Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Coronavirus disease
1. Coronavirus disease (COVID-19).
Done by:
Sara Salama Alganzoury
Ali Mostafa Ali
Molecular Biotechnology program
Under Supervision of
Dr. Mohamed M. Omran
Associated professor of Biochemistry
Helwan university, Faculty of science, chemistry department
3. Name : SARS-COV-2 (nCoVD-19)
Appeared on: Dec 2019 – Until Now
Breakout Location : Wuhan, China.
Status : Pandemic
Transmission Rate : Very High
INTRODUCTION
6. Transmission & Prevention
Transmission Prevention
• Via Respiratory droplets • Avoid contact with sick person
(1 meter)
• Wash hands with soap & water
• Use medical face masks &
gloves If developed cough
• Use detergents to clean
surface
10. Molecular diagnosis
Real-time reverse-transcription polymerase chain reaction assays for a novel human
coronavirus.
• The confirmation of COVID-19 is achieved by RT-PCR detection of throat swab
samples of suspected patients. two target genes including open reading frame1ab
(ORF1ab) and nucleocapsid protein (N), and simultaneously amplified and tested
during the real-time RT-PCR assay.
Target 1 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA;
reverse primer ACGATTGTGCATCAGCTGA;
probe 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3’.
Target 2 (N): forward primer GGGGAACTTCTCCTGCTAGAAT;
reverse primer CAGACATTTTGCTCTCAAGCTG;
probe 5'-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3’.
• A cycle threshold value (Ct value) less than 37 was defined as a positive record, and
a Ct-value exceeds 40 was defined as a negative test.
11. • The human COVID-19 IgG/IgM Antibody ELISA is made from
the 2019-nCoV N protein coated microtiter plate, Goat-anti-
human Antibody-HRP and other reagents.
Indirect ELISA principle is used to test the antibodies against
2019-nCoV in human serum
• Here, the coated N protein combines with COVID-19 IgG/IgM
Antibody in serum, then add secondary antibody-HRP to
specifically bind with complex of antibody-antigens on the
microplate.
• With the TMB substrate, it will generate an amount of color.
• The depth of color is relative with the content of the COVID-19
IgG/IgM Antibody,
• when the value of color is greater than the cut-off value, the
human has been infected with the 2019-nCoV.
COVID-19 IgG/IgM Antibody ELISA
12. This Test used immunochromatography techniques . The card
contains
1) colloidal gold-labeled recombinant new coronavirus antigen and
quality control antibody gold markers;
2) two detection lines (G and M lines) and one quality Control line (C
line) of nitrocellulose membrane.
The M line is immobilized with a monoclonal anti-human IgM
antibody for detecting a new coronavirus IgM antibody;
the G line is immobilized with a reagent for detecting a new
coronavirus IgG antibody; and the C line is immobilized with a
quality control antibody.
If the sample contains an IgG antibody, the antibody will bind to the
colloidal gold-labeled new coronavirus antigen, and the immune
complex will be captured by the reagent immobilized on the
membrane to form a purple-red G line, indicating that the new
coronavirus IgG antibody is positive.
Rapid COVID-19 Test
•
The Food and Drug Administration has approved the first rapid point-of-care COVID-19 test at 21 March
2020. This is rapid lateral flow test for Coronavirus disease (COVID-19).
14. In bacterial infectious neutrophils increase and in viral
infection. The blood counts of patients on admission
showed decrease in neutrophils (26 [39%] of 67 patients),
lymphocytes (28 [42%] of 67 patients), and eosinophils
(48 [72%] of 67 patients), among which, the number of
eosinophils in 31 patients was zero.
15. Cytokines and Chemokines
• Virus infections induce a proinflammatory response including
expression of cytokines and chemokines that can be activated
by Viral surface glycoproteins, double-stranded RNA, and
intracellular viral proteins via signal transduction pathways
• CoV infects lung cells via its Spike (S) glycoprotein that binds
receptor present on macrophages. infection of macrophages
with CoV S glycoprotein results in suppression of macrophage
responses since it reduced the capacity of macrophages to
produce TNFα and IL-6 in naive and induced production of the
immunosuppressive cytokine IL-10.v
(Al-Qahtani et al., 2017)
16. The C-reactive protein (CRP) test is used by a health practitioner to
detect inflammation. CRP is an acute phase reactant, a protein made
by the liver and released into the blood within a few hours after
tissue injury, the start of an infection, or other cause of
inflammation.
The erythrocyte sedimentation rate (ESR) measures how fast red cells
fall through a column of blood. It is an indirect index of acute-phase
protein concentrations (particularly depends on the concentration of
fibrinogen) and is a sensitive but nonspecific index of plasma protein
changes which result from inflammation or tissue damage.
C-reactive protein (CRP) & The erythrocyte sedimentation
rate (ESR)
17. liver enzyme levels such as aspartate transaminase and
alanine aminotransferase, were significantly increased.
The coronavirus patients showed increase in alanine
aminotransferase (23 [33%] of 69 patients) and aspartate
aminotransferase (19 [28%] of 69 patients), most of which
count less than 100 U/L.
Inflammatory markers
18. In terms of inflammation indicators, patients on admission
showed increase in lactate dehydrogenase (25 [41%] of 61
patients), C-reactive protein (42 [67%] of 63 patients), and
erythrocyte sedimentation rate (30 [52%] of 58 patients).
The levels of lactate dehydrogenase, c reactive protein, and
erythrocyte sedimentation rate were increased .
Inflammatory markers
(Guo et al., 2020)
19. 1. Antiviral drugs and systemic corticosteroid treatment commonly
used in clinical practice previously, including neuraminidase
inhibitors (oseltamivir, peramivir, zanamivir, etc), ganciclovir,
acyclovir, and ribavirin, as well as methylprednisolone.
2. Remdesivir (GS-5734) is a 1′-cyano-substituted adenosine nucleotide
analog prodrug and shows broadspectrum antiviral activity against
several RNA viruses
3. Chloroquine is a repurposed drug with great potential to treat
• COVID-19. Chloroquine has been used to treat malaria for many years
Treatment of COVID-19
20. 1. https://www.cdc.gov/coronavirus/2019-ncov/symptoms-testing/symptoms.html
https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory
2. Al-Qahtani AA, Lyroni K, Aznaourova M, Tseliou M, Al-Anazi MR, Al-Ahdal MN, Alkahtani S, Sourvinos G, Tsatsanis C.
Middle east respiratory syndrome corona virus spike glycoprotein suppresses macrophage responses via DPP4-
mediated induction of IRAK-M and PPARγ. Oncotarget. 2017 Feb 7;8(6):9053-9066
3. Guo YR, Cao QD, Hong ZS, Tan YY, Chen SD, Jin HJ, Tan KS, Wang DY, Yan Y. The origin, transmission and
clinical therapies on coronavirus disease 2019 (COVID-19) outbreak - an update on the status. Mil Med Res. 2020 Mar
13;7(1):1
4. Wang Z, Yang B, Li Q, Wen L, Zhang R. Clinical Features of 69 Cases with Coronavirus Disease 2019 in Wuhan, China.
Clin Infect Dis. 2020 Mar 16. pii: ciaa272.
References