securities and Exchange Commission
(SEC)
in 1934.
Created to enforce the Securities Exchange Act of 1934, the
SEC was
put in charge of the disclosure of data by firms participating in
the secu-
rities market, thereby regulating corporate finance (Seligman
2003).
48. Disclosure of information related to the remuneration of
executive officers
and directors was intended to deter managers from engaging in
wrongful
behavior and mismanaging corporate assets (Loss and Seligman
1995).
Thus, the inception of the SEC has made executive
compensation data
available to the public from the 1930s to the present.
These data, reported in 10-K reports and proxy statements, have
been
used by researchers to analyze executive compensation at
several points in
time and, more recently, systematically by Frydman and Saks
(2009), pro-
viding a consistent view of how compensation evolved over the
longer run.
49. Thus, the theories proposed to explain evolution of pay over the
past 30
years should be contrasted against the now well-established
facts on exec-
utive compensation over most of the 20th century.
3.2 A case study of executive compensation at GE
To provide a more involved view of the changes in
compensation policies
and in the labor market for managers over time, I use the history
of GE as
an illustration. This corporation is a primary example of
corporate, finan-
cial, and technological success of the 20th century.
12
3.2.1 Brief history of GE
GE was constituted as a firm that operated in the electrification
50. business
in 1892 when Edison Electric Light Company, founded by
Thomas Edison
only 2 years earlier, merged with its competitor Thomas–
Houston Electric
Company. Over time, and as many other large successful firms
in the
economy, the business of GE evolved, mostly prompted by
savvy man-
agers who were able to anticipate future challenges. Over time,
GE became
a highly diversified multinational business, operating in several
different
sectors. The first stage of diversification came very early in the
20th cen-
tury. With the establishment of GE Labs, the pinnacle of
scientific
51. research within a corporation at that time, the company
expanded into
the manufacturing of transformers (1903), radio technology
(1920s), and
12
For example, GE is the only firm of the original 12 companies
that constituted the Dow
Jones Industrial Index in 1896 still belonging to it. Moreover,
when Irving Langmuir
won the Nobel Prize in Chemistry in 1932, he became the first
individual to receive such
award for research performed outside an academic institution.
CESifo Economic Studies, 55, 3-4/2009 467
Executive Compensation over the 20th Century
silicone and nuclear power (1940s). The 1960s and 1970s were
a period of
diversification and GE was no exception, growing into sectors
52. as diverse
as aerospace, computers, and mining. As for many other firms
becoming
large conglomerates at that time, this fast growth came without
significant
improvements in stock market performance. Thus, the following
two dec-
ades saw a refocus of the corporate strategy, shifting from
manufacturing
to technology and (mainly financial) services, as well as
increasing the
presence of the company abroad. The company changed its
focus again
during the past decade, by diminishing the reliance on financial
services
and mature industrial businesses, expanding instead into
healthcare and
entertainment. By 2007, the financial unit, GE Capital, still
accounted for
about 42% of the firm’s profits. Deeply affected by the current
financial
crisis, the downturn in the unit has had severe consequences on
the entire
company, and the future economic health of GE is now
uncertain.
53. 3.2.2 Top management at GE and the specificity of skills
Table 1 provides information on the demographic characteristics
of all
presidents, chairman, and CEOs of GE since the firm’s
inception. Over
the many challenges faced throughout its history, only 12 top
executives
led GE.
One of the main explanations for the trends in executive
compensation is
a shift from specific to more general managerial skills.
Educational and
career background can plausibly inform on the types of skills of
managers.
Thus, Table 1 lists the educational degrees obtained by GE’s top
man-
agers. Up to the late 1950s, almost all of GE’s CEOs had a
college edu-
cation and had specialized in either engineering or law.
Depending on this
background, they had mainly worked their way up either in
production or
54. in the legal department before moving into general management.
The
education of GE’s top executives became more varied since the
1960s: in
the past four decades, these individuals had degrees in
economics, engi-
neering, or mathematics. Moreover, Jeffrey Immelt is the first
CEO at GE
to hold an MBA degree, reflecting the growing importance of
business
education in the careers of top managers more generally. The
educational
and career background of GE’s top managers are indicative of a
broader
trend in the market for executives: top managers had their
highest degree
in engineering or general science up to the 1960s but the
likelihood of
degrees in finance and management have steadily increased
since then
(Frydman 2007).
As revealed by the available biographical information, the work
expe-
rience of top managers has also evolved considerably. Prior to
55. the 1970s,
most top managers worked mainly in one sector of the firm (as
produc-
tion, finance, or the legal department) throughout their entire
career. Since
then, a broader experience has become more important, perhaps
because
468 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
T
a
b
le
1
C
h
a
ra
ct
146. top managers are now required to lead corporations that are
more diver-
sified in nature. As a consequence, many firms established
programs to
rotate promising managers across different sectors. For
example, Reginald
H. Jones, GE’s CEO from 1972 to 1981, worked as a manager in
con-
sumer, utility, industrial, construction, and distribution fields
after being
assigned into general management, before becoming the chief
financial
officer of the corporation in 1968. Thus, he plausibly acquired
skills in
several different areas of the firm that contributed to his success
as a chief
executive of a widely diversified corporation.
GE’s top executives were rising through the ranks of the
company, as
displayed by their fairly long tenure: the shortest tenure of a
chief execu-
tive lasted 5 years while three CEOs remained at the position
for at least 20
147. years. Excluding the early CEOs who joined the firm when it
was founded,
Jeff Immelt had the shortest tenure at the firm (a total of 18
years) among
these nine individuals when he was appointed CEO in 2001 (see
Table 2).
At first pass, the evolution of managerial characteristics at GE
reveals
somewhat conflicting evidence regarding the composition of
skills of top
managers. Both the change in educational background (from
science and
engineering to finance and management) and in functional
experience
(from working in one sector to rotating across different sectors)
suggests
that skills have become more general over time. In contrast, the
long
tenure at the firm could indicate that firm-specific skills are
relevant.
However, those top managers passed up for the chief executive
position
usually leave the firm to lead a company in, often, fairly
different sectors.
148. For example, when GE selected Jeff Immelt in 2001 for the
CEO position,
W. James Mc Nerney Jr. and Robert L. Nardelli, the two
contenders from
the firm that were passed up for the job, quickly left to become
CEOs in
firms as different from GE as 3M and Home Depot,
respectively. The
ability and willingness to move to a firm in different industry
late in the
career suggest that the skills of these top executives were
mostly general.
The evidence from GE suggests that change in the importance of
skills
from firm specific to general occurred slowly over time. Thus,
this theory
does not seem to account for the sharp change in the level of
compensa-
tion for GE’s top managers that occurred in the 1970s, as
described in
Section 3.2.3.
3.2.3 Executive compensation at GE
149. A historical study in executive compensation is feasible for
USA because
the Securities and Exchange Commission has required publicly
traded
corporations to disclose the pay of the three highest paid
officers since
its inception in the 1930s. Using GE’s proxy statements, Figure
1 shows
the trend in salaries and bonuses (either cash or stock, both
awarded and
paid out in the given year), as well as the evolution in total
compensation
CESifo Economic Studies, 55, 3-4/2009 471
Executive Compensation over the 20th Century
(salaries and all bonuses plus the Black–Scholes value of stock
option
grants) for the three highest-paid officers. Because evidence for
a single
firm is intrinsically fairly noisy, the trends in pay are calculated
using a 3-
150. year moving average.
Prior to the 1950s, the remuneration of GE’s top officers was
entirely
composed of salaries and current bonuses prior to the 1950s.
Perhaps
prompted by extremely high labor income tax rates, forms of
compensa-
tion more directly tied to the performance of the firm started
being used at
mid-century. Since the 1950s, deferred bonuses tied to firm and,
on occa-
sion, to individual performance gained importance.
13
Perhaps more sur-
prising is that employee stock options became frequently used
to
remunerate ‘key employees’ over this period (see Figure 1).
GE established its first stock option plan in 1953. Since high
taxes on
labor income reduced the attractiveness of cash compensation,
options
151. had a considerable tax advantage since the 1950s. The 1950
Revenue
Act determined that, when satisfying a series of qualifications,
‘restricted’
stock options could be taxed at the much lower rate on capital
gains.
Introducing the new plan, GE’s management argued to their
shareholders;
Since [. . .] the Internal Revenue Code amendment in 1950 [. . .]
over 200
companies whose stock is listed on the NYSE, including many
compe-
titors of your Company, have adopted stock option plans . . .
[Such a
plan] is essential if the Company is to compete successfully
with other
companies for the services of individuals of outstanding ability
and
accomplishment.
General Electric’ Proxy Statement, 20 March 1953
GE’s proxy statement suggests that, by helping the firm to get
around
152. prohibitive taxation, stock options allowed the firm to compete
for man-
agerial talent, although they accounted for a small fraction of
total pay at
that time (see Figure 1). More importantly, corporations were
aware of its
competitors’ compensation policies and, probably, of the level
of remu-
neration awarded to other top executives even during this
period. Thus,
the market for managers and, in particular, their compensation
may have
been more integrated during earlier decades than previously
thought.
The evolution of the total real level of pay for GE’s three
highest-paid
executives indicates that there were two distinct periods in
remuneration
policies. First, the total real level of pay for GE’s top three
managers
13
In the case of GE, these bonuses were mainly paid out after the
executives had retired.
153. However, many other large firms established incentive
compensation plans that awarded
bonuses to be paid out in cash or in stock over a number of
years (Frydman and Saks
2009).
472 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
increased at a slow rate of about 2% per year from the 1940s to
the 1960s.
This period of little growth was followed by a rapid
acceleration in top
management pay, mostly encouraged by the increasing use of
stock
options since the 1980s and of restricted stock since the 1990s.
From the
1970s to the present, the compensation of the three highest-paid
officers at
GE has grown at the significantly higher annual rate of 8%.
These trends
in pay are also evidenced when restricting the sample to
154. Presidents,
Chairmen, and CEOs. Table 2 shows the average pay for each of
these
top managers over the years in which they were listed in proxy
statements.
Compensation increased sharply for three chief executives who
led the
firm since the 1970s.
Executive compensation behaved in a different manner in the
past,
generating a different relationship between executive
compensation and
several of the proposed determinants for the recent increase in
pay over
Figure 1 The real level of total executive compensation at GE.
Notes: Compensation is measured as the 3-year moving-average
for each measure
of pay for the three highest-paid executives as reported in GE’s
proxy statements.
Salary and Bonus are defined as the level of salaries and current
bonuses both
155. awarded and paid out in the year. Long-Term (L-T) Bonus
measures the amount
paid out in the year from long-term bonuses awarded in prior
years. Stock
Option Grants is defined as the Black–Scholes value of stock
options granted
in the given year. Total compensation is the sum of salary,
bonus, long-term
bonus, and the Black–Scholes value of stock options granted.
The real level of
pay is calculated in millions of $2000, using the CPI.
CESifo Economic Studies, 55, 3-4/2009 473
Executive Compensation over the 20th Century
the earlier decades. In particular, it is possible to analyze the
relevance of
two main theories discussed in Section 2 in light of GE’s
evidence.
First, the long-run trends in pay do not appear to be driven by
156. the
growth in aggregate firm size, as predicted by the theories on
demand
for talent and the scale of firms described in Section 2.1.1.
Figure 2
shows that the level of total compensation for GE’s three
highest-paid
executives was highly correlated with the S&P index since the
1980s.
14
However, this correlation was not present from the 1950s to the
1970s,
a period in which compensation increased at a slow pace
through a rapid
expansion and a significant contraction in the stock market.
15
Thus,
increasing size in the typical firm in the economy has not
157. always been
reflected in higher compensation at GE.
Another view is that corporate governance is a key determinant
of com-
pensation. As described in Section 2.2.1, the sharp increase in
compensa-
tion could be explained if managers’ ability to extract rents
increased, as
the firm’s corporate governance grew weaker. While measuring
gover-
nance is intrinsically difficult, two proxies for governance can
be con-
structed over time. Table 3 presents information on the size of
the
board of directors and the fraction of directors that were
insiders (officers
of the firm in that year) in 1936, 1950, 1970, and 1990. Larger
boards have
158. been linked to less effective monitoring, since in this case the
CEO could
be more prone to influencing the directors’ decisions (Jensen
1993,
Yermack 1996). A high fraction of insiders may indicate poor
governance
as insiders may weaken the monitoring abilities of a board if
they are more
loyal to the CEO. On the other hand, inside directors may have
more
information about the workings of the firm. In the context of
GE, top
executives were awarded both high and low levels of pay in
periods of
large board size. Moreover, the composition of the board of
directors
remained fairly stable since the 1950s while compensation
changed
159. dramatically.
An alternative mechanism for control and monitoring is the
presence of
large blockholders. If the growth in pay is related to weak
governance, the
concentration of ownership could reduce CEOs ability to extract
rents by
providing direct monitoring. On the other hand, large
blockholders may
14
To be consistent with the trends in compensation, the S&P
index is also calculated as a
3-year moving average.
15
The theory on increasing returns to firm scale implies that the
evolution in compensation
over time should be determined by the size of the typical firm in
the economy. I approx-
imate the typical firm using the S&P index, but similar results
would be obtained using
160. the market value of a sizable sample of large firms, as the S&P
500 or all firms in
ExecuComp. Except for a smaller increase during the 1950s and
1960s, the evolution
of market value for GE followed a similar pattern than the S&P
index.
474 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
lead to hire pay if improvements in monitoring lead to a higher
likelihood
of being fired, as discussed in Section 2.2.2. Neither of these
mechanisms
applied to GE. While systematic long-run evidence on firm
ownership is
not available, information from the 1930s and the 1990s reveals
that GE
161. did not have a large blockholder (measured as an individual or
institution
owning at least 5% of the shares outstanding). Ever since its
inception, the
ownership of GE has been fairly dispersed.
Figure 2 Real total executive compensation at GE and the S&P
Index.
Notes: Compensation and the S&P index are measured as a 3-
year moving-
average. Total compensation is the sum of salary, bonus, long-
term bonus,
and the Black–Scholes value of stock options granted the three
highest-paid
executives as reported in GE’s proxy statements. The real level
of pay is calcu-
lated in millions of $2000, using the CPI. The S&P index is also
expressed rel-
ative to the CPI and equals 1 in 2000.
Table 3 Board size and board composition
162. Year Board size Fraction of inside directors
1935 19 31.58
1950 17 11.76
1970 12 16.67
1990 18 11.11
Note: Board size and composition was obtained from the
corresponding volumes of
Moody’s Manual of Investments. Inside directors are identified
as the members of the
board that are also listed as officers of the firm in Moody’s.
CESifo Economic Studies, 55, 3-4/2009 475
Executive Compensation over the 20th Century
Thus, according to these different measures, there is no
evidence that
163. changes in corporate governance at GE relate to the evolution of
compen-
sation at the firm. The historical evidence indicates that
corporate gover-
nance, increasing returns to scale in a competitive labor market,
and
changes in managerial skill types cannot account for the
changes in top
executive compensation at GE over the longer run.
3.2.4 Representativeness and generalization of the findings
Focusing on a particular company allows revealing both general
trends as
well as emphasizing that the experiences of particular firms and
managers
are, to a large extent, idiosyncratic. However, it is important to
relate the
164. evidence for GE to more general, stylized facts on compensation
and
managerial careers that have been put forth by the existing
literature.
Moreover, new long-run facts can be used to illuminate the
current
debate on the drivers of executive pay.
While GE is only one and a particularly successful firm, the
trends in
compensation described for its three highest-paid officers match
closely
the more general trends uncovered in the literature. Using a
more com-
prehensive set of firms, Frydman and Saks (2009) show that the
pattern in
executive pay changed substantially over time. Following World
War II,
executive pay remained fairly constant for almost three decades.
This is
165. surprising relative to current evidence because the governance
of corpora-
tions was arguably weaker, the ownership of firms was more
dispersed
than in recent years, and firms were also growing and becoming
more
complex during this earlier period. Thus aggregate data as well
as GE’s
information suggest that returns to scale and corporate
governance cannot
on its own account for the long-run changes in compensation.
In contrast to other firms, GE did not experience much change
in its
governance or ownership structure, but its size and complexity
grew at par
with other large successful firms. Moreover, anecdotal evidence
from GE
and other corporations suggests that firms were aware of and
166. took the
compensation strategies of competitors into account when
determining the
pay of their top managers, at least since the disclosure of pay
data started
being required by the SEC in the 1930s. Thus, it is unlikely that
the growth
in CEO pay in the past three decades was triggered by a sudden
ratcheting
effect induced by compensation consultants.
It is difficult to argue that the competition in product markets
did not
increase as well during the 1950s and 1960s, a period of little
change in
executive compensation for GE and for other firms in the
economy.
However, trade and globalization may have affected firms at the
end
167. of this period in a different manner, by altering the tasks that
executives
were responsible for and, consequently, the market for managers
476 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
more broadly.
16
The history of GE is indicative of an important transfor-
mation in the market for top managers. Once large corporations
were
relatively mature by the 1950s and 1960s, the market for top
managerial
talent took place mostly within the organization. These
‘organization men’
rose through the ranks of the firm, most often than not working
their way
up in one particular area of the firm (usually in production or in
the legal
168. department) (Whyte 1956). Managerial skills seem to have been
mostly
firm-specific; top executives usually had an educational
background in
science or engineering, were exposed to a single area of the
firm before
becoming general managers, spent most of their career at the
same cor-
poration, and rarely moved to a different firm late in their
career (even
when passed up for the chief executive position). The
characteristics of
GE’s top managers discussed in Section 3.2.2 fit perfectly with
this general
description.
The slow but steady growth in the importance of business
education and
the increasing diverse sectoral experience of managers in the
economy
indicate that managerial skills have become more general in
nature since
mid-century. While the skills of GE’s top managers have also
become
more general in nature, a difference relative to the overall
169. market is that
GE maintains a policy of forming and recruiting its own top
managerial
talent within the organization. All of GE’s top executives have
come from
within the firm, had a long tenure before reaching the CEO
position and,
thus far, have not been fired. This contrasts sharply with the
evidence for
the overall market for managers. As discussed in Section 2.1.2,
the likeli-
hood of selecting an outsider for the CEO position has more
than doubled
in the past three decades. But perhaps this difference is
somewhat endo-
genous, as GE has a reputation for being one of the best
producers of
corporate leaders.
Selecting the CEO from within the organization does not
necessarily
imply that the skills of the managers are firm specific. In fact,
the behavior
of the market for managers indicates that the mobility of
executives across
170. industries and organizations has increased, as top managers
passed up for
the CEO position in corporations selecting insiders as chief
executives are
often poached by other firms. The responsibilities of top
executives appear
16
Anecdotal evidence suggests that a shift in the demand for
managerial skills occurred as
firms evolved during the 1950s and 1960s due to globalization,
competition, and
increases in the complexity of large corporations. For example,
Packard (1962) empha-
sizes that ‘‘Both the competition and the new markets that
European unity promises—
plus the need of US companies to expand significantly to
develop world markets—call
for new imaginative kinds of business leadership. [. . .] There is
grave doubt that America
industry has been developing enough of the kind of leaders who
will be competent to
guide their enterprises effectively in this new environment.’’
CESifo Economic Studies, 55, 3-4/2009 477
171. Executive Compensation over the 20th Century
to have evolved over time, arguably from tasks requiring mostly
firm-
specific skills to decisions based on general human capital that
could be
applied in diverse firms. However, the pace and magnitude of
these
changes (both at GE and in the economy) suggest a relatively
minor
role of a shift in the types of managerial skills on the long-run
evolution
in compensation (Kaplan and Rauh 2009, Gabaix and Landier
2008).
In sum, GE has been one of the best performers throughout the
entire
172. 20th century, but the trends in the level and structure of
compensation for
its top executives and the characteristics of its managers are
fairly repre-
sentative of most large publicly traded corporations. Earlier
data provides
a new environment to contrast the main theories for the recent
rise in CEO
pay.
17
Available evidence suggests that the proposed explanations do
not
fit well with the long-run trends, raising new challenges to
provide an
understanding of the evolution of executive compensation and
the labor
market for corporate managers.
173. 4 Conclusion
In this article, I argue that the lack of consensus on the
determinants for
the recent increase in CEO and other top management pay is in
part
associated with the use of quantitative evidence that is limited
to the
past three decades. Because the changes in compensation have
been
fairly monotonic over this period, an understanding of the time-
series
evolution of pay has been limited.
An alternative strategy to better grasp the mechanisms that
affect exec-
utive compensation is to learn from the past by assessing the
main pro-
174. posed theories using data for other countries or other time
periods. In
particular, the disclosure of compensation for publicly traded
corpora-
tions allows this exercise for US firms since the 1930s. These
historical
data reveal a complex picture of the evolution of managerial
pay and the
market for managers. Moreover, most of the common
explanations for the
recent changes in compensation cannot individually account for
its evo-
lution over the long run. To match the trends suggested by the
quantita-
tive and anecdotal evidence for the 20th century, future research
should
evaluate new views of the determinants of pay as well as
175. address how the
relevant explanations have changed over time.
17
Two remaining theories, the importance of social norms and
outside opportunities for
managers, are hard to assess empirically because it difficult to
construct relevant proxies.
478 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
References
Bebchuk, L. A. and J. M. Fried (2003), ‘‘Executive
Compensation as an
Agency Problem’’, Journal of Economic Perspectives 17, 71–92.
Bebchuk, L. A. and J. M. Fried (2004), Pay without
Performance: The
Unfulfilled Promise of Executive Compensation, Harvard
176. University
Press, Cambridge.
Berle, A. A. and G. C. Means (1991), The Modern Corporation
and Private
Property, Transaction Publishers, New Brunswick, NJ.
Bertrand, M. and S. Mullainathan (2001), ‘‘Are CEOs Rewarded
for
Luck? The Ones Without Principals Are’’, Quarterly Journal of
Economics 116, 901–932.
Bizjak, J. M., M. Lemmon and L. Naveen (2008), ‘‘Does the
Use of Peer
Groups Contribute to Higher Pay and Less Efficient
Compensation?’’
Journal of Financial Economics 90, 152–168.
Chandler, A. D. Jr. (1977), The Visible Hand. The Managerial
Revolution
in American Business, The Belknap Press of Harvard University
Press,
MA.
Cuñat, V. and M. Guadalupe (2009a), ‘‘Executive Compensation
177. and
Competition in the Banking and Financial Sectors’’, Journal of
Banking and Finance 33, 439–474.
Cuñat, V. and M. Guadalupe (2009b), ‘‘Globalization and the
Provision
of Incentives Inside the Firm: The Effect of Foreign
Competition’’,
Journal of Labor Economics 27, 179–212.
Fama, E. F. (1980), ‘‘Agency Problems and the Theory of the
Firm’’,
Journal of Political Economy 88, 288–307.
Frydman, C. (2007), ‘‘Rising through the Ranks: The Evolution
of the
Market for Corporate Executives, 1936–2003’’, Working Paper,
MIT
Sloan School of Management.
Frydman, C. and R. Saks (2009), ‘‘Executive Compensation: A
New View
from a Long-Term Perspective, 1936–2005’’, NBER Working
Paper No.
W14145.
178. Gabaix, X. and A. Landier (2008), ‘‘Why has CEO Pay
Increased So
Much?’’ Quarterly Journal of Economics 123, 49–100.
Gompers, P., J. Ishii and A. Metrick (2003), ‘‘Corporate
Governance and
Equity Prices’’, Quarterly Journal of Economics 118, 107–155.
Hall, B. J. and J. B. Liebman (1998), ‘‘Are CEOs Really Paid
like
Bureaucrats?’’ Quarterly Journal of Economics 113, 653–691.
Hermalin, B. E. (2005), ‘‘Trends in Corporate Governance’’,
Journal of
Finance 60, 2351–2384.
CESifo Economic Studies, 55, 3-4/2009 479
Executive Compensation over the 20th Century
Hubbard, R. G. and D. Palia (1995), ‘‘Executive Pay and
Performance:
179. Evidence from the U.S. Banking Industry’’, Journal of Financial
Economics 39, 105–130.
Huson, M. R., R. Parrino and L. T. Starks (2001), ‘‘Internal
Monitoring
Mechanisms and CEO Turnover: A Long-Term Perspective’’,
Journal of
Finance 56, 2265–2297.
Jensen, M. C. (1993), ‘‘The Modern Industrial Revolution, Exit,
and the
Failure of Internal Control Systems’’, Journal of Finance 48,
831–880.
Kaplan, S. N. and B. A. Minton (2006), ‘‘How has CEO
Turnover
Changed? Increasingly Performance Sensitive Boards and
Increasingly
180. Uneasy CEOs’’, NBER Working Paper No. W12465.
Kaplan, S. N. and J. Rauh (2009), ‘‘Wall Street and Main
Street: What
Contributed to the Rise in the Highest Incomes?’’ Review of
Financial
Studies, forthcoming.
Khurana, R. (2002), ‘‘Searching for a Corporate Savior’’, The
Irrational
Quest for Charismatic CEOs, Princeton University Press, NJ.
Lehn, K., S. Patro and M. Zhao (2003), ‘‘Determinants of the
Size and
Structure of Corporate Boards: 1935–2000’’, Working Paper,
University
of Pittsburgh.
Levy, F. S. and P. Temir (2007), ‘‘Inequality and Institutions in
20th
181. Century America’’, MIT Department of Economics Working
Paper
No. 07–17.
Llense, F. (2008), ‘‘French CEO Compensations: What is the
Cost of a
Mandatory Upper Limit?’’ Working Paper, CESifo Working
Paper
Series No. 2402.
Murphy, K. J. (1999), ‘‘Executive Compensation’’, in O.
Ashenfelter and
D. Card (eds.) Handbook of Labor Economics, vol. 3B, North
Holland,
Amsterdam, New York, pp. 2485–2563.
Murphy, K. J. and J. Zábojnı́k (2004), ‘‘CEO Pay and Turnover:
A
182. Market Based Explanation for Recent Trends’’, American
Economic
Review (Papers and Proceedings) 94, 192–196.
Murphy, K. J. and J. Zábojnı́k (2007), ‘‘Managerial Capital and
the
Market for CEOs’’, Working Paper, University of Southern
California.
Packard, V. (1962), The Pyramid Climbers, McGraw-Hill Book
Company,
Inc, New York.
Piketty, T. and E. Saez (2003), ‘‘Income Inequality in the
United States:
1913-1998’’, Quarterly Journal of Economics 118, 1–39.
Rosen, S. (1981), ‘‘The Economics of Superstars’’, American
Economic
Review 71, 845–858.
183. 480 CESifo Economic Studies, 55, 3-4/2009
C. Frydman
Rosen, S. (1982), ‘‘Authority, Control and the Distribution of
Earnings’’,
Bell Journal of Economics 13, 311–323.
Seligman, J. (2003), The Transformation of Wall Street, Aspen
Publishers,
New York.
Tervio, M. (2009), ‘‘The Difference That CEOs Make: An
Assignment
Model Approach’’ American Economic Review 98, 642–668.
Whyte, W. H. Jr. (1956), The Organization Man, Simon and
Schuster,
New York.
Yermack, D. (1996), ‘‘Higher Market Valuation of Companies
with a
184. Small Board of Directors’’, Journal of Financial Economics 40,
185–212.
CESifo Economic Studies, 55, 3-4/2009 481
Executive Compensation over the 20th Century
Copyright of CESifo Economic Studies is the property of
Oxford University Press / UK and its content may not
be copied or emailed to multiple sites or posted to a listserv
without the copyright holder's express written
permission. However, users may print, download, or email
articles for individual use.