Njiru, 2012 has described that " Lack of effective point of care diagnostic tests applicable in resource-poor endemic areas is a critical barrier to effective treatment and control of infectious diseases.” Therefore, Innovations in biotechnology that combine molecular biology, microfabrication and bioinformatics are moving nucleic acid technologies from futuristic possibilities to common laboratory techniques and modes for diagnoses. In this context, LAMP (Loop Mediated Isothermal Amplification) is a highly sensitive and specific DNA/RNA amplification method. Advantage of LAMP is isothermal reaction condition and therefore, LAMP is affordable because of no need to have expensive thermal cycler.
LAMP is a DNA amplification technology which enables rapid and sensitive detection and when run on the Genie III platform enables detection of pests and diseases outside of the laboratory at any point in the agri-food chain where decisions are being made.
The target audience are researchers, agri-business and forestry experts, farmers and foresters and any other interested in being introduced to this portable molecular diagnostic tools on plant diseases.
Do not hesitate to contact EMPHASIS project through Facebook, Twitter, email (emphasisproject@gmail.com), Youtube or through our website (http://www.emphasisproject.eu/) if you want to be updated on webinars dates and content and book a ticket.
To watch on Youtube: https://youtu.be/Dg-lAjuCYuQ
Real-Time PCR
The Polymerase Chain Reaction (PCR) is a process for the
amplification of specific fragments of DNA.
Real-Time PCR a specialized technique that allows a PCR reaction
to be visualized “in real time” as the reaction progresses.
Real-Time PCR allows us to measure minute amounts of DNA
sequences in a sample.
Uses of Real-Time PCR
Real-Time PCR has become a cornerstone of molecular biology:
Gene expression analysis
Cancer research
Drug research
Disease diagnosis and management
Viral quantification
Food testing
Testing of GMO food
Animal and plant breeding
Gene copy number
This is a powerpoint file of a practical class taken by Dr. Karthikeyan Pethsuamay for the first year MBBS students of AIIMS, New Delhi. Feel free to download and use for educational purposes. Happy learning and teaching!
Don't forget to watch the YouTube video.
Njiru, 2012 has described that " Lack of effective point of care diagnostic tests applicable in resource-poor endemic areas is a critical barrier to effective treatment and control of infectious diseases.” Therefore, Innovations in biotechnology that combine molecular biology, microfabrication and bioinformatics are moving nucleic acid technologies from futuristic possibilities to common laboratory techniques and modes for diagnoses. In this context, LAMP (Loop Mediated Isothermal Amplification) is a highly sensitive and specific DNA/RNA amplification method. Advantage of LAMP is isothermal reaction condition and therefore, LAMP is affordable because of no need to have expensive thermal cycler.
LAMP is a DNA amplification technology which enables rapid and sensitive detection and when run on the Genie III platform enables detection of pests and diseases outside of the laboratory at any point in the agri-food chain where decisions are being made.
The target audience are researchers, agri-business and forestry experts, farmers and foresters and any other interested in being introduced to this portable molecular diagnostic tools on plant diseases.
Do not hesitate to contact EMPHASIS project through Facebook, Twitter, email (emphasisproject@gmail.com), Youtube or through our website (http://www.emphasisproject.eu/) if you want to be updated on webinars dates and content and book a ticket.
To watch on Youtube: https://youtu.be/Dg-lAjuCYuQ
Real-Time PCR
The Polymerase Chain Reaction (PCR) is a process for the
amplification of specific fragments of DNA.
Real-Time PCR a specialized technique that allows a PCR reaction
to be visualized “in real time” as the reaction progresses.
Real-Time PCR allows us to measure minute amounts of DNA
sequences in a sample.
Uses of Real-Time PCR
Real-Time PCR has become a cornerstone of molecular biology:
Gene expression analysis
Cancer research
Drug research
Disease diagnosis and management
Viral quantification
Food testing
Testing of GMO food
Animal and plant breeding
Gene copy number
This is a powerpoint file of a practical class taken by Dr. Karthikeyan Pethsuamay for the first year MBBS students of AIIMS, New Delhi. Feel free to download and use for educational purposes. Happy learning and teaching!
Don't forget to watch the YouTube video.
Light regulated expression of a plant development gene in tomatoArthur Stem
Light is a critical factor for plant development. The importance of this factor has resulted in plants developing a complex signaling system to regulate response to light quality and quantity. Studies of Arabidopsis show that negative regulation is an important component of this process. With this in mind, it’s important to consider the effect light can have on the cessation or continuation of negative regulation found in gene expression. Recently the tomato genome was sequenced; this offers a promising opportunity to study how light regulates gene expression and development in this essential crop. This study looks at the DEETIOLATED-1 (DET1) gene mutation, found in naturally occurring hp2dg (high pigment-2 dark green) tomato plants.
Polymerase chain reaction is a technique used in molecular biology to amplify a single copy or a few copies of a segment of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence
In this ppt, the various types of PCR such as real time PCR, Reverse transcription PCR, multiplex PCR, ligation chain PCR, nested PCR which is applied in diagnosis of diseases, identification of genetic disorders, determination of polymorphism and also in DNA fingerprinting analysis are described.
Light regulated expression of a plant development gene in tomatoArthur Stem
Light is a critical factor for plant development. The importance of this factor has resulted in plants developing a complex signaling system to regulate response to light quality and quantity. Studies of Arabidopsis show that negative regulation is an important component of this process. With this in mind, it’s important to consider the effect light can have on the cessation or continuation of negative regulation found in gene expression. Recently the tomato genome was sequenced; this offers a promising opportunity to study how light regulates gene expression and development in this essential crop. This study looks at the DEETIOLATED-1 (DET1) gene mutation, found in naturally occurring hp2dg (high pigment-2 dark green) tomato plants.
Polymerase chain reaction is a technique used in molecular biology to amplify a single copy or a few copies of a segment of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence
In this ppt, the various types of PCR such as real time PCR, Reverse transcription PCR, multiplex PCR, ligation chain PCR, nested PCR which is applied in diagnosis of diseases, identification of genetic disorders, determination of polymorphism and also in DNA fingerprinting analysis are described.
Purification of total RNA from peripheral blood mononuclear cells - Download ...QIAGEN
Peripheral blood is often used for in vitro studies of the human immune system or immune responses, such as inflammation. An important part of the human immune system is represented by the peripheral blood mononuclear cells (PBMC). PBMC are blood cells characterized by a round nucleus and consist mainly of lymphocytes (T cells, B cells, and NK cells), macrophages and dendritic cells. Here, we describe the analysis of lipopolysaccharide-induced transcriptional response of isolated PBMC from whole blood using the RNeasy® Mini Kit or RNeasy Micro Kit, RT2 First Strand Kit, RT2 SYBR® Green ROX™ qPCR Mastermix, and RT2 Profiler PCR Arrays.
A TaqMan-based Quantitative RT-PCR Method for Detection of Apple Chlorotic Le...Agriculture Journal IJOEAR
Abstract—ACLSV is one of the major fruit viruses and can cause severe diseases in species of family Rosaceae. Previous RT-PCR methods are available to detect ACLSV in hawthorn samples, but not to evaluate the infected level of ACLSV. In this study, a TaqMan-based quantitative RT-PCR detection method targeting CP gene of ACLSV was first established and the sensitivity and reproducibility were investigated. The results indicated that this standard curve between log of plasmid DNA concentration versus the cycle threshold (Ct) value generated a linear fit with a linear correlation (R2) of 0.99 and the PCR efficiency was more than 90%. The quantitative RT-PCR method was high sensitive and able to detect 6.9 × 102 copies•μL-1 of ACLSV RNA. Compared with the conventional RT-PCR method, it was 100-fold sensitive in detection of ACLSV. In addition, different organs of hawthorn samples were examined using the quantitative RT-PCR repeatedly and the result revealed that the quantitative RT-PCR is not only an effective detection method, and can obtain an absolute quantitation for ACLSV.
ShRNA-specific regulation of FMNL2 expression in P19 cellsYousefLayyous
This video encompasses all the steps and data produced for my graduation project in BSc in Biopharmaceutical science. During the course of the project we modified mammalian cells using Short Hairpin RNA to inhibit the correct function of the cytoskelleton. In this way we studied the importance of FMNL2 for the activation and regulation of actin fibers. Among the methods used are Flourescent microscopy, mamallian cell culture, cloning and flow cytometry.
I am Mark T. I am a Molecular Biology Assignment Expert at nursingassignmenthelp.com. I hold a Masters’ in Medical Biotechnology, from Arizona State University, USA. I have been helping students with their assignments for the past 8 years. I solve assignments related to Molecular Biology.
Visit nursingassignmenthelp.com or email info@nursingassignmenthelp.com. You can also call on +1 678 648 4277 for any assistance with Molecular Biology Assignments.
DNA damage repair Neil3 gene Knockout in MOLT-4iosrjce
RNAi is superannuated cellular mechanism that protect organism against viruses that replicate
through double- stranded RNA. RNAi can be used to diminish gene expression from plasmid expressing and
inserted sequence repeat. A stable harpin would be expressed after the vector was integrated into the genome.
In this paper a shiRNA expressing vector for Neil3 was designed and developed which is capable of replication
in MOLT-4. This shiRNA vector had the ability to arose the RNAi pathway, and reduce the gene expression of
Neil3. This was assessed by using pSilence 4.1CMV as a vector, and Gapdh as positive control.
1. 1
The Expression of Chlorophyll a/b Binding Protein in
Glycine Max
By: Alexander Ward
CMB 426 – Dr. Tsou
2. 2
Exposure tointense lightcausesincreasedplastoquinone betweenPSIandII, down-regulation
of bothLHCA and LHCB as intensity increases,more soforLHCB.3
Thiscouldbe due to a type of photonic
protection,asincreasingthe quantityof photonscan’tincrease the rate of photosynthesisindefinitely.
Qualitiesof lightalsohave animpactonthe expressionof LHCA andLHCB. Red and greenlightcaused
increasedexpressionof several LHCA andLHCB genes,relative topolychromaticlight.3
If the expression
of bothgenes,LHCA and LHCB, increase,itwouldstandtoreasonthat the chlorophyll a/bbinding
proteinwouldbe essential to these,andwouldalsoneedtobe upregulated.
Figure 1: RT-PCR analysis ofthe expressionofthe Zostera marina LHC (ZmLhc) gene familyunder
differentlightquality. A, the expressionof ZmLhca. B,the expressionof ZmLhcb. The arrowsindicate
geneswithsignificantexpressionchanges.3
As previouslystated,intheory,increasingthe expressionof LHCA andLHCB wouldcause
chlorophyll a/bbindingproteintoalsoupregulate. Usingred,blue andgreenlightcanincrease the
expressionof manytypes of LHCA and LHCB. The color whichinducesupregulationof the LHCPgene
may be differentinGlycine max thanZosteramarina,anaquatic plant. The procedure will requirethat
the samplesbe exposedtothe same intensityof lightforthe same quantityof time. The lightwill be
initiallypolychromatic,butfilteredbyfilterpaper toabsorbthe wavelengthsof interest. Usingagray
lightfilterasthe control, red,blue andgreenlightasexperimental protocols,determinationof the
difference inexpressionof the chlorophyll a/bbindingproteincanbe done bysamplingthe leaves of
mature plants and performingaRT-PCR.
3. 3
Figure 2: Diagram of the four complexes. PSII: photosystemII,cyt b6/f:part of the electrontransport
chainbetweenPSIIandPS I, PSI: photosystemI,CF1: ATPsynthase,CF0:protonchannel. Proteins
encodedbythe nucleusare blue,thatof plastidshave differentcolors.2
Chlorophyll a/bbindingproteincanbind bothChl-A andChl-B. Thisisknownas a photoactive
protein-chlorophyllorprotein-pigmentcomplex. There are a few differentformsof Chlorophyll a/b
bindingprotein,someare codedbynucleusDNA,whileothersare codedbythe ChloroplastDNA. This
complexeswithotherproteinsandformsthe lightharvestingcomplex (LHC) forphotosynthesis. In
changinglightconditions, Chlorophylla/bbindingprotein representsasystemforbalancingthe two
photosystems.2
The experimental conditionswillbe filteringthe same intensityof lightwithfilterlenses,red,
greenandblue. The seedlings,1weekold,will be exposedtothese lightsourceswithconstantintensity
for 18 hours,and inthe dark for 8 hours. The experimentwillcontinuefor1 week. After1 week,the
plantswill have theirprimaryleavesharvestedandanalyzedusingRT-PCR.
In triplicate seedlingspertreatment,blue,greenandredlight,andone triplicate of seedlingsfor
the grey filteredlight. Eachseedlingwill needtobe placedthe same distance fromthe lightsource to
avoidvariationinlightintensity. The seedlingswill be 1weekold,andexposedtothisexperimentfor1
week,before harvestingthe primaryleavesforRT-PCR. There wasa small variationinintensity,28± 4%
transmittance.
The RNA wasisolatedbyfirstpowderingthe primaryleaf tissue withliquidnitrogen. All of the
primaryleaveswere cutoff andgrindeddowninliquidnitrogen. Thismethodpreventsdegradationof
RNA afterbeingcut fromthe plant. The sampleswere storedat -80o
C until RNA extractionhadtaken
place.
The tissue wasthensubjectedtothe QiagenRNeasyExtractionKit. The kitcombinesaseriesof
debrisfiltrationandwashestoremove cellularcomponentsfromthe sample. The kitcontainstwo
extractionbufferscalledRLCandRLT. RLC isusedwithfibroustissuessuchasthe cotyledonandolder
4. 4
plants,while RLTisusedforleavesandothertissues. All butone sample wassuccessfulinextracting
RNA withbufferRLT,while the control hadto be repeatedusingRLC.
AfterRNA extraction,the sampleswere quantifiedusingA260/A280. Inorderto calculate the
concentrationof RNA usingA260 we hadusedthe equation,
(1) 𝑀𝑎𝑠𝑠 𝑜𝑓 𝑅𝑁𝐴 = (𝐴260) × (𝑅𝑁𝐴 𝑐𝑜𝑛𝑠𝑡𝑎𝑛𝑡)× (𝑉𝑜𝑙𝑢𝑚𝑒 𝑜𝑓 𝑆𝑎𝑚𝑝𝑙𝑒)
Sample A260 RNA Constant
(
𝜇𝑔
𝜇𝐿
)
Volume
(μL)
Mass of
RNA (μg)
Control 0.032 40 38 4.864
Red 0.132 40 38 20.064
Green 0.048 40 38 7.296
Blue 0.081 40 38 12.312
Table 1: Conversionof A260 into mass per sample.
The sampleswere furtherquantifiedusingaglyoxal RNA gel electrophoresisanddetermining
the relative netpixelcount. The netpixel intensitywasnormalizedbytakingthe ratioof eachvalue
versesone of the middle intensitysamples. Thiswill avoid havingtouse toomuchof one sample ortoo
little of anothersample.
Sample Volume (μL) NetPixel Count Normalization RT-PCRVolume (μL)
Control 7.81 621903 1.00 7.81
Red 1.89 484357 1.28 2.42
Green 5.21 831066 0.75 3.91
Blue 3.09 882641 0.70 2.16
Table 2: Normalization ofRNA gel usingnet pixel intensityrelative tothe control sample.
Finally,the mRNA hadundergone RT-PCRinordertoquantifyusingrelative endpointnetpixel
count inorderto determine howthe mRNA expressionlevelshave changedduringeachtreatment.
Oligo Start Length TM GC% Seq
Left Primer 264 20 53.7 55% GGTTCGATCCGTTTGGGCTA
Right Primer 863 20 53.4 55% ATGGTTGTGTGGAGTGGGTC
Table 3: Primer sequencesandmeltingpoints. The resultingproductsize is599 bp. Primerdesign
generatedusingBLAST.1
5. 5
Figure 3: PrimerTest Gel. Startingfrom the rightside,lane 1 isthe negative control,lane 2is blank,
lane 3 is the molecularweightladder,andlane 4is the primertestlane. The single bandat the
approximate amountof nucleotidesisobserved.
6. 6
Figure 4: Agarose Gel ElectrophoresisofcDNA resultingfrom RT-PCR. In eachtreatmentlane,fromleft
to right,the concentrationgoesfrom100
, 10-1
and 10-2
. Measuringthe net pixel intensityof the 10-2
samplestodetermine the expressionof the gene of interest. The control hada netintensityof 84420,
redwith67789, greenwith49589, and blue with21910. Relative tothe control,eachexperimental
conditioncauseddownregulationof the mRNA forchlorophylla/bbindingprotein.
Overall Conclusion:The resultingmRNA followingthe treatmentswasdownregulationineverycase,
unexpectedfromwhatwastheorized. The resultcouldbe due todifferentformsof expressingthe
gene,suchas DNA modificationoralternative splicing. Modificationcanalsooccur at the proteinlevel,
such as inhibitingorpromotingthe functionof the protein. Itwasobservedduringthe experimentthat
the seedlinginthe filteredblue lightconditionsseemedtobe the weakest,catabolizingpartof the
cotyledon. Repeatthe experimentwithvariation inincubationtime. Forfuture work,we coulduse
differentamountsof transmittedlight,basedonthe filterusedorvarythe distance fromthe light
source. We couldalsoadjustthe amountof incubationtime,andgeta betterideaof the trendinmRNA
expressionovertime. We couldalsotestchloroplastRNA orDNA expressionof all the chlorophyll a/b
bindingproteins.2
