crucial AccountabilityAs a nurse leader What confrontations .docx
•Download as DOCX, PDF•
0 likes•2 views
c rucial Accountability As a nurse leader What confrontations do you typically avoid or instigate? Do you use tricks to talk yourself out of speaking up or are you one who always speaks? talk about the silence-to-violence habit in healthcare and how it affects health care staff Please use peer reviewed articles and add references APA style between 150 and 200 words in length. .
Report
Share
Report
Share
Recommended
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docx
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docx
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
Recommended
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docx
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docx
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
Cryptography
Lesson 10
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
© (ISC)2 ® 2010, All Rights Reserved
For Personal Use of (ISC)2 Seminar Attendee Only
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
CISSP-ISSEP® Bootcamp Seminar v10
Technical Management
Public Key Infrastructure
Chapter 7
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
2
Key Management
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
3
2
Usage Control
5
6
7
Storage
Recovery
Escrow
8
Zeroization
1
3
Creation
Change and Expiry
4
Distribution
Creation
Automated key generation
Truly random
Suitable length
Key encrypting keys
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
4
Key Usage Control
Management has a vested interest in what activities or content may be hidden in cryptographically protected communications or files
They may create a policy that allows management to audit or decrypt encrypted data at their discretion
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
5
Key Change and Expiry
In any environment, plans should be made to update keys periodically
Generating symmetric keys is easy, but delivering them is expensive since you will be delivering [N*(N-1)]/2 keys to N users
Expiry
Expiry ensures that a key is never overused
Expiry based upon:
Amount of traffic
Amount of traffic over time
Time-in-use
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
6
Distribution
Out of band
Public key encryption
Secret key construction
Secret key delivery
Key Distribution Centers (KDC)
Certificates
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
7
Storage
Trusted hardware
Smartcards
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
8
Recovery
Split knowledge
Multi-party key recovery (MPR)
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise.
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCI 352 - Digital Forensics
Assignment #1
Spring 2020
Due Date: Tuesday, February 25, 2020
Total Points: 100
You are going to write a Python program that represents a command line version of a hexadecimal editor.
This program will be similar to the Linux built-in command line hexadecimal editors such as xxd and
hexdump.
The program will first ask the user to enter the name of any file you want to read. Your program will then
print the binary contents of the file into the standard output (screen). The output will be divided into three
main sections: the offset values in decimal, sixteen space-separated hexadecimal bytes, followed by the
same sixteen bytes but in ASCII value. The figure below shows an example of the first 48 bytes of an
output, and the three different sections:
Notice that in the 2nd section there a space between the 8th and 9th byte. Each output line represents 16 bytes.
The first column shows the decimal offset, where the first byte from the first line represents the 0th byte;
the second line starts with byte 16th and so on. The final section only shows the printable ASCII characters.
These are the ASCII characters can be printed on the screen (usually they are the characters with ASCII
values between 0x20 and 0x7EThe rest of the unprintable bytes are replaced by a period ('.'). The following
built-in Python functions will be useful in this situation: chr, hex, ord. More information about these
functions can be found here: https://docs.python.org/3/library/functions.html
What to hand in
Submit your program electronically through D2L. Please hand in the Python program (.py file or.ipynb)
offset
Hexadecimal Values
ASCII Values
https://docs.python.org/3/library/functions.html
© 2016 by Pearson Education, Inc.
*
THINK CRITICALLY, FACIONE & GITTENS
Chapter 12
Comparative Reasoning
© 2016 by Pearson Education, Inc.
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Learning OutcomesExplain comparative reasoning and how it impacts our understanding of novel situationsApply correctly the five criteria for the evaluation of comparative reasoningDescribe the uses, benefits, and risks of comparative reasoning
Learning OutcomesChapter first explains comparative reasoning and how it impacts our understanding of novel situations.It then applies correctly the five criteria for the evaluation of comparative reasoning.The chapter finally describes the uses, benefits, and risks of comparative reasoning.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Chapter Opening Video
Chapter Opening VideoThe video talks about comparative reasoning.It shows the importance of identifying and evaluating the comparative reasoning and the analogies.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
This is Like That—Recognizing Comparative ReasoningOur minds crave patternsComparative, ideological, and emp.
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docx
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docx
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Cryptography KeysCryptography provides confidentiality, inte.docx
Cryptography Keys
Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use.
Let’s say you work for one of the following types of industry:
Manufacturing
Government
Research
Service
Consulting
After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week.
.
CSC-162 Final ProjectMedia LibraryCreate a program that will.docx
CSC-162 Final Project
Media Library
Create a program that will keep track of a media library to store movies. It will store all of the data using arrays. Since we have not learned how to use files or a database the information will not be stored anywhere and will be lost once the program ends. The program will keep track of a movie’s title, actors/actresses with characters, movie length, and year of the movie. All data will be stored in arrays.
Arrays needed for Movie Library
· Title
· Length
· Year
· Rating (index value of drop down)
· Actors/characters (must be able to have more than one actor per movie)
· Example: Robert Downey Jr. as Tony StarkRequired Controls
· Multiple Forms
· Textboxes
· Labels
· List boxes
· Dropdown (Combo box)
· Menus
· Splash Screen
· About DialogOther Requirements
· Use Module file
· Use of non-event procedures (procedures defined by you)
· Must prompt user on exit to make sure they want to quit the program
· Must prompt user on save to make sure they want to save the changes
· Must prompt user on delete to make sure they want to delete a media item
· Must use variables within the procedures and functions
· ALL input fields must be validated - is numeric, is the field empty etc.
· All numeric fields must be converted using CInt or CDec and assigned to variablesBonus option
· Store data in a file - worth up to 10 pts.Movie Selected
· Dropdowns must be populated
· Disable all fieldsAdd New Movie
· Enable all of the fields
· Set focus to the title field
· Clear all of the fieldsSave a New Movie
· All fields must be filled in to add a movie
· Movie cannot already exist in the list to be added to the list
· Year of the movie must be numeric
· Length of the movie must be numeric (total number of minutes)
· Display messages to user for each of the above error conditions
· Make sure there is room in the arrays, if not resize the arrays
· Current selected item in the list box of movies should be the movie just added
· Disable all of the controls againItem Selected in Movie List
· Update fields to display the movie details including any actors listed.Add New Actors to a Movie
· Ask how many actors to add
· Add each actor and the name of their characterDelete an Actor from the List
· Select an actor from the list for a movie and delete themUpdate the Actors list for a Movie
· Add an actor to the list for a movie only if there is room on the list
Final Project Evaluation Form - Total Points Possible: 100 – Score
Algorithms (Possible Points = 15)
Points Earned
1 Initial Algorithm (5)
2 Refined Algorithm - pseudo-code
· Matches Final Code (4)
· Indentation (3)
· Statements broken down to correct level (3)
Documentation (Possible 10 Points)
1 All Header Information Present (1)
2 All Variables labeled at declaration (3)
3 Present for meaningful blocks of code (3)
4 Present for individual lines when needed (3)
Style and Readability (Possible 5 Points)
1 Code blocked out according.
CSC 240Lab 31) Update the specifications of the DeleteItem f.docx
CSC 240
Lab 3
1) Update the specifications of the DeleteItem function of the array version of the class UnsortedType as follows:
a) If the ItemType to be deleted is not found in the list, then the list remains unchanged.
b) All copies of the item to be deleted are removed from the list, if they exist.
What is the time complexity of the DeleteItem function and why?
2) Create a function called ShiftRight that shifts the contents of the list one index to the right bringing the last item (index = length - 1) of the list to the front (index = 0) of the list.
What is the time complexity of the ShiftRight function and why?
Use the following driver to test your implementations:
#include
#include "unsorted.h"
using namespace std;
int main() {
UnsortedType classList;
classList.PutItem(ItemType(4));
classList.PutItem(ItemType(5));
classList.PutItem(ItemType(4));
classList.PutItem(ItemType(4));
classList.PutItem(ItemType(8));
cout << "(original) length: " << classList.GetLength() << endl;
classList.ResetList();
classList.Print();
classList.ShiftRight();
cout << "(shifted right) length: " << classList.GetLength() << endl;
classList.ResetList();
classList.Print();
classList.DeleteItem(ItemType(4));
cout << "(delete all 4s) length: " << classList.GetLength() << endl;
classList.ResetList();
classList.Print();
classList.ShiftRight();
cout << "(shift right) length: " << classList.GetLength() << endl;
classList.ResetList();
classList.Print();
return 0;
}
Also, use the following ItemType class, as provided in your source code:
class ItemType
{
public:
ItemType();
RelationType ComparedTo(ItemType) const;
void Print(std::ostream&) const;
void Initialize(int number);
private:
int value;
};
.
CSA CCM V3.0.1 CLOUD CONTROLS MATRIX VERSION 3.0.1Control DomainC.docx
CSA CCM V3.0.1 CLOUD CONTROLS MATRIX VERSION 3.0.1Control DomainCCM V3.0 Control IDUpdated Control SpecificationArchitectural RelevanceCorp Gov RelevanceCloud Service Delivery Model ApplicabilitySupplier RelationshipScope ApplicabilityPhysNetworkComputeStorageAppDataSaaSPaaSIaaSService ProviderTenant / ConsumerAICPA
2009 TSC MapAICPA
Trust Service Criteria (SOC 2SM Report)AICPA
2014 TSCBITS Shared Assessments
AUP v5.0BITS Shared Assessments
SIG v6.0BSI GermanyCanada PIPEDACCM V1.XCIS-AWS-Foundation v1.1COBIT 4.1COBIT 5.0COPPACSA Enterprise Architecture
(formerly Trusted Cloud Initiative)CSA Guidance V3.0ENISA IAF95/46/EC - European Union Data Protection DirectiveFedRAMP Security Controls
(Final Release, Jan 2012)
--LOW IMPACT LEVEL--FedRAMP Security Controls
(Final Release, Jan 2012)
--MODERATE IMPACT LEVEL--FERPAGAPP (Aug 2009)HIPAA / HITECH ActHITRUST CSF v8.1ISO/IEC 27001:2013ISO/IEC 27002:2013ISO/IEC 27017:2015ISO/IEC 270018:2015ITARJericho ForumMexico - Federal Law on Protection of Personal Data Held by Private PartiesNERC CIPNIST SP800-53 R3NIST SP800-53 R4 App JNZISMNZISM v2.5 ODCA UM: PA R2.0PCI DSS v2.0PCI DSS v3.0PCI DSS v3.2Shared Assessments 2017 AUPDomain > Container > CapabilityPublicPrivatePA IDPA levelApplication & Interface Security
Application SecurityAIS-01Applications and programming interfaces (APIs) shall be designed, developed, deployed, and tested in accordance with leading industry standards (e.g., OWASP for web applications) and adhere to applicable legal, statutory, or regulatory compliance obligations.XXXXXXXXS3.10.0
S3.10.0(S3.10.0) Design, acquisition, implementation, configuration, modification, and management of infrastructure and software are consistent with defined system security policies to enable authorized access and to prevent unauthorized access.
(S3.10.0) Design, acquisition, implementation, configuration, modification, and management of infrastructure and software are consistent with defined processing integrity and related security policies.CC7.1I.4G.16.3, I.3Schedule 1 (Section 5), 4.7 - Safeguards, Subsec. 4.7.3SA-04AI2.4APO09.03
APO13.01
BAI03.01
BAI03.02
BAI03.03
BAI03.05
MEA03.01
MEA03.02312.8 and 312.10Application Services > Development Process > Software Quality AssurancesharedxDomain 106.03.01. (c)Article: 27 (3)NIST SP 800-53 R3 SC-5
NIST SP 800-53 R3 SC-6
NIST SP 800-53 R3 SC-7
NIST SP 800-53 R3 SC-12
NIST SP 800-53 R3 SC-13
NIST SP 800-53 R3 SC-14NIST SP 800-53 R3 SA-8
NIST SP 800-53 R3 SC-2
NIST SP 800-53 R3 SC-4
NIST SP 800-53 R3 SC-5
NIST SP 800-53 R3 SC-6
NIST SP 800-53 R3 SC-7
NIST SP 800-53 R3 SC-7 (1)
NIST SP 800-53 R3 SC-7 (2)
NIST SP 800-53 R3 SC-7 (3)
NIST SP 800-53 R3 SC-7 (4)
NIST SP 800-53 R3 SC-7 (5)
NIST SP 800-53 R3 SC-7 (7)
NIST SP 800-53 R3 SC-7 (8)
NIST SP 800-53 R3 SC-7 (12)
NIST SP 800-53 R3 SC-7 (13)
NIST SP 800-53 R3 SC-7 (18)
NIST SP 800-53 R3 SC-8
NIST SP 800-53 R3 SC-8 (1)
NIST SP 800-53 R3 SC-9
NIST SP 800-53 R3 SC-9 (1)
NIST SP 800-53 R3 SC-10
NIST SP .
CS672 – System Engineering and Analysis Discussion 6 - 1192018.docx
CS672 – System Engineering and Analysis
Discussion 6 - 11/9/2018
Samson Kamal Victor
Chapter 12, Question 1:
Reliability:
Reliability is an ability of software to run with minimum number of failure rate in the given period of time. The software failure may be some errors, uncertainty, and misinterpretation of initial system requirement. Software faults are the design faults of the system (Jiantao, 1999)
Characteristics:
· Design faults cause
· Errors may occur without warnings
· Restart in certain time period will reduce the failure
· Reliability of prediction is depend on the human design
· Software interfaces are not visual or physical it is only conceptual
· Software reliability is not operational time dependence but depend on number of successful operations
· Based on the number of failure rate to predict the future system
· Proper well designed framework can lead more reliable software
Chapter 12, Question 2:
System design:
The reliability in system design is very important to predict of failure, quantitative and qualitative reliability requirement of mean time between failure (MTBF) and meantime between maintenance (MTBM)
The reliability need to be checked in each stage of the lifecycle. In the conceptual design stage, preliminary design, detail design and development, production, operation and support. Complete weaved in development cycle
To extend the reliability in the system design then in the conceptual design stage must be done in detailed with the reliability requirements. If the reliability is analyzed properly then it would product may work for extend period of life time. The reliability analyses, evaluation prediction and the formal design review and approval
Chapter 12, Question 3:
Quantitative measure of reliability:
Understanding the nature of system thoroughly and the product metric help to measure the quantitative measure of software reliability. The size of the product can be measured using the line of code (LOC), also using the source line of code (SLOC) and thousand source line of code (KSLOC) with no comments, allows to understand the functionality and complexity of the code, the flow chart diagram will show simplified representation of code, testing of the code functionality and estimate the fault will make the product more reliable (Jiantao, 1999)
The quantitative measure of personal reliability can be measured based on the three factors over time (test-retest reliability) the intelligence of the personal in consistent across time. Internal consistency is represents the self esteem or good qualities of the personal and interact reliability of social skills and how they interaction with others (ReliabilityMeasurement, 2015)
The hardware system is physical device like sensor, controllers and actuators. The hardware reliability is required of time related model to check the physical device fail over time to avoid the physical faults
The quantitative measure of data reliability supported by the positivis.
CSA CCM V3.0CLOUD CONTROLS MATRIX VERSION 3.0Control DomainCCM V3..docx
CSA CCM V3.0CLOUD CONTROLS MATRIX VERSION 3.0Control DomainCCM V3.0 Control IDControl SpecificationArchitectural RelevanceCorp Gov RelevanceCloud Service Delivery Model ApplicabilitySupplier RelationshipScope ApplicabilityCCM v3.0 Change ProposalPhysNetworkComputeStorageAppDataSaaSPaaSIaaSService ProviderTenant / ConsumerAICPA
TS MapAICPA
Trust Service Criteria (SOC 2SM Report)BITS Shared Assessments
AUP v5.0BITS Shared Assessments
SIG v6.0BSI GermanyCCM V1.XCOBIT 4.1CSA Enterprise Architecture / Trust Cloud InitiativeCSA Guidance V3.0ENISA IAFFedRAMP Security Controls
(Final Release, Jan 2012)
--LOW IMPACT LEVEL--FedRAMP Security Controls
(Final Release, Jan 2012)
--MODERATE IMPACT LEVEL--GAPP (Aug 2009)HIPAA / HITECH ActISO/IEC 27001-2005Jericho ForumNERC CIPNIST SP800-53 R3NZISMPCI DSS v2.0Application & Interface Security
Application SecurityAIS-01Applications and interfaces (APIs) shall be designed, developed, and deployed in accordance with industry acceptable standards (e.g., OWASP for web applications) and adhere to applicable legal, statutory, or regulatory compliance obligations.XXXXXXXXXS3.10.0
S3.10.0(S3.10.0) Design, acquisition, implementation, configuration, modification, and management of infrastructure and software are consistent with defined system security policies to enable authorized access and to prevent unauthorized access.
(S3.10.0) Design, acquisition, implementation, configuration, modification, and management of infrastructure and software are consistent with defined processing integrity and related security policies.I.4G.16.3, I.3SA-04AI2.4Domain 106.03.01. (c)NIST SP 800-53 R3 SC-5
NIST SP 800-53 R3 SC-6
NIST SP 800-53 R3 SC-7
NIST SP 800-53 R3 SC-12
NIST SP 800-53 R3 SC-13
NIST SP 800-53 R3 SC-14NIST SP 800-53 R3 SA-8
NIST SP 800-53 R3 SC-2
NIST SP 800-53 R3 SC-4
NIST SP 800-53 R3 SC-5
NIST SP 800-53 R3 SC-6
NIST SP 800-53 R3 SC-7
NIST SP 800-53 R3 SC-7 (1)
NIST SP 800-53 R3 SC-7 (2)
NIST SP 800-53 R3 SC-7 (3)
NIST SP 800-53 R3 SC-7 (4)
NIST SP 800-53 R3 SC-7 (5)
NIST SP 800-53 R3 SC-7 (7)
NIST SP 800-53 R3 SC-7 (8)
NIST SP 800-53 R3 SC-7 (12)
NIST SP 800-53 R3 SC-7 (13)
NIST SP 800-53 R3 SC-7 (18)
NIST SP 800-53 R3 SC-8
NIST SP 800-53 R3 SC-8 (1)
NIST SP 800-53 R3 SC-9
NIST SP 800-53 R3 SC-9 (1)
NIST SP 800-53 R3 SC-10
NIST SP 800-53 R3 SC-11
NIST SP 800-53 R3 SC-12
NIST SP 800-53 R3 SC-12 (2)
NIST SP 800-53 R3 SC-12 (5)
NIST SP 800-53 R3 SC-13
NIST SP 800-53 R3 SC-13 (1)
NIST SP 800-53 R3 SC-14
NIST SP 800-53 R3 SC-17
NIST SP 800-53 R3 SC-181.2.645 CFR 164.312(e)(2)(i)A.11.5.6
A.11.6.1
A.12.2.1
A.12.2.2
A.12.2.3
A.12.2.4
A.12.5.2
A.12.5.4
A.12.5.5
A.12.6.1
A.15.2.1Commandment #1
Commandment #2
Commandment #4
Commandment #5
Commandment #11CIP-007-3 - R5.1SC-2
SC-3
SC-4
SC-5
SC-6
SC-7
SC-8
SC-9
SC-10
SC-11
SC-12
SC-13
SC-14
SC-17
SC-18
SC-20
SC-21
SC-22
SC-236.5Application & Interface Security
Customer Access RequirementsAIS-02Prior to granting customers access to data, assets, and information systems, all.
CSB Hoeganaes Corporation Case Study 1Hoeganaes Corporatio.docx
CSB Hoeganaes Corporation Case Study 1
Hoeganaes Corporation Case Study December 2011
Case Study
U.S. Chemical Safety and Hazard Investigation Board
Hoeganaes Corporation: Gallatin, TN
Metal Dust Flash Fires and Hydrogen Explosion
January 31, 2011; March 29, 2011; May 27, 2011
5 Killed, 3 Injured
No. 2011-4-I-TN
KEY ISSUES
Hazard recognition and training
Engineering controls
Fire codes/enforcement
Regulatory oversight
CSB Hoeganaes Corporation Case Study 2
Hoeganaes Corporation Case Study December 2011
1.0 INTRODUCTION
This case study examines multiple iron dust flash fires and a hydrogen explosion at the
Hoeganaes facility in Gallatin, TN. The first iron dust flash fire incident killed two workers
and the second injured an employee. The third incident, a hydrogen explosion and resulting
iron dust flash fires, claimed three lives and injured two other workers.
1.1 HOEGANAES CORPORATION
Hoeganaes Corp. is a worldwide producer of atomized steel and iron powders. Headquartered
in Cinnaminson, NJ, Hoeganaes has facilities in the U.S., Germany, China, and Romania.
The Hoeganaes Corp. is a subsidiary of GKN, a multinational engineering company headquar-
tered in the United Kingdom. GKN has businesses in addition to powder metallurgy, including
aerospace and automotive driveline industries. GKN acquired the Hoeganaes Corp. in 1999.
The largest consumer for the powdered metal (PM1) product is the automotive industry,
which presses and sinters2 the powder into small metal parts.
1.2 FACILITY DESCRIPTION
The Hoeganaes Gallatin facility (Figure 1), located 30 miles northeast of Nashville, Tennessee,
employs just under 200 employees. Since becoming operational in the 1980s, they have increased
their manufacturing capability over 550 percent from 45,000 to over 300,000 tons.
TABLE OF CONTENTS
1.0 Introduction 2
2.0 Process Discussion 3
3.0 The Incidents 3
4.0 Analysis 6
5.0 Key Findings 24
6.0 Recommendations 24
Appendix A: Determination of
Iron Powder Explosibility from
Pressure Ratio Calculations 28
Appendix B: Determination of
Iron Powder Classification from
Explosion Severity Calculation 30
FIGURE 1
Satellite view of the
Hoeganaes Gallatin facility.
1PM is the accepted acronym by the powdered metals industry.
2Sintering is the process of solidifying PM via heat and/or pressure to form a component.
CSB Hoeganaes Corporation Case Study 3
Hoeganaes Corporation Case Study December 2011
3Ductility is the physical property of a material where it is capable of sustaining large perman.
CS672 – System Engineering and Analysis Discussion 8 - 1123201.docx
CS672 – System Engineering and Analysis
Discussion 8 - 11/23/2018
Samson kamal Victor
Chapter 15, Question 1:
Logistics:
Logistics as set of activities to satisfy the physical need from producer to manufacture a product that meet the customer demand, also the product shipment, storage and maintenance in efficient and effective manner in less time (Logistics-management, n.d.)
According to Manoj (2015) study found the following elements in logistics:
1. Logistics and maintenance support planning: proper initial planning and ensure all the activities are properly coordinate throughout the life cycle
2. Logistics and maintenance personnel: depends on the personnel skills, error rates, attrition rate, maintenance labor hour
3. Training and training support: provide training to personnel understanding of logistics and enough materials for training
4. Supply support: provide support to supply chain such as MTBR, spares / repair demand rate and process time, inventory of items in time, probability of spare availability
5. Software reliability and maintainability, complexity, modules, cost
6. Documentation of Information system that contain technical information such as access time, size, number of data, processing and implementation time
7. Maintenance facilities for items processed, time, and utilities
8. Packaging, handling, storage, and transportation
9. Test, measurement, handling and support equipment: all equipments like monitoring tools, special test equipment, operational support, level of maintenance
10. Logistics information throughout the organization with all the activities in timely and secured manner
Chapter 15, Question 3:
Supply chain:
It is an activity of shifting the product from producer to consumer, also there lots of people involved in supply chain manufacturer, distributer, and consumer (Investopedia, 2003)
Function and activities:
Collecting the product from the manufacture, distributing the product to the dealer or third party dealers and consumer is the end user who is going make use of the product. The activities in the each layer to verify the product quality, expiration period, directing to the location of customer need. If the product has any issue send back to the manufacturer
Supply chain management:
It manages the flow of the product movement from one hand to other hand. It has the planning to design and manages the raw material supply to manufacturer and once the product developed, shipping the product to the dealers, the reason is to build the competitive systems with help of logistics system to move the items to the desired location to satisfy the demand and measure the performance of supply chain activities (Investopedia, 2003)
Function:
- Aligning flows: cost, equipments, and data passed between customers and suppliers.
- Integrating functions: it integrates the functionality of logistics to ensure the SCM goals satisfied
- Coordinating processes: used to plan, source, make, deliver, and re.
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
Physical pharmaceutics notes for B.pharm students
More Related Content
More from mydrynan
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
Cryptography
Lesson 10
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
© (ISC)2 ® 2010, All Rights Reserved
For Personal Use of (ISC)2 Seminar Attendee Only
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
CISSP-ISSEP® Bootcamp Seminar v10
Technical Management
Public Key Infrastructure
Chapter 7
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
2
Key Management
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
3
2
Usage Control
5
6
7
Storage
Recovery
Escrow
8
Zeroization
1
3
Creation
Change and Expiry
4
Distribution
Creation
Automated key generation
Truly random
Suitable length
Key encrypting keys
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
4
Key Usage Control
Management has a vested interest in what activities or content may be hidden in cryptographically protected communications or files
They may create a policy that allows management to audit or decrypt encrypted data at their discretion
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
5
Key Change and Expiry
In any environment, plans should be made to update keys periodically
Generating symmetric keys is easy, but delivering them is expensive since you will be delivering [N*(N-1)]/2 keys to N users
Expiry
Expiry ensures that a key is never overused
Expiry based upon:
Amount of traffic
Amount of traffic over time
Time-in-use
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
6
Distribution
Out of band
Public key encryption
Secret key construction
Secret key delivery
Key Distribution Centers (KDC)
Certificates
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
7
Storage
Trusted hardware
Smartcards
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
8
Recovery
Split knowledge
Multi-party key recovery (MPR)
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise.
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCI 352 - Digital Forensics
Assignment #1
Spring 2020
Due Date: Tuesday, February 25, 2020
Total Points: 100
You are going to write a Python program that represents a command line version of a hexadecimal editor.
This program will be similar to the Linux built-in command line hexadecimal editors such as xxd and
hexdump.
The program will first ask the user to enter the name of any file you want to read. Your program will then
print the binary contents of the file into the standard output (screen). The output will be divided into three
main sections: the offset values in decimal, sixteen space-separated hexadecimal bytes, followed by the
same sixteen bytes but in ASCII value. The figure below shows an example of the first 48 bytes of an
output, and the three different sections:
Notice that in the 2nd section there a space between the 8th and 9th byte. Each output line represents 16 bytes.
The first column shows the decimal offset, where the first byte from the first line represents the 0th byte;
the second line starts with byte 16th and so on. The final section only shows the printable ASCII characters.
These are the ASCII characters can be printed on the screen (usually they are the characters with ASCII
values between 0x20 and 0x7EThe rest of the unprintable bytes are replaced by a period ('.'). The following
built-in Python functions will be useful in this situation: chr, hex, ord. More information about these
functions can be found here: https://docs.python.org/3/library/functions.html
What to hand in
Submit your program electronically through D2L. Please hand in the Python program (.py file or.ipynb)
offset
Hexadecimal Values
ASCII Values
https://docs.python.org/3/library/functions.html
© 2016 by Pearson Education, Inc.
*
THINK CRITICALLY, FACIONE & GITTENS
Chapter 12
Comparative Reasoning
© 2016 by Pearson Education, Inc.
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Learning OutcomesExplain comparative reasoning and how it impacts our understanding of novel situationsApply correctly the five criteria for the evaluation of comparative reasoningDescribe the uses, benefits, and risks of comparative reasoning
Learning OutcomesChapter first explains comparative reasoning and how it impacts our understanding of novel situations.It then applies correctly the five criteria for the evaluation of comparative reasoning.The chapter finally describes the uses, benefits, and risks of comparative reasoning.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Chapter Opening Video
Chapter Opening VideoThe video talks about comparative reasoning.It shows the importance of identifying and evaluating the comparative reasoning and the analogies.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
This is Like That—Recognizing Comparative ReasoningOur minds crave patternsComparative, ideological, and emp.
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docx
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docx
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Cryptography KeysCryptography provides confidentiality, inte.docx
Cryptography Keys
Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use.
Let’s say you work for one of the following types of industry:
Manufacturing
Government
Research
Service
Consulting
After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week.
.
CSC-162 Final ProjectMedia LibraryCreate a program that will.docx
CSC-162 Final Project
Media Library
Create a program that will keep track of a media library to store movies. It will store all of the data using arrays. Since we have not learned how to use files or a database the information will not be stored anywhere and will be lost once the program ends. The program will keep track of a movie’s title, actors/actresses with characters, movie length, and year of the movie. All data will be stored in arrays.
Arrays needed for Movie Library
· Title
· Length
· Year
· Rating (index value of drop down)
· Actors/characters (must be able to have more than one actor per movie)
· Example: Robert Downey Jr. as Tony StarkRequired Controls
· Multiple Forms
· Textboxes
· Labels
· List boxes
· Dropdown (Combo box)
· Menus
· Splash Screen
· About DialogOther Requirements
· Use Module file
· Use of non-event procedures (procedures defined by you)
· Must prompt user on exit to make sure they want to quit the program
· Must prompt user on save to make sure they want to save the changes
· Must prompt user on delete to make sure they want to delete a media item
· Must use variables within the procedures and functions
· ALL input fields must be validated - is numeric, is the field empty etc.
· All numeric fields must be converted using CInt or CDec and assigned to variablesBonus option
· Store data in a file - worth up to 10 pts.Movie Selected
· Dropdowns must be populated
· Disable all fieldsAdd New Movie
· Enable all of the fields
· Set focus to the title field
· Clear all of the fieldsSave a New Movie
· All fields must be filled in to add a movie
· Movie cannot already exist in the list to be added to the list
· Year of the movie must be numeric
· Length of the movie must be numeric (total number of minutes)
· Display messages to user for each of the above error conditions
· Make sure there is room in the arrays, if not resize the arrays
· Current selected item in the list box of movies should be the movie just added
· Disable all of the controls againItem Selected in Movie List
· Update fields to display the movie details including any actors listed.Add New Actors to a Movie
· Ask how many actors to add
· Add each actor and the name of their characterDelete an Actor from the List
· Select an actor from the list for a movie and delete themUpdate the Actors list for a Movie
· Add an actor to the list for a movie only if there is room on the list
Final Project Evaluation Form - Total Points Possible: 100 – Score
Algorithms (Possible Points = 15)
Points Earned
1 Initial Algorithm (5)
2 Refined Algorithm - pseudo-code
· Matches Final Code (4)
· Indentation (3)
· Statements broken down to correct level (3)
Documentation (Possible 10 Points)
1 All Header Information Present (1)
2 All Variables labeled at declaration (3)
3 Present for meaningful blocks of code (3)
4 Present for individual lines when needed (3)
Style and Readability (Possible 5 Points)
1 Code blocked out according.
CSC 240Lab 31) Update the specifications of the DeleteItem f.docx
CSC 240
Lab 3
1) Update the specifications of the DeleteItem function of the array version of the class UnsortedType as follows:
a) If the ItemType to be deleted is not found in the list, then the list remains unchanged.
b) All copies of the item to be deleted are removed from the list, if they exist.
What is the time complexity of the DeleteItem function and why?
2) Create a function called ShiftRight that shifts the contents of the list one index to the right bringing the last item (index = length - 1) of the list to the front (index = 0) of the list.
What is the time complexity of the ShiftRight function and why?
Use the following driver to test your implementations:
#include
#include "unsorted.h"
using namespace std;
int main() {
UnsortedType classList;
classList.PutItem(ItemType(4));
classList.PutItem(ItemType(5));
classList.PutItem(ItemType(4));
classList.PutItem(ItemType(4));
classList.PutItem(ItemType(8));
cout << "(original) length: " << classList.GetLength() << endl;
classList.ResetList();
classList.Print();
classList.ShiftRight();
cout << "(shifted right) length: " << classList.GetLength() << endl;
classList.ResetList();
classList.Print();
classList.DeleteItem(ItemType(4));
cout << "(delete all 4s) length: " << classList.GetLength() << endl;
classList.ResetList();
classList.Print();
classList.ShiftRight();
cout << "(shift right) length: " << classList.GetLength() << endl;
classList.ResetList();
classList.Print();
return 0;
}
Also, use the following ItemType class, as provided in your source code:
class ItemType
{
public:
ItemType();
RelationType ComparedTo(ItemType) const;
void Print(std::ostream&) const;
void Initialize(int number);
private:
int value;
};
.
CSA CCM V3.0.1 CLOUD CONTROLS MATRIX VERSION 3.0.1Control DomainC.docx
CSA CCM V3.0.1 CLOUD CONTROLS MATRIX VERSION 3.0.1Control DomainCCM V3.0 Control IDUpdated Control SpecificationArchitectural RelevanceCorp Gov RelevanceCloud Service Delivery Model ApplicabilitySupplier RelationshipScope ApplicabilityPhysNetworkComputeStorageAppDataSaaSPaaSIaaSService ProviderTenant / ConsumerAICPA
2009 TSC MapAICPA
Trust Service Criteria (SOC 2SM Report)AICPA
2014 TSCBITS Shared Assessments
AUP v5.0BITS Shared Assessments
SIG v6.0BSI GermanyCanada PIPEDACCM V1.XCIS-AWS-Foundation v1.1COBIT 4.1COBIT 5.0COPPACSA Enterprise Architecture
(formerly Trusted Cloud Initiative)CSA Guidance V3.0ENISA IAF95/46/EC - European Union Data Protection DirectiveFedRAMP Security Controls
(Final Release, Jan 2012)
--LOW IMPACT LEVEL--FedRAMP Security Controls
(Final Release, Jan 2012)
--MODERATE IMPACT LEVEL--FERPAGAPP (Aug 2009)HIPAA / HITECH ActHITRUST CSF v8.1ISO/IEC 27001:2013ISO/IEC 27002:2013ISO/IEC 27017:2015ISO/IEC 270018:2015ITARJericho ForumMexico - Federal Law on Protection of Personal Data Held by Private PartiesNERC CIPNIST SP800-53 R3NIST SP800-53 R4 App JNZISMNZISM v2.5 ODCA UM: PA R2.0PCI DSS v2.0PCI DSS v3.0PCI DSS v3.2Shared Assessments 2017 AUPDomain > Container > CapabilityPublicPrivatePA IDPA levelApplication & Interface Security
Application SecurityAIS-01Applications and programming interfaces (APIs) shall be designed, developed, deployed, and tested in accordance with leading industry standards (e.g., OWASP for web applications) and adhere to applicable legal, statutory, or regulatory compliance obligations.XXXXXXXXS3.10.0
S3.10.0(S3.10.0) Design, acquisition, implementation, configuration, modification, and management of infrastructure and software are consistent with defined system security policies to enable authorized access and to prevent unauthorized access.
(S3.10.0) Design, acquisition, implementation, configuration, modification, and management of infrastructure and software are consistent with defined processing integrity and related security policies.CC7.1I.4G.16.3, I.3Schedule 1 (Section 5), 4.7 - Safeguards, Subsec. 4.7.3SA-04AI2.4APO09.03
APO13.01
BAI03.01
BAI03.02
BAI03.03
BAI03.05
MEA03.01
MEA03.02312.8 and 312.10Application Services > Development Process > Software Quality AssurancesharedxDomain 106.03.01. (c)Article: 27 (3)NIST SP 800-53 R3 SC-5
NIST SP 800-53 R3 SC-6
NIST SP 800-53 R3 SC-7
NIST SP 800-53 R3 SC-12
NIST SP 800-53 R3 SC-13
NIST SP 800-53 R3 SC-14NIST SP 800-53 R3 SA-8
NIST SP 800-53 R3 SC-2
NIST SP 800-53 R3 SC-4
NIST SP 800-53 R3 SC-5
NIST SP 800-53 R3 SC-6
NIST SP 800-53 R3 SC-7
NIST SP 800-53 R3 SC-7 (1)
NIST SP 800-53 R3 SC-7 (2)
NIST SP 800-53 R3 SC-7 (3)
NIST SP 800-53 R3 SC-7 (4)
NIST SP 800-53 R3 SC-7 (5)
NIST SP 800-53 R3 SC-7 (7)
NIST SP 800-53 R3 SC-7 (8)
NIST SP 800-53 R3 SC-7 (12)
NIST SP 800-53 R3 SC-7 (13)
NIST SP 800-53 R3 SC-7 (18)
NIST SP 800-53 R3 SC-8
NIST SP 800-53 R3 SC-8 (1)
NIST SP 800-53 R3 SC-9
NIST SP 800-53 R3 SC-9 (1)
NIST SP 800-53 R3 SC-10
NIST SP .
CS672 – System Engineering and Analysis Discussion 6 - 1192018.docx
CS672 – System Engineering and Analysis
Discussion 6 - 11/9/2018
Samson Kamal Victor
Chapter 12, Question 1:
Reliability:
Reliability is an ability of software to run with minimum number of failure rate in the given period of time. The software failure may be some errors, uncertainty, and misinterpretation of initial system requirement. Software faults are the design faults of the system (Jiantao, 1999)
Characteristics:
· Design faults cause
· Errors may occur without warnings
· Restart in certain time period will reduce the failure
· Reliability of prediction is depend on the human design
· Software interfaces are not visual or physical it is only conceptual
· Software reliability is not operational time dependence but depend on number of successful operations
· Based on the number of failure rate to predict the future system
· Proper well designed framework can lead more reliable software
Chapter 12, Question 2:
System design:
The reliability in system design is very important to predict of failure, quantitative and qualitative reliability requirement of mean time between failure (MTBF) and meantime between maintenance (MTBM)
The reliability need to be checked in each stage of the lifecycle. In the conceptual design stage, preliminary design, detail design and development, production, operation and support. Complete weaved in development cycle
To extend the reliability in the system design then in the conceptual design stage must be done in detailed with the reliability requirements. If the reliability is analyzed properly then it would product may work for extend period of life time. The reliability analyses, evaluation prediction and the formal design review and approval
Chapter 12, Question 3:
Quantitative measure of reliability:
Understanding the nature of system thoroughly and the product metric help to measure the quantitative measure of software reliability. The size of the product can be measured using the line of code (LOC), also using the source line of code (SLOC) and thousand source line of code (KSLOC) with no comments, allows to understand the functionality and complexity of the code, the flow chart diagram will show simplified representation of code, testing of the code functionality and estimate the fault will make the product more reliable (Jiantao, 1999)
The quantitative measure of personal reliability can be measured based on the three factors over time (test-retest reliability) the intelligence of the personal in consistent across time. Internal consistency is represents the self esteem or good qualities of the personal and interact reliability of social skills and how they interaction with others (ReliabilityMeasurement, 2015)
The hardware system is physical device like sensor, controllers and actuators. The hardware reliability is required of time related model to check the physical device fail over time to avoid the physical faults
The quantitative measure of data reliability supported by the positivis.
CSA CCM V3.0CLOUD CONTROLS MATRIX VERSION 3.0Control DomainCCM V3..docx
CSA CCM V3.0CLOUD CONTROLS MATRIX VERSION 3.0Control DomainCCM V3.0 Control IDControl SpecificationArchitectural RelevanceCorp Gov RelevanceCloud Service Delivery Model ApplicabilitySupplier RelationshipScope ApplicabilityCCM v3.0 Change ProposalPhysNetworkComputeStorageAppDataSaaSPaaSIaaSService ProviderTenant / ConsumerAICPA
TS MapAICPA
Trust Service Criteria (SOC 2SM Report)BITS Shared Assessments
AUP v5.0BITS Shared Assessments
SIG v6.0BSI GermanyCCM V1.XCOBIT 4.1CSA Enterprise Architecture / Trust Cloud InitiativeCSA Guidance V3.0ENISA IAFFedRAMP Security Controls
(Final Release, Jan 2012)
--LOW IMPACT LEVEL--FedRAMP Security Controls
(Final Release, Jan 2012)
--MODERATE IMPACT LEVEL--GAPP (Aug 2009)HIPAA / HITECH ActISO/IEC 27001-2005Jericho ForumNERC CIPNIST SP800-53 R3NZISMPCI DSS v2.0Application & Interface Security
Application SecurityAIS-01Applications and interfaces (APIs) shall be designed, developed, and deployed in accordance with industry acceptable standards (e.g., OWASP for web applications) and adhere to applicable legal, statutory, or regulatory compliance obligations.XXXXXXXXXS3.10.0
S3.10.0(S3.10.0) Design, acquisition, implementation, configuration, modification, and management of infrastructure and software are consistent with defined system security policies to enable authorized access and to prevent unauthorized access.
(S3.10.0) Design, acquisition, implementation, configuration, modification, and management of infrastructure and software are consistent with defined processing integrity and related security policies.I.4G.16.3, I.3SA-04AI2.4Domain 106.03.01. (c)NIST SP 800-53 R3 SC-5
NIST SP 800-53 R3 SC-6
NIST SP 800-53 R3 SC-7
NIST SP 800-53 R3 SC-12
NIST SP 800-53 R3 SC-13
NIST SP 800-53 R3 SC-14NIST SP 800-53 R3 SA-8
NIST SP 800-53 R3 SC-2
NIST SP 800-53 R3 SC-4
NIST SP 800-53 R3 SC-5
NIST SP 800-53 R3 SC-6
NIST SP 800-53 R3 SC-7
NIST SP 800-53 R3 SC-7 (1)
NIST SP 800-53 R3 SC-7 (2)
NIST SP 800-53 R3 SC-7 (3)
NIST SP 800-53 R3 SC-7 (4)
NIST SP 800-53 R3 SC-7 (5)
NIST SP 800-53 R3 SC-7 (7)
NIST SP 800-53 R3 SC-7 (8)
NIST SP 800-53 R3 SC-7 (12)
NIST SP 800-53 R3 SC-7 (13)
NIST SP 800-53 R3 SC-7 (18)
NIST SP 800-53 R3 SC-8
NIST SP 800-53 R3 SC-8 (1)
NIST SP 800-53 R3 SC-9
NIST SP 800-53 R3 SC-9 (1)
NIST SP 800-53 R3 SC-10
NIST SP 800-53 R3 SC-11
NIST SP 800-53 R3 SC-12
NIST SP 800-53 R3 SC-12 (2)
NIST SP 800-53 R3 SC-12 (5)
NIST SP 800-53 R3 SC-13
NIST SP 800-53 R3 SC-13 (1)
NIST SP 800-53 R3 SC-14
NIST SP 800-53 R3 SC-17
NIST SP 800-53 R3 SC-181.2.645 CFR 164.312(e)(2)(i)A.11.5.6
A.11.6.1
A.12.2.1
A.12.2.2
A.12.2.3
A.12.2.4
A.12.5.2
A.12.5.4
A.12.5.5
A.12.6.1
A.15.2.1Commandment #1
Commandment #2
Commandment #4
Commandment #5
Commandment #11CIP-007-3 - R5.1SC-2
SC-3
SC-4
SC-5
SC-6
SC-7
SC-8
SC-9
SC-10
SC-11
SC-12
SC-13
SC-14
SC-17
SC-18
SC-20
SC-21
SC-22
SC-236.5Application & Interface Security
Customer Access RequirementsAIS-02Prior to granting customers access to data, assets, and information systems, all.
CSB Hoeganaes Corporation Case Study 1Hoeganaes Corporatio.docx
CSB Hoeganaes Corporation Case Study 1
Hoeganaes Corporation Case Study December 2011
Case Study
U.S. Chemical Safety and Hazard Investigation Board
Hoeganaes Corporation: Gallatin, TN
Metal Dust Flash Fires and Hydrogen Explosion
January 31, 2011; March 29, 2011; May 27, 2011
5 Killed, 3 Injured
No. 2011-4-I-TN
KEY ISSUES
Hazard recognition and training
Engineering controls
Fire codes/enforcement
Regulatory oversight
CSB Hoeganaes Corporation Case Study 2
Hoeganaes Corporation Case Study December 2011
1.0 INTRODUCTION
This case study examines multiple iron dust flash fires and a hydrogen explosion at the
Hoeganaes facility in Gallatin, TN. The first iron dust flash fire incident killed two workers
and the second injured an employee. The third incident, a hydrogen explosion and resulting
iron dust flash fires, claimed three lives and injured two other workers.
1.1 HOEGANAES CORPORATION
Hoeganaes Corp. is a worldwide producer of atomized steel and iron powders. Headquartered
in Cinnaminson, NJ, Hoeganaes has facilities in the U.S., Germany, China, and Romania.
The Hoeganaes Corp. is a subsidiary of GKN, a multinational engineering company headquar-
tered in the United Kingdom. GKN has businesses in addition to powder metallurgy, including
aerospace and automotive driveline industries. GKN acquired the Hoeganaes Corp. in 1999.
The largest consumer for the powdered metal (PM1) product is the automotive industry,
which presses and sinters2 the powder into small metal parts.
1.2 FACILITY DESCRIPTION
The Hoeganaes Gallatin facility (Figure 1), located 30 miles northeast of Nashville, Tennessee,
employs just under 200 employees. Since becoming operational in the 1980s, they have increased
their manufacturing capability over 550 percent from 45,000 to over 300,000 tons.
TABLE OF CONTENTS
1.0 Introduction 2
2.0 Process Discussion 3
3.0 The Incidents 3
4.0 Analysis 6
5.0 Key Findings 24
6.0 Recommendations 24
Appendix A: Determination of
Iron Powder Explosibility from
Pressure Ratio Calculations 28
Appendix B: Determination of
Iron Powder Classification from
Explosion Severity Calculation 30
FIGURE 1
Satellite view of the
Hoeganaes Gallatin facility.
1PM is the accepted acronym by the powdered metals industry.
2Sintering is the process of solidifying PM via heat and/or pressure to form a component.
CSB Hoeganaes Corporation Case Study 3
Hoeganaes Corporation Case Study December 2011
3Ductility is the physical property of a material where it is capable of sustaining large perman.
CS672 – System Engineering and Analysis Discussion 8 - 1123201.docx
CS672 – System Engineering and Analysis
Discussion 8 - 11/23/2018
Samson kamal Victor
Chapter 15, Question 1:
Logistics:
Logistics as set of activities to satisfy the physical need from producer to manufacture a product that meet the customer demand, also the product shipment, storage and maintenance in efficient and effective manner in less time (Logistics-management, n.d.)
According to Manoj (2015) study found the following elements in logistics:
1. Logistics and maintenance support planning: proper initial planning and ensure all the activities are properly coordinate throughout the life cycle
2. Logistics and maintenance personnel: depends on the personnel skills, error rates, attrition rate, maintenance labor hour
3. Training and training support: provide training to personnel understanding of logistics and enough materials for training
4. Supply support: provide support to supply chain such as MTBR, spares / repair demand rate and process time, inventory of items in time, probability of spare availability
5. Software reliability and maintainability, complexity, modules, cost
6. Documentation of Information system that contain technical information such as access time, size, number of data, processing and implementation time
7. Maintenance facilities for items processed, time, and utilities
8. Packaging, handling, storage, and transportation
9. Test, measurement, handling and support equipment: all equipments like monitoring tools, special test equipment, operational support, level of maintenance
10. Logistics information throughout the organization with all the activities in timely and secured manner
Chapter 15, Question 3:
Supply chain:
It is an activity of shifting the product from producer to consumer, also there lots of people involved in supply chain manufacturer, distributer, and consumer (Investopedia, 2003)
Function and activities:
Collecting the product from the manufacture, distributing the product to the dealer or third party dealers and consumer is the end user who is going make use of the product. The activities in the each layer to verify the product quality, expiration period, directing to the location of customer need. If the product has any issue send back to the manufacturer
Supply chain management:
It manages the flow of the product movement from one hand to other hand. It has the planning to design and manages the raw material supply to manufacturer and once the product developed, shipping the product to the dealers, the reason is to build the competitive systems with help of logistics system to move the items to the desired location to satisfy the demand and measure the performance of supply chain activities (Investopedia, 2003)
Function:
- Aligning flows: cost, equipments, and data passed between customers and suppliers.
- Integrating functions: it integrates the functionality of logistics to ensure the SCM goals satisfied
- Coordinating processes: used to plan, source, make, deliver, and re.
More from mydrynan (20)
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSC-321 Final Writing Assignment In this assignment, you .docx
CSC-321 Final Writing Assignment In this assignment, you .docx
Cryptography is the application of algorithms to ensure the confiden.docx
Cryptography is the application of algorithms to ensure the confiden.docx
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
Cryptography KeysCryptography provides confidentiality, inte.docx
Cryptography KeysCryptography provides confidentiality, inte.docx
CSC-162 Final ProjectMedia LibraryCreate a program that will.docx
CSC-162 Final ProjectMedia LibraryCreate a program that will.docx
CSC 240Lab 31) Update the specifications of the DeleteItem f.docx
CSC 240Lab 31) Update the specifications of the DeleteItem f.docx
CSA CCM V3.0.1 CLOUD CONTROLS MATRIX VERSION 3.0.1Control DomainC.docx
CSA CCM V3.0.1 CLOUD CONTROLS MATRIX VERSION 3.0.1Control DomainC.docx
CS672 – System Engineering and Analysis Discussion 6 - 1192018.docx
CS672 – System Engineering and Analysis Discussion 6 - 1192018.docx
CSA CCM V3.0CLOUD CONTROLS MATRIX VERSION 3.0Control DomainCCM V3..docx
CSA CCM V3.0CLOUD CONTROLS MATRIX VERSION 3.0Control DomainCCM V3..docx
CSB Hoeganaes Corporation Case Study 1Hoeganaes Corporatio.docx
CSB Hoeganaes Corporation Case Study 1Hoeganaes Corporatio.docx
CS672 – System Engineering and Analysis Discussion 8 - 1123201.docx
CS672 – System Engineering and Analysis Discussion 8 - 1123201.docx
Recently uploaded
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
Physical pharmaceutics notes for B.pharm students
Gender and Mental Health - Counselling and Family Therapy Applications and In...
A proprietary approach developed by bringing together the best of learning theories from Psychology, design principles from the world of visualization, and pedagogical methods from over a decade of training experience, that enables you to: Learn better, faster!
CHUYÊN ĐỀ ÔN TẬP VÀ PHÁT TRIỂN CÂU HỎI TRONG ĐỀ MINH HỌA THI TỐT NGHIỆP THPT ...
CHUYÊN ĐỀ ÔN TẬP VÀ PHÁT TRIỂN CÂU HỎI TRONG ĐỀ MINH HỌA THI TỐT NGHIỆP THPT ...Nguyen Thanh Tu Collection
https://app.box.com/s/qspvswamcohjtbvbbhjad04lg65waylfWound healing PPT
This document provides an overview of wound healing, its functions, stages, mechanisms, factors affecting it, and complications.
A wound is a break in the integrity of the skin or tissues, which may be associated with disruption of the structure and function.
Healing is the body’s response to injury in an attempt to restore normal structure and functions.
Healing can occur in two ways: Regeneration and Repair
There are 4 phases of wound healing: hemostasis, inflammation, proliferation, and remodeling. This document also describes the mechanism of wound healing. Factors that affect healing include infection, uncontrolled diabetes, poor nutrition, age, anemia, the presence of foreign bodies, etc.
Complications of wound healing like infection, hyperpigmentation of scar, contractures, and keloid formation.
A Free 200-Page eBook ~ Brain and Mind Exercise.pptx
(A Free eBook comprising 3 Sets of Presentation of a selection of Puzzles, Brain Teasers and Thinking Problems to exercise both the mind and the Right and Left Brain. To help keep the mind and brain fit and healthy. Good for both the young and old alike.
Answers are given for all the puzzles and problems.)
With Metta,
Bro. Oh Teik Bin 🙏🤓🤔🥰
Educational Technology in the Health Sciences
Plenary presentation at the NTTC Inter-university Workshop, 18 June 2024, Manila Prince Hotel.
Elevate Your Nonprofit's Online Presence_ A Guide to Effective SEO Strategies...
Whether you're new to SEO or looking to refine your existing strategies, this webinar will provide you with actionable insights and practical tips to elevate your nonprofit's online presence.
BIOLOGY NATIONAL EXAMINATION COUNCIL (NECO) 2024 PRACTICAL MANUAL.pptx
Practical manual for National Examination Council, Nigeria.
Contains guides on answering questions on the specimens provided
CapTechTalks Webinar Slides June 2024 Donovan Wright.pptx
Slides from a Capitol Technology University webinar held June 20, 2024. The webinar featured Dr. Donovan Wright, presenting on the Department of Defense Digital Transformation.
Temple of Asclepius in Thrace. Excavation results
The temple and the sanctuary around were dedicated to Asklepios Zmidrenus. This name has been known since 1875 when an inscription dedicated to him was discovered in Rome. The inscription is dated in 227 AD and was left by soldiers originating from the city of Philippopolis (modern Plovdiv).
Philippine Edukasyong Pantahanan at Pangkabuhayan (EPP) Curriculum
(𝐓𝐋𝐄 𝟏𝟎𝟎) (𝐋𝐞𝐬𝐬𝐨𝐧 𝟏)-𝐏𝐫𝐞𝐥𝐢𝐦𝐬
𝐃𝐢𝐬𝐜𝐮𝐬𝐬 𝐭𝐡𝐞 𝐄𝐏𝐏 𝐂𝐮𝐫𝐫𝐢𝐜𝐮𝐥𝐮𝐦 𝐢𝐧 𝐭𝐡𝐞 𝐏𝐡𝐢𝐥𝐢𝐩𝐩𝐢𝐧𝐞𝐬:
- Understand the goals and objectives of the Edukasyong Pantahanan at Pangkabuhayan (EPP) curriculum, recognizing its importance in fostering practical life skills and values among students. Students will also be able to identify the key components and subjects covered, such as agriculture, home economics, industrial arts, and information and communication technology.
𝐄𝐱𝐩𝐥𝐚𝐢𝐧 𝐭𝐡𝐞 𝐍𝐚𝐭𝐮𝐫𝐞 𝐚𝐧𝐝 𝐒𝐜𝐨𝐩𝐞 𝐨𝐟 𝐚𝐧 𝐄𝐧𝐭𝐫𝐞𝐩𝐫𝐞𝐧𝐞𝐮𝐫:
-Define entrepreneurship, distinguishing it from general business activities by emphasizing its focus on innovation, risk-taking, and value creation. Students will describe the characteristics and traits of successful entrepreneurs, including their roles and responsibilities, and discuss the broader economic and social impacts of entrepreneurial activities on both local and global scales.
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...Nguyen Thanh Tu Collection
https://app.box.com/s/tacvl9ekroe9hqupdnjruiypvm9rdaneskeleton System.pdf (skeleton system wow)
🔥🔥🔥🔥🔥🔥🔥🔥🔥
إضغ بين إيديكم من أقوى الملازم التي صممتها
ملزمة تشريح الجهاز الهيكلي (نظري 3)
💀💀💀💀💀💀💀💀💀💀
تتميز هذهِ الملزمة بعِدة مُميزات :
1- مُترجمة ترجمة تُناسب جميع المستويات
2- تحتوي على 78 رسم توضيحي لكل كلمة موجودة بالملزمة (لكل كلمة !!!!)
#فهم_ماكو_درخ
3- دقة الكتابة والصور عالية جداً جداً جداً
4- هُنالك بعض المعلومات تم توضيحها بشكل تفصيلي جداً (تُعتبر لدى الطالب أو الطالبة بإنها معلومات مُبهمة ومع ذلك تم توضيح هذهِ المعلومات المُبهمة بشكل تفصيلي جداً
5- الملزمة تشرح نفسها ب نفسها بس تكلك تعال اقراني
6- تحتوي الملزمة في اول سلايد على خارطة تتضمن جميع تفرُعات معلومات الجهاز الهيكلي المذكورة في هذهِ الملزمة
واخيراً هذهِ الملزمة حلالٌ عليكم وإتمنى منكم إن تدعولي بالخير والصحة والعافية فقط
كل التوفيق زملائي وزميلاتي ، زميلكم محمد الذهبي 💊💊
🔥🔥🔥🔥🔥🔥🔥🔥🔥
Recently uploaded (20)
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
Gender and Mental Health - Counselling and Family Therapy Applications and In...
Gender and Mental Health - Counselling and Family Therapy Applications and In...
CHUYÊN ĐỀ ÔN TẬP VÀ PHÁT TRIỂN CÂU HỎI TRONG ĐỀ MINH HỌA THI TỐT NGHIỆP THPT ...
CHUYÊN ĐỀ ÔN TẬP VÀ PHÁT TRIỂN CÂU HỎI TRONG ĐỀ MINH HỌA THI TỐT NGHIỆP THPT ...
A Free 200-Page eBook ~ Brain and Mind Exercise.pptx
A Free 200-Page eBook ~ Brain and Mind Exercise.pptx
Elevate Your Nonprofit's Online Presence_ A Guide to Effective SEO Strategies...
Elevate Your Nonprofit's Online Presence_ A Guide to Effective SEO Strategies...
BIOLOGY NATIONAL EXAMINATION COUNCIL (NECO) 2024 PRACTICAL MANUAL.pptx
BIOLOGY NATIONAL EXAMINATION COUNCIL (NECO) 2024 PRACTICAL MANUAL.pptx
CapTechTalks Webinar Slides June 2024 Donovan Wright.pptx
CapTechTalks Webinar Slides June 2024 Donovan Wright.pptx
NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx
NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx
Philippine Edukasyong Pantahanan at Pangkabuhayan (EPP) Curriculum
Philippine Edukasyong Pantahanan at Pangkabuhayan (EPP) Curriculum
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
SWOT analysis in the project Keeping the Memory @live.pptx
SWOT analysis in the project Keeping the Memory @live.pptx
crucial AccountabilityAs a nurse leader What confrontations .docx
- 1. c rucial Accountability As a nurse leader What confrontations do you typically avoid or instigate? Do you use tricks to talk yourself out of speaking up or are you one who always speaks? talk about the silence-to-violence habit in healthcare and how it affects health care staff Please use peer reviewed articles and add references APA style between 150 and 200 words in length.