The document discusses finding regulatory motifs in DNA sequences. It begins with an example of implanting a hidden motif into random DNA sequences and mutations introduced into the motif. This illustrates the difficulty of identifying motifs since even instances of the same motif can differ. The document then discusses how transcription factors regulate genes by binding to specific motifs, and how identifying conserved motifs across genes' regulatory regions can help discover regulatory relationships between genes. Several complications of the motif finding problem are outlined.
This document discusses gene motifs and algorithms for finding motifs in DNA sequences. It defines a gene as a segment of DNA that encodes a protein, and a motif as a conserved element in a protein sequence alignment that correlates with a function. It describes exact and non-exact matching algorithms for finding motifs, including brute force searching all possible motif positions and planted motif search (PMS) algorithms. PMS works by generating all possible short subsequences (l-mers) from each input sequence and finding the common motif.
Post-editese: an Exacerbated Translationese (presentation at MT Summit 2019)Antonio Toral
The document summarizes an analysis of post-edited translations compared to human translations in terms of translationese principles. The analysis uses several datasets containing human translations, machine translations, and post-edits. Experiments measure lexical variety, lexical density, length ratio, and perplexity on parts-of-speech sequences to analyze differences between human translations, machine translations, and post-edits. The results generally show that post-edits exhibit characteristics that are between those of human translations and machine translations, indicating that post-editing does not fully remove the "footprint" of machine translation.
This talk will cover various aspects of Logic Programming. We examine Logic Programming in the contexts of Programming Languages, Mathematical Logic and Machine Learning.
We will we start with an introduction to Prolog and metaprogramming in Prolog. We will also discuss how miniKanren and Core.Logic differ from Prolog while maintaining the paradigms of logic programming.
We will then cover the Unification Algorithm in depth and examine the mathematical motivations which are rooted in Skolem Normal Form. We will describe the process of converting a statement in first order logic to clausal form logic. We will also discuss the applications of the Unification Algorithm to automated theorem proving and type inferencing.
Finally we will look at the role of Prolog in the context of Machine Learning. This is known as Inductive Logic Programming. In that context we will briefly review Decision Tree Learning and it's relationship to ILP. We will then examine Sequential Covering Algorithms for learning clauses in Propositional Calculus and then the more general FOIL algorithm for learning sets of Horn clauses in First Order Predicate Calculus. Examples will be given in both Common Lisp and Clojure for these algorithms.
Pierre de Lacaze has over 20 years’ experience with Lisp and AI based technologies. He holds a Bachelor of Science in Applied Mathematics and Computer Science and a Master’s Degree in Computer Science. He is the president of LispNYC.org
The second lecture of expert system with python course.
Enjoy!
you can find the first lecture here:
https://www.slideshare.net/ahmadhussein45/expert-system-with-python-1
Pattern Mining To Unknown Word Extraction (10Jason Yang
The document discusses using pattern mining and machine learning techniques to identify and extract unknown words from Chinese text. It begins with an introduction on Chinese word segmentation challenges and types of unknown words. It then discusses related work using particular and general methods. The main techniques described are using continuity pattern mining to derive unknown word detection rules (Phase 1), and applying machine learning classification and sequential learning for extraction (Phase 2). Experimental results show improvements over previous work, with an F1-score of 0.614 for unknown word extraction.
Rule-based reasoning in the Semantic WebFulvio Corno
An introduction to SWRL and to rule-based reasoning languagest for the Semantic Web. The material is mostly taken from the Semantic Web Recommendations. Slides for the PhD Course on Semantic Web (http://elite.polito.it/).
Membranes are composed of lipids and proteins that form a bilayer. This structure allows membranes to compartmentalize cells and organelles while regulating the transport of substances. Lipids are the main structural component and include fatty acids, glycerol, and phospholipids. Fatty acids esterify to glycerol to form simple lipids like triglycerides, which function as energy stores. More complex lipids contain additional groups like phosphate and incorporate into membranes. Membranes use the asymmetric lipid bilayer to control permeability through passive diffusion and active transporters.
1) The document describes a method called PepChipOmics for mapping epitopes using digital mirror devices to generate peptide arrays containing over 100,000 peptides.
2) As a demonstration, a monoclonal antibody specific for the protein Tapasin was used to map its epitope.
3) The epitope was identified as the sequence LDPEL (residues 40-44 of Tapasin) based on a strong fluorescence signal on the peptide chip and inhibition of antibody binding by a synthesized peptide containing this sequence.
This document discusses gene motifs and algorithms for finding motifs in DNA sequences. It defines a gene as a segment of DNA that encodes a protein, and a motif as a conserved element in a protein sequence alignment that correlates with a function. It describes exact and non-exact matching algorithms for finding motifs, including brute force searching all possible motif positions and planted motif search (PMS) algorithms. PMS works by generating all possible short subsequences (l-mers) from each input sequence and finding the common motif.
Post-editese: an Exacerbated Translationese (presentation at MT Summit 2019)Antonio Toral
The document summarizes an analysis of post-edited translations compared to human translations in terms of translationese principles. The analysis uses several datasets containing human translations, machine translations, and post-edits. Experiments measure lexical variety, lexical density, length ratio, and perplexity on parts-of-speech sequences to analyze differences between human translations, machine translations, and post-edits. The results generally show that post-edits exhibit characteristics that are between those of human translations and machine translations, indicating that post-editing does not fully remove the "footprint" of machine translation.
This talk will cover various aspects of Logic Programming. We examine Logic Programming in the contexts of Programming Languages, Mathematical Logic and Machine Learning.
We will we start with an introduction to Prolog and metaprogramming in Prolog. We will also discuss how miniKanren and Core.Logic differ from Prolog while maintaining the paradigms of logic programming.
We will then cover the Unification Algorithm in depth and examine the mathematical motivations which are rooted in Skolem Normal Form. We will describe the process of converting a statement in first order logic to clausal form logic. We will also discuss the applications of the Unification Algorithm to automated theorem proving and type inferencing.
Finally we will look at the role of Prolog in the context of Machine Learning. This is known as Inductive Logic Programming. In that context we will briefly review Decision Tree Learning and it's relationship to ILP. We will then examine Sequential Covering Algorithms for learning clauses in Propositional Calculus and then the more general FOIL algorithm for learning sets of Horn clauses in First Order Predicate Calculus. Examples will be given in both Common Lisp and Clojure for these algorithms.
Pierre de Lacaze has over 20 years’ experience with Lisp and AI based technologies. He holds a Bachelor of Science in Applied Mathematics and Computer Science and a Master’s Degree in Computer Science. He is the president of LispNYC.org
The second lecture of expert system with python course.
Enjoy!
you can find the first lecture here:
https://www.slideshare.net/ahmadhussein45/expert-system-with-python-1
Pattern Mining To Unknown Word Extraction (10Jason Yang
The document discusses using pattern mining and machine learning techniques to identify and extract unknown words from Chinese text. It begins with an introduction on Chinese word segmentation challenges and types of unknown words. It then discusses related work using particular and general methods. The main techniques described are using continuity pattern mining to derive unknown word detection rules (Phase 1), and applying machine learning classification and sequential learning for extraction (Phase 2). Experimental results show improvements over previous work, with an F1-score of 0.614 for unknown word extraction.
Rule-based reasoning in the Semantic WebFulvio Corno
An introduction to SWRL and to rule-based reasoning languagest for the Semantic Web. The material is mostly taken from the Semantic Web Recommendations. Slides for the PhD Course on Semantic Web (http://elite.polito.it/).
Membranes are composed of lipids and proteins that form a bilayer. This structure allows membranes to compartmentalize cells and organelles while regulating the transport of substances. Lipids are the main structural component and include fatty acids, glycerol, and phospholipids. Fatty acids esterify to glycerol to form simple lipids like triglycerides, which function as energy stores. More complex lipids contain additional groups like phosphate and incorporate into membranes. Membranes use the asymmetric lipid bilayer to control permeability through passive diffusion and active transporters.
1) The document describes a method called PepChipOmics for mapping epitopes using digital mirror devices to generate peptide arrays containing over 100,000 peptides.
2) As a demonstration, a monoclonal antibody specific for the protein Tapasin was used to map its epitope.
3) The epitope was identified as the sequence LDPEL (residues 40-44 of Tapasin) based on a strong fluorescence signal on the peptide chip and inhibition of antibody binding by a synthesized peptide containing this sequence.
The document summarizes epitope prediction and its algorithms. It discusses that epitopes are the portions of antigens responsible for antigen-antibody specificity. There are two main types of epitopes: sequential/continuous epitopes recognized by T helper cells and conformational/discontinuous epitopes recognized by both T and B cells. It then describes several computational algorithms used for predicting B-cell and T-cell epitopes, including Hopp & Woods, Welling's method, Karplus & Schultz parameters, and Kolaskar & Tongaonkar's method. Finally, it lists several databases and servers that can be used for epitope prediction, such as SYFPEITHI, MHCPEP, and EPIM
Pharmacology is the study of drug interactions with biological systems. It is explained by pharmacokinetics, which studies how the body affects drugs, and pharmacodynamics, which studies how drugs affect the body. An ideal drug is effective and safe. Pharmacokinetics principles include absorption, distribution, metabolism and excretion of drugs in the body. Drugs can be administered via several routes including oral, parenteral, inhalation and others. The rate and extent of drug absorption depends on factors like solubility, permeability and first-pass metabolism.
THIS ppt explains in brief about general anesthesia for under graduates. It includes brief classification, mechanism of action, side effects of some important drugs. concepts like diffusion hypoxia, second gas effect, balanced anesthesia and pre- anaesthetic medication are discussed.
Pharmacodynamics is the study of how drugs act on the body, including their biochemical and physiological effects and the mechanisms of drug action at the organ and cellular levels. Most drugs interact with biomolecules like enzymes, ion channels, transporters, and receptors. Receptors are macromolecules that recognize signal molecules like drugs and initiate a response. Drugs can act as agonists, antagonists, partial agonists, or inverse agonists depending on how they activate or inhibit receptor activity. The drug-receptor interaction is governed by affinity and intrinsic activity. Transmembrane signaling is accomplished by G-protein coupled receptors, receptors with intrinsic ion channels, enzyme-linked receptors, and transcription factor receptors.
Thermo regulation – physiology temperature monitoringbalu muppala
This document discusses thermoregulation and temperature monitoring during anesthesia. It covers:
- How the body normally regulates temperature through thermal sensing, central regulation in the hypothalamus, and efferent responses like sweating and shivering.
- How general anesthetics impair this regulation by raising warm thresholds slightly but markedly lowering cold thresholds, widening the safe temperature range.
- The effects of specific anesthetics like propofol, nitrous oxide, and volatile agents in decreasing cold response thresholds more than warm thresholds.
- The importance of temperature monitoring during anesthesia given impaired thermoregulation can lead to hypothermia and associated complications.
Mechanism of general anaesthesia at molecular level.narasimha reddy
This document discusses the mechanism of general anesthesia at the molecular level. It begins by introducing general anesthetics and their historical use. While anesthetics have been used for over 160 years, their exact mechanism of action is still unknown. The document then examines various theories for how anesthetics act, including affecting ion channels such as GABA, glutamate, and calcium channels. It also discusses the Meyer-Overton hypothesis that anesthetic potency correlates with lipid solubility. While research continues, no single theory can fully explain anesthesia and its effects are thought to involve multiple molecular targets in the brain and nervous system.
Drug use in hepatic and renal impairmentAkshil Mehta
- Drugs are more likely to accumulate and cause toxicity in patients with impaired liver or kidney function due to reduced drug metabolism and excretion. The pharmacokinetics of many drugs are altered in patients with hepatic or renal impairment.
- In liver disease, drug absorption, metabolism, protein binding, and elimination can all be affected. Dosage reductions are often required for drugs that are metabolized by the liver. Hepatotoxic drugs should be avoided when possible.
- In kidney disease, drug absorption and excretion may be altered. Drugs that are weak acids or bases can be "trapped" in the urine through changes in urine pH. Dosage adjustments are often needed for drugs excreted by
The document provides an overview of general anesthesia, including its history, definition, principles, effects on the body, and mechanisms of action. It discusses how early ideas focused on a unitary theory of anesthesia and cell membranes, but research now shows general anesthetics act by enhancing the inhibitory effects of GABA receptors in the brain. Specifically, the intravenous anesthetic propofol acts as a positive modulator of GABA receptors containing beta subunits, producing its sedative effects.
The document discusses inhalational anaesthetic agents. It covers their physicochemical properties, mechanisms of anaesthesia, uptake and distribution in the body, and various physiological effects. It also discusses concepts such as minimum alveolar concentration (MAC), anaesthetic pre-conditioning and cardioprotection, and environmental and safety considerations regarding inhalational agents.
Stage III: Stage of Surgical Anaesthesia
- Begins after excitement stage ends and lasts until anaesthetic is stopped
- Patient is unconscious and has regular breathing
- Pupils are dilated and fixed
- Reflexes like eyelash, swallowing are lost
- Surgery can be safely performed during this stage
- Hi-C has determined the 3D structure of genomes. Transposons and retroelements are mobile genetic elements that can copy and insert into new genome regions.
- Mutations can occur through nucleotide changes or changes at the codon/protein level, causing missense, nonsense, or silent mutations. A single nucleotide change is a point mutation.
- Gene identification in eukaryotes considers promoters, introns/exons, splice sites, polyA signals, and codon usage bias. Experimental validation is needed to prove a sequence is truly a gene.
The concept of the gene is and has always been a continuously evolving one. In order to provide a structure for understanding the concept, its history is divided into classical, neoclassical, and modern periods. The classical view prevailed into the 1930s, and conceived the gene as an indivisible unit of genetic transmission, recombination, mutation, and function. The discovery of intragenic recombination in the early 1940s and the establishment of DNA as the physical basis of inheritance led to the neoclassical concept of the gene, which prevailed until the 1970s. In this view the gene (or cistron, as it was called then) was subdivided into its constituent parts, mutons and recons, identified as nucleotides. Each cistron was believed to be responsible for the synthesis of a single mRNA and hence for one polypeptide. This colinearity hypothesis prevailed from 1955 to the 1970s. Starting from the early 1970s, DNA technologies have led to the modern period of gene conceptualization, wherein none of the classical or neoclassical criteria are sufficient to define a gene. Modern discoveries include those of repeated genes, split genes and alternative splicing, assembled genes, overlapping genes, transposable genes, complex promoters, multiple polyadenylation sites, polyprotein genes, editing of the primary transcript, and nested genes. We are currently left with a rather abstract, open, and generalized concept of the gene, even though our comprehension of the structure and organization of the genetic material has greatly increased.
This document discusses genomic repeats and techniques for finding repeats and matching patterns in DNA sequences. It covers using hash tables to store and retrieve DNA sequences, building keyword trees to represent sets of sequences, and constructing suffix trees to efficiently find all occurrences of a pattern in a string. Suffix trees allow pattern matching to be performed in linear time compared to quadratic time for a naive approach. The document also introduces the problem of approximate pattern matching and heuristic search algorithms used to quickly find similar matches in large genomes.
Understanding mechanisms underlying human gene expression variation with RNA ...Joseph Pickrell
This document summarizes a study that used RNA sequencing of lymphoblastoid cell lines from 69 Nigerian individuals to identify genetic variants that influence gene expression and splicing. It identified approximately 1,000 expression quantitative trait loci (eQTLs) and 200 splicing quantitative trait loci (sQTLs). eQTLs were enriched near transcription start sites, while sQTLs were enriched in and around canonical splice sites. The study also reannotated the genome by identifying over 4,000 previously unannotated exons and 400 new polyadenylation sites.
This document discusses gene prediction and some of the computational challenges involved. It covers topics like genes and proteins, gene prediction problems, computational approaches like using open reading frames and codon usage. It also discusses central dogma, exons, introns, splicing signals, genetic code and different gene prediction algorithms.
This document discusses gene prediction and some of the computational challenges involved. It covers topics like genes and proteins, gene prediction problems, computational approaches like using open reading frames and codon usage. It also discusses central dogma, exons, introns, splicing signals, genetic code and stop codons. Popular gene prediction algorithms like GENSCAN and TWINSCAN that use hidden Markov models and similarity are also mentioned.
This document provides an overview of genetic algorithms:
- It describes the biological inspiration from Darwin's theory of evolution and natural selection. Genetic algorithms mimic this process to optimize solutions.
- The core components of a genetic algorithm are explained - populations of chromosomes are evolved over generations using selection, crossover and mutation operators.
- Examples are given to demonstrate how genetic algorithms can be used to find the minimum of a function and solve a checkboard coloring problem.
- Potential applications to parameter optimization in molecular modeling are discussed.
Course: Bioinformatics for Biomedical Research (2014).
Session: 1.3- Genome Browsing, Genomic Data Mining and Genome Data Visualization with Ensembl, Biomart and IGV.
Statistics and Bioinformatisc Unit (UEB) & High Technology Unit (UAT) from Vall d'Hebron Research Institute (www.vhir.org), Barcelona.
Using Bayesian methods and modeling character change heterogeneity, the study found:
1) Modeling asymmetry in character change (relaxing the symmetrical change assumption) can better reflect empirical morphological data in about half of datasets analyzed.
2) In simulations, the generating model of character change asymmetry could be detected among misspecified models using model selection.
3) Estimating trees using the best-fit model of character change asymmetry resulted in topologies that were more accurate compared to misspecified models, especially with increasing amounts of missing data.
DNA contains genetic information that codes for proteins. It is found in the nucleus of cells in structures called chromosomes. DNA differs between individuals at certain locations called loci. Forensic DNA analysis involves extracting DNA from evidence samples, amplifying regions of interest using PCR, separating the amplified DNA, and comparing it to reference samples. If DNA matches between an evidence sample and suspect, statistics are presented on the estimated frequency of that DNA profile in a population. Mitochondrial DNA analysis can be used for degraded samples and examines DNA sequence rather than length.
Genome and exome sequencing can be used to identify genetic variants that cause rare diseases. Whole genome sequencing requires 30-50X coverage to sequence the entire genome, while exome sequencing only sequences the 1-2% of the genome that is the exome, or protein-coding regions. Read mapping is used to align sequencing reads to the reference genome and is computationally intensive. Variant detection methods like spaced seeds and Burrows-Wheeler transforms are used to identify SNPs and indels, while structural variation can be detected using tools like BreakDancer that analyze read pairs and soft-clipped reads.
The document summarizes epitope prediction and its algorithms. It discusses that epitopes are the portions of antigens responsible for antigen-antibody specificity. There are two main types of epitopes: sequential/continuous epitopes recognized by T helper cells and conformational/discontinuous epitopes recognized by both T and B cells. It then describes several computational algorithms used for predicting B-cell and T-cell epitopes, including Hopp & Woods, Welling's method, Karplus & Schultz parameters, and Kolaskar & Tongaonkar's method. Finally, it lists several databases and servers that can be used for epitope prediction, such as SYFPEITHI, MHCPEP, and EPIM
Pharmacology is the study of drug interactions with biological systems. It is explained by pharmacokinetics, which studies how the body affects drugs, and pharmacodynamics, which studies how drugs affect the body. An ideal drug is effective and safe. Pharmacokinetics principles include absorption, distribution, metabolism and excretion of drugs in the body. Drugs can be administered via several routes including oral, parenteral, inhalation and others. The rate and extent of drug absorption depends on factors like solubility, permeability and first-pass metabolism.
THIS ppt explains in brief about general anesthesia for under graduates. It includes brief classification, mechanism of action, side effects of some important drugs. concepts like diffusion hypoxia, second gas effect, balanced anesthesia and pre- anaesthetic medication are discussed.
Pharmacodynamics is the study of how drugs act on the body, including their biochemical and physiological effects and the mechanisms of drug action at the organ and cellular levels. Most drugs interact with biomolecules like enzymes, ion channels, transporters, and receptors. Receptors are macromolecules that recognize signal molecules like drugs and initiate a response. Drugs can act as agonists, antagonists, partial agonists, or inverse agonists depending on how they activate or inhibit receptor activity. The drug-receptor interaction is governed by affinity and intrinsic activity. Transmembrane signaling is accomplished by G-protein coupled receptors, receptors with intrinsic ion channels, enzyme-linked receptors, and transcription factor receptors.
Thermo regulation – physiology temperature monitoringbalu muppala
This document discusses thermoregulation and temperature monitoring during anesthesia. It covers:
- How the body normally regulates temperature through thermal sensing, central regulation in the hypothalamus, and efferent responses like sweating and shivering.
- How general anesthetics impair this regulation by raising warm thresholds slightly but markedly lowering cold thresholds, widening the safe temperature range.
- The effects of specific anesthetics like propofol, nitrous oxide, and volatile agents in decreasing cold response thresholds more than warm thresholds.
- The importance of temperature monitoring during anesthesia given impaired thermoregulation can lead to hypothermia and associated complications.
Mechanism of general anaesthesia at molecular level.narasimha reddy
This document discusses the mechanism of general anesthesia at the molecular level. It begins by introducing general anesthetics and their historical use. While anesthetics have been used for over 160 years, their exact mechanism of action is still unknown. The document then examines various theories for how anesthetics act, including affecting ion channels such as GABA, glutamate, and calcium channels. It also discusses the Meyer-Overton hypothesis that anesthetic potency correlates with lipid solubility. While research continues, no single theory can fully explain anesthesia and its effects are thought to involve multiple molecular targets in the brain and nervous system.
Drug use in hepatic and renal impairmentAkshil Mehta
- Drugs are more likely to accumulate and cause toxicity in patients with impaired liver or kidney function due to reduced drug metabolism and excretion. The pharmacokinetics of many drugs are altered in patients with hepatic or renal impairment.
- In liver disease, drug absorption, metabolism, protein binding, and elimination can all be affected. Dosage reductions are often required for drugs that are metabolized by the liver. Hepatotoxic drugs should be avoided when possible.
- In kidney disease, drug absorption and excretion may be altered. Drugs that are weak acids or bases can be "trapped" in the urine through changes in urine pH. Dosage adjustments are often needed for drugs excreted by
The document provides an overview of general anesthesia, including its history, definition, principles, effects on the body, and mechanisms of action. It discusses how early ideas focused on a unitary theory of anesthesia and cell membranes, but research now shows general anesthetics act by enhancing the inhibitory effects of GABA receptors in the brain. Specifically, the intravenous anesthetic propofol acts as a positive modulator of GABA receptors containing beta subunits, producing its sedative effects.
The document discusses inhalational anaesthetic agents. It covers their physicochemical properties, mechanisms of anaesthesia, uptake and distribution in the body, and various physiological effects. It also discusses concepts such as minimum alveolar concentration (MAC), anaesthetic pre-conditioning and cardioprotection, and environmental and safety considerations regarding inhalational agents.
Stage III: Stage of Surgical Anaesthesia
- Begins after excitement stage ends and lasts until anaesthetic is stopped
- Patient is unconscious and has regular breathing
- Pupils are dilated and fixed
- Reflexes like eyelash, swallowing are lost
- Surgery can be safely performed during this stage
- Hi-C has determined the 3D structure of genomes. Transposons and retroelements are mobile genetic elements that can copy and insert into new genome regions.
- Mutations can occur through nucleotide changes or changes at the codon/protein level, causing missense, nonsense, or silent mutations. A single nucleotide change is a point mutation.
- Gene identification in eukaryotes considers promoters, introns/exons, splice sites, polyA signals, and codon usage bias. Experimental validation is needed to prove a sequence is truly a gene.
The concept of the gene is and has always been a continuously evolving one. In order to provide a structure for understanding the concept, its history is divided into classical, neoclassical, and modern periods. The classical view prevailed into the 1930s, and conceived the gene as an indivisible unit of genetic transmission, recombination, mutation, and function. The discovery of intragenic recombination in the early 1940s and the establishment of DNA as the physical basis of inheritance led to the neoclassical concept of the gene, which prevailed until the 1970s. In this view the gene (or cistron, as it was called then) was subdivided into its constituent parts, mutons and recons, identified as nucleotides. Each cistron was believed to be responsible for the synthesis of a single mRNA and hence for one polypeptide. This colinearity hypothesis prevailed from 1955 to the 1970s. Starting from the early 1970s, DNA technologies have led to the modern period of gene conceptualization, wherein none of the classical or neoclassical criteria are sufficient to define a gene. Modern discoveries include those of repeated genes, split genes and alternative splicing, assembled genes, overlapping genes, transposable genes, complex promoters, multiple polyadenylation sites, polyprotein genes, editing of the primary transcript, and nested genes. We are currently left with a rather abstract, open, and generalized concept of the gene, even though our comprehension of the structure and organization of the genetic material has greatly increased.
This document discusses genomic repeats and techniques for finding repeats and matching patterns in DNA sequences. It covers using hash tables to store and retrieve DNA sequences, building keyword trees to represent sets of sequences, and constructing suffix trees to efficiently find all occurrences of a pattern in a string. Suffix trees allow pattern matching to be performed in linear time compared to quadratic time for a naive approach. The document also introduces the problem of approximate pattern matching and heuristic search algorithms used to quickly find similar matches in large genomes.
Understanding mechanisms underlying human gene expression variation with RNA ...Joseph Pickrell
This document summarizes a study that used RNA sequencing of lymphoblastoid cell lines from 69 Nigerian individuals to identify genetic variants that influence gene expression and splicing. It identified approximately 1,000 expression quantitative trait loci (eQTLs) and 200 splicing quantitative trait loci (sQTLs). eQTLs were enriched near transcription start sites, while sQTLs were enriched in and around canonical splice sites. The study also reannotated the genome by identifying over 4,000 previously unannotated exons and 400 new polyadenylation sites.
This document discusses gene prediction and some of the computational challenges involved. It covers topics like genes and proteins, gene prediction problems, computational approaches like using open reading frames and codon usage. It also discusses central dogma, exons, introns, splicing signals, genetic code and different gene prediction algorithms.
This document discusses gene prediction and some of the computational challenges involved. It covers topics like genes and proteins, gene prediction problems, computational approaches like using open reading frames and codon usage. It also discusses central dogma, exons, introns, splicing signals, genetic code and stop codons. Popular gene prediction algorithms like GENSCAN and TWINSCAN that use hidden Markov models and similarity are also mentioned.
This document provides an overview of genetic algorithms:
- It describes the biological inspiration from Darwin's theory of evolution and natural selection. Genetic algorithms mimic this process to optimize solutions.
- The core components of a genetic algorithm are explained - populations of chromosomes are evolved over generations using selection, crossover and mutation operators.
- Examples are given to demonstrate how genetic algorithms can be used to find the minimum of a function and solve a checkboard coloring problem.
- Potential applications to parameter optimization in molecular modeling are discussed.
Course: Bioinformatics for Biomedical Research (2014).
Session: 1.3- Genome Browsing, Genomic Data Mining and Genome Data Visualization with Ensembl, Biomart and IGV.
Statistics and Bioinformatisc Unit (UEB) & High Technology Unit (UAT) from Vall d'Hebron Research Institute (www.vhir.org), Barcelona.
Using Bayesian methods and modeling character change heterogeneity, the study found:
1) Modeling asymmetry in character change (relaxing the symmetrical change assumption) can better reflect empirical morphological data in about half of datasets analyzed.
2) In simulations, the generating model of character change asymmetry could be detected among misspecified models using model selection.
3) Estimating trees using the best-fit model of character change asymmetry resulted in topologies that were more accurate compared to misspecified models, especially with increasing amounts of missing data.
DNA contains genetic information that codes for proteins. It is found in the nucleus of cells in structures called chromosomes. DNA differs between individuals at certain locations called loci. Forensic DNA analysis involves extracting DNA from evidence samples, amplifying regions of interest using PCR, separating the amplified DNA, and comparing it to reference samples. If DNA matches between an evidence sample and suspect, statistics are presented on the estimated frequency of that DNA profile in a population. Mitochondrial DNA analysis can be used for degraded samples and examines DNA sequence rather than length.
Genome and exome sequencing can be used to identify genetic variants that cause rare diseases. Whole genome sequencing requires 30-50X coverage to sequence the entire genome, while exome sequencing only sequences the 1-2% of the genome that is the exome, or protein-coding regions. Read mapping is used to align sequencing reads to the reference genome and is computationally intensive. Variant detection methods like spaced seeds and Burrows-Wheeler transforms are used to identify SNPs and indels, while structural variation can be detected using tools like BreakDancer that analyze read pairs and soft-clipped reads.
An introduction to promoter prediction and analysisSarbesh D. Dangol
This document provides an introduction to promoter prediction and analysis in plants. It discusses what promoters are, including their cis-acting elements and core promoter regions. It describes different types of promoters such as constitutive, spatiotemporal, and inducible promoters. It also discusses models for finding binding sites in promoters and experimental approaches for identifying regulatory elements like chromatin immunoprecipitation. Finally, it mentions some bioinformatics tools and databases that can be used for promoter analysis.
This document discusses gene prediction and promoter prediction. It begins by explaining that gene prediction involves locating protein-coding genes within sequenced genomes in order to understand their functional content. Various computational methods are used for gene prediction, including searching for signals like start/stop codons, searching coding content, and comparing sequences to find homologs. Promoter prediction involves locating DNA elements that regulate gene expression and is challenging due to diversity and short, conserved motifs. Ab initio and comparative phylogenetic footprinting methods are used to predict promoters and regulatory elements in prokaryotes and eukaryotes.
Chromatin is a complex of DNA and proteins found in the nucleus of eukaryotic cells. It functions to compact DNA into chromosomes. Chromatin is made up of nucleosomes, which consist of DNA wound around histone proteins. Nucleosomes can further condense to form chromatin fibers. During cell division, chromatin condenses even further to form chromosomes. Chromatin is involved in processes like DNA replication, transcription, repair, and recombination. There are two main types: euchromatin, which decondenses during interphase, and heterochromatin, which remains condensed. Transposable elements are DNA sequences that can change positions within a genome. They are found in both prokaryotes and eukary
This document discusses methods for analyzing transgenic plants, including determining if a plant is transgenic and if transgenes are expressed. It describes established methods like PCR, Southern blots, and Northern blots. Southern blots are used to confirm transgene insertion into the genome by detecting fragments of different sizes after restriction enzyme digestion and gel electrophoresis. Northern blots detect RNA transcripts to confirm transgene expression. Proper experimental design and controls are important to avoid false positives and obtain conclusive evidence of stable transgene integration and expression.
Algorithm Implementation of Genetic Association Analysis for Rheumatoid Arth...Fatma Sayed Ibrahim
My M.Sc. dissertation defense. The title is "Algorithm Implementation of Genetic Association Analysis for Rheumatoid Arthritis Data Based on Haplotype Blocks"
The document outlines lectures on the human genome that will take place from October 12-16, 2014. It discusses the structure and content of the lectures. The lectures will cover: (1) an introduction and analogy comparing the genome to a book, (2) the human genome project and sequencing technologies, and (3) outcomes of the genomic era. It also provides background on the genome, including that humans are diploid and have 23 chromosome pairs, as well as an overview of polymerase chain reaction as a method for amplifying DNA sequences.
The document describes string comparison techniques using matrix algebra and seaweed matrices. It introduces the concept of semi-local string comparison, which involves comparing a whole string to substrings of another string. The key idea is representing string comparison matrices implicitly using seaweed matrices, which represent unit-Monge matrices. This allows developing algebraic techniques for efficiently multiplying such matrices using the algebra of braids and the seaweed monoid. These multiplication techniques can then be applied to problems like dynamic programming string comparison and comparing compressed strings.
The document provides an overview of the KNIME analytics platform and its capabilities. It discusses:
- KNIME's origins, offices, codebase, and application areas including pharma, healthcare, finance, retail, and more.
- The key components of the KNIME platform including data access, transformation, analysis, visualization, and deployment capabilities.
- Integrations with tools like R, Weka, databases, and file formats.
- Community contributions expanding KNIME's functionality in areas like bioinformatics, chemistry, image processing, and more.
Ядерный век прошел, и становится все понятнее, что в фокусе науки 21-го века будут живые системы, медицина, и человек во всех его проявлениях. Здесь осуществляются самые масштабные финансовые вливания, и на эту отрасль человечество возлагает самые большие надежды. Все чаще слышатся предметные обсуждения тем, казавшихся еще недавно научной фантастикой: сможет ли человечество победить старение, рак, и другие смертельные заболевания? Сможет ли менять свой геном по собственному желанию? Будем ли мы хозяевами своим телам в той же мере, как мы хозяйничаем на Земле?
Многие десятилетия биология и медицина развивались как описательные науки. Однако по мере созревания и накопления информации, любая наука рано или поздно переходит на более точный язык - язык математики. Проект "Геном человека" обеспечил технологический прорыв, который будет питать науку о живом еще много лет - но который также поставил много новых глобальных вопросов перед современными учеными.
Иммунотерапия раковых опухолей: взгляд со стороны системной биологии. Максим ...BioinformaticsInstitute
This document summarizes recent advances in cancer immunotherapy from the perspective of systems biology. It discusses how checkpoint blockade immunotherapy works by addressing the second co-inhibitory checkpoint signal needed for T cell activation. Computational methods are now able to identify tumor-specific neoantigens that can be targeted by immunotherapy. Mouse model studies showed that certain tumors are naturally rejected due to expression of a mutant antigen recognized by T cells, and that antigen-specific T cells are present before immunotherapy treatment. The high mutational load in melanoma makes it particularly responsive to checkpoint blockade. Early work in the 19th century by William Coley observed tumor regression following bacterial infection, which led to development of a toxin mixture that resembled modern vaccine formulations. Members of
http://bioinformaticsinstitute.ru/guests
В пятницу 10 октября в 19.00 Мария Шутова (ИоГЕН РАН) выступала в Институте биоинформатики с открытой лекцией, посвященной изучению рака.
Рак -- одна из наиболее распространенных причин смерти по всему миру. В лекции рассматривается, как знания об эволюции, работе генома, репрограммировании, а также использование биоинформатических методов помогли лучше понять, как развивается раковая опухоль и предложить новые методы лечения разнообразных типов рака. Рассмотрены мышиные модели развития рака и интересные результаты, которые были получены с их помощью.
http://bioinformaticsinstitute.ru/lectures
Гостевая лекция Института биоинформатики, 9 октября 2014. Лектор -- Мария Шутова (ИоГЕН РАН).
За последние десять лет плюрипонтентные клетки стали героями двух Нобелевских премий и многих тысяч научных и научно-популярных статей. Их уникальная возможность превращаться в любую клетку взрослого организма до сих пор дает пищу для ума как биологам развития, так и ученым, ищущим способы лечения генетических заболеваний. В лекции будет рассказано о двух типах плюрипотентных клеток: "естественных" (эмбриональные стволовые клетки) и "искусственных" (индуцированные плюрипотентные стволовые клетки). Отдельно мы остановимся на том, как знания о работе транскрипционных факторов помогли репрограммировать клетки, и как эти "искусственные" плюрипотентные клетки можно использовать в медицине.
Секвенирование как инструмент исследования сложных фенотипов человека: от ген...BioinformaticsInstitute
This document summarizes genetic analyses of complex human phenotypes. It describes whole genome sequencing of individuals from bipolar disorder families and finding an association between genetic variation in a chromosome 6 region and amygdala volume. It also discusses rare variant sequencing of metabolic syndrome-related genes in Finnish cohorts, identifying new signals beyond existing GWAS hits. Additionally, it outlines exome and targeted sequencing of Tourette syndrome pedigrees, with a genome-wide significant result in a long non-coding RNA gene linked to the trait.
В своей лекции Андрей Афанасьев рассказал о стартапах в биотехе и биоинформатике и своем биоинформатическом проекте iBinom, разобрал несколько биотехнологических проектов глазами инноваторов и инвесторов, а также коснулся вопроса поиска инвестиций и поделился личным опытом взаимодействия с венчурными фондами и институтами развития.
This document provides an overview of the ENCODE project and how its data can be accessed through the UCSC Genome Browser. It discusses the different types of ENCODE data available, including mapping data, gene annotations, expression data, regulatory information, and genetic variation. It also explains how to find, view, and download ENCODE tracks from the Genome Browser and where to get more information about ENCODE. The overall goal of the ENCODE project is to identify all functional elements in the human genome.
2. 1. Implanting Patterns in Random Text
2. Gene Regulation
3. Regulatory Motifs
4. The Gold Bug Problem
5. The Motif Finding Problem
6. Brute Force Motif Finding
7. The Median String Problem
8. Search Trees
9. Branch-and-Bound Motif Search
10. Branch-and-Bound Median String Search
11. Consensus and Pattern Branching: Greedy Motif Search
12. Planted Motif Search: Exhaustive Motif Search
Outline
7. Now Where is the Motif?
atgaccgggatactgatagaagaaaggttgggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg
acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacaataaaacggcggga
tgagtatccctgggatgacttaaaataatggagtggtgctctcccgatttttgaatatgtaggatcattcgccagggtccga
gctgagaattggatgcaaaaaaagggattgtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga
tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatataataaaggaagggcttatag
gtcaatcatgttcttgtgaatggatttaacaataagggctgggaccgcttggcgcacccaaattcagtgtgggcgagcgcaa
cggttttggcccttgttagaggcccccgtataaacaaggagggccaattatgagagagctaatctatcgcgtgcgtgttcat
aacttgagttaaaaaatagggagccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta
ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatactaaaaaggagcggaccgaaagggaag
ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttactaaaaaggagcgga
9. Challenge Problem
• Find a motif in a sample of 20 “random” sequences (e.g. 600
nucleotides long).
• Each sequence contains an implanted pattern of length 15.
• Each pattern appears with 4 mismatches.
• More generally, an (n, k) motif is a pattern of length n which
appears with k mismatches within a DNA sequence.
• So our challenge problem is to find a (15,4) motif in a group
of 20 sequences.
10. Why (15,4)-motif is hard to find?
• Goal: recover original pattern P from its (unknown!) instances:
P1 , P2 , … , P20
• Problem: Although P and Pi are similar for each i (4 mutations
for a (15,4) motif), given two different instances Pi and Pj, they
may differ twice as much (4 + 4 = 8 mutations for a (15,4)
motif).
• Conclusions:
1. Pairwise similiarities are misleading.
2. Multiple similarities are difficult to find.
11. Combinatorial Gene Regulation
• A microarray experiment showed
that when gene X is knocked out,
20 other genes are not expressed
• Motivating Question: How can
one gene have such drastic
effects?
DNA Microarray
12. Regulatory Proteins
• Answer: Gene X encodes regulatory protein, a.k.a. a
transcription factor (TF)
• The 20 unexpressed genes rely on gene X’s TF to induce
transcription
• A single TF may regulate multiple genes
13. Regulatory Regions
• Every gene contains a regulatory region (RR) typically
stretching 100-1000 bp upstream of the transcriptional start
site.
• Located within the RR are the Transcription Factor Binding
Sites(TFBS), also known as motifs, which are specific for a
given transcription factor.
• TFs influence gene expression by binding to a specific TFBS.
• A TFBS can be located anywhere within the regulatory region.
• TFBS may vary slightly across different regulatory regions
since non-essential bases could mutate.
16. Motif Logos
• Motifs can mutate on
unimportant bases.
• The five motifs in five different
genes have mutations in position
3 and 5.
• Representations called motif
logos illustrate the conserved
and variable regions of a motif.
• At right is an example of a
motif logo.
TGGGGGA
TGAGAGA
TGGGGGA
TGAGAGA
TGAGGGA
17. Motif Logos: An Additional Example
(http://www-lmmb.ncifcrf.gov/~toms/sequencelogo.html)
18. Identifying Motifs
• Recall that a TFBS is represented by a motif.
• Therefore finding similar motifs in multiple genes’ regulatory
regions suggests a regulatory relationship among those genes.
19. Identifying Motifs: Complications
• We do not know the motif sequence in advance.
• We do not know where the motif is located relative to the
genes’ start.
• As we have seen, a motif can differ slightly from one gene to
the next.
• How do we discern a motif with a real pattern from “random”
motifs that don’t represent real correlation between genes?
20. Detour: A Motif Finding Analogy
• The Motif Finding Problem is similar to the problem posed by
Edgar Allan Poe (1809 – 1849) in his short story “The Gold
Bug.”
21. The Gold Bug Problem
• “Here Legrand, having re-heated the parchment, submitted it to
my inspection. The following characters were rudely traced, in a
red tint, between the death's head and the goat:”
53++!305))6*;4826)4+.)4+);806*;48!8`60))85;]8*:+*8!83(88)5
*!;
46(;88*96*?;8)*+(;485);5*!2:*+(;4956*2(5*-4)8`8*;
4069285);)6
!8)4++;1(+9;48081;8:8+1;48!85;4)485!528806*81(+9;48;(88;4(
+?3
4;48)4+;161;:188;+?;
• Legrand’s Goal: Decipher the message on the parchment.
22. Gold Bug Problem: Assumptions
• The encrypted message is in English
• Each symbol corresponds to one letter in the English alphabet
• Conversely, no letter corresponds to more than one symbol
• No punctuation marks are encoded
23. Gold Bug Problem: Naïve Approach
• Count the frequency of each symbol in the encrypted message
• Find the frequency of each letter in the alphabet in the English
language
• Compare the frequencies of the previous steps, try to find a
correlation and map the symbols to a letter in the alphabet
24. Gold Bug Problem: Symbol Frequencies
• Gold Bug Message:
• English Language:
e t a o i n s r h l d c u m f p g w y b v k x j q z
Most frequent Least frequent
Symbol 8 ; 4 ) + * 5 6 ( ! 1 0 2 9 3 : ? ` - ] .
Frequency 34 25 19 16 15 14 12 11 9 8 7 6 5 5 4 4 3 2 1 1 1
25. Gold Bug Problem: Symbol Frequencies
• Result of using symbol frequencies:
sfiilfcsoorntaeuroaikoaiotecrntaeleyrcooestvenpinelefheeosnlt
arhteenmrnwteonihtaesotsnlupnihtamsrnuhsnbaoeyentacrmuesotorl
eoaiitdhimtaecedtepeidtaelestaoaeslsueecrnedhimtaetheetahiwfa
taeoaitdrdtpdeetiwt
• The result does not make sense.
• Therefore, we must use some other method to decode the
message.
26. Gold Bug Problem: l-tuple count
• A better approach is to examine the frequencies of l-tuples,
which are subsequences of 2 symbols, 3 symbols, etc.
• “The” is the most frequent 3-tuple in English and “;48” is the
most frequent 3-tuple in the encrypted text.
• We make inferences of unknown symbols by examining other
frequent l-tuples.
27. Gold Bug Problem: l-tuple count
• Mapping “the” to “;48” and substituting all occurrences of the
symbols:
53++!305))6*the26)h+.)h+)te06*the!e`60))e5t]e*:+*e!e3(ee)5*!t
h6(tee*96*?te)*+(the5)t5*!2:*+(th956*2(5*h)e`e*th0692e5)t)6!e
)h++t1(+9the0e1te:e+1the!e5th)he5!52ee06*e1(+9thet(eeth(+?3ht
he)h+t161t:1eet+?t
28. The Gold Bug Message Decoding: Second Attempt
• Make inferences:
53++!305))6*the26)h+.)h+)te06*the!e`60))e5t]e*:+*e!e3(ee)5*!t
h6(tee*96*?te)*+(the5)t5*!2:*+(th956*2(5*h)e`e*th0692e5)t)6!e
)h++t1(+9the0e1te:e+1the!e5th)he5!52ee06*e1(+9thet(eeth(+?3ht
he)h+t161t:1eet+?t
29. The Gold Bug Message Decoding: Second Attempt
• Make inferences:
53++!305))6*the26)h+.)h+)te06*the!e`60))e5t]e*:+*e!e3(ee)5*!t
h6(tee*96*?te)*+(the5)t5*!2:*+(th956*2(5*h)e`e*th0692e5)t)6!e
)h++t1(+9the0e1te:e+1the!e5th)he5!52ee06*e1(+9thet(eeth(+?3ht
he)h+t161t:1eet+?t
• “thet(ee” most likely means “the tree”
• Infer “(“ = “r”
30. The Gold Bug Message Decoding: Second Attempt
• Make inferences:
53++!305))6*the26)h+.)h+)te06*the!e`60))e5t]e*:+*e!e3(ee)5*!t
h6(tee*96*?te)*+(the5)t5*!2:*+(th956*2(5*h)e`e*th0692e5)t)6!e
)h++t1(+9the0e1te:e+1the!e5th)he5!52ee06*e1(+9thet(eeth(+?3ht
he)h+t161t:1eet+?t
• “thet(ee” most likely means “the tree”
• Infer “(“ = “r”
• “th(+?3h” becomes “thr+?3h”
• Can we guess “+” and “?”?
31. Gold Bug Problem: Solution
• Using inferences like these to figure out all the mappings, the
final message is:
AGOODGLASSINTHEBISHOPSHOSTELINTHEDEVILSSEATWENYONEDEGRE
ESANDTHIRTEENMINUTESNORTHEASTANDBYNORTHMAINBRANCHSEVENT
HLIMBEASTSIDESHOOTFROMTHELEFTEYEOFTHEDEATHSHEADABEELINE
FROMTHETREETHROUGHTHESHOTFIFTYFEETOUT
32. Gold Bug Problem: Solution
• Using inferences like these to figure out all the mappings, the
final message is:
AGOODGLASSINTHEBISHOPSHOSTELINTHEDEVILSSEATWENYONEDEGRE
ESANDTHIRTEENMINUTESNORTHEASTANDBYNORTHMAINBRANCHSEVENT
HLIMBEASTSIDESHOOTFROMTHELEFTEYEOFTHEDEATHSHEADABEELINE
FROMTHETREETHROUGHTHESHOTFIFTYFEETOUT
• Punctuation is important:
A GOOD GLASS IN THE BISHOP’S HOSTEL IN THE DEVIL’S SEA,
TWENTY ONE DEGREES AND THIRTEEN MINUTES NORTHEAST AND BY NORTH,
MAIN BRANCH SEVENTH LIMB, EAST SIDE, SHOOT FROM THE LEFT EYE OF
THE DEATH’S HEAD A BEE LINE FROM THE TREE THROUGH THE SHOT,
FIFTY FEET OUT.
33. Gold Bug Problem: Prerequisites
• There are two prerequisites that we need to solve the gold bug
problem:
1. We need to know the relative frequencies of single letters,
as well as the frequencies of 2-tuples and 3-tuples in
English.
2. We also need to know all the words in the English
language.
34. Gold Bug Problem and Motif Finding: Similarities
Motif Finding:
• Nucleotides in motifs encode for a message in the “genetic”
language.
• In order to solve the problem, we analyze the frequencies of
patterns in the nucleotide sequences
• Knowledge of established regulatory motifs makes the
Motif Finding problem simpler.
Gold Bug Problem:
• Symbols in “The Gold Bug” encode for a message in
English.
• In order to solve the problem, we analyze the frequencies of
patterns in the text written in English
• Knowledge of the words in the English language helps
35. Gold Bug Problem and Motif Finding: Similarities
Motif Finding:
• Nucleotides in motifs encode for a message in the “genetic”
language.
• In order to solve the problem, we analyze the frequencies of
patterns in the nucleotide sequences
• Knowledge of established regulatory motifs makes the
Motif Finding problem simpler.
Gold Bug Problem:
• Symbols in “The Gold Bug” encode for a message in
English.
• In order to solve the problem, we analyze the frequencies of
patterns in the text written in English
• Knowledge of the words in the English language helps
36. Gold Bug Problem and Motif Finding: Similarities
Motif Finding:
• Nucleotides in motifs encode for a message in the “genetic”
language.
• In order to solve the problem, we analyze the frequencies of
patterns in the nucleotide sequences
• Knowledge of established regulatory motifs makes the
Motif Finding problem simpler.
Gold Bug Problem:
• Symbols in “The Gold Bug” encode for a message in
English.
• In order to solve the problem, we analyze the frequencies of
patterns in the text written in English
• Knowledge of the words in the English language helps
37. Gold Bug Problem and Motif Finding: Differences
• Motif Finding is more difficult than the Gold Bug problem:
1. We don’t have the complete dictionary of motifs
2. The “genetic” language does not have a standard
“grammar”
3. Only a small fraction of nucleotide sequences encode for
motifs; the size of the data is enormous
38. The Motif Finding Problem: Informal Statement
• Given a random sample of DNA sequences:
cctgatagacgctatctggctatccacgtacgtaggtcctctgtgcgaatctatgcgtttccaaccat
agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
aaacgtacgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtacgtc
• Find the pattern that is implanted in each of the individual
sequences, namely, the motif
39. The Motif Finding Problem: Additional Info
• The hidden sequence is of length 8.
• The pattern is not necessarily the same in each array because
random mutations (substitutions) may occur in the sequences,
as we have seen.
40. The Motif Finding Problem
• The patterns revealed with no mutations:
cctgatagacgctatctggctatccacgtacgtaggtcctctgtgcgaatctatgcgtttccaaccat
agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
aaacgtacgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtacgtc
acgtacgt
Consensus String
41. The Motif Finding Problem
• The patterns with 2-point mutations:
cctgatagacgctatctggctatccaGgtacTtaggtcctctgtgcgaatctatgcgtttccaaccat
agtactggtgtacatttgatCcAtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
aaacgtTAgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtCcAtataca
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaCcgtacgGc
42. The Motif Finding Problem
• The patterns with 2-point mutations:
cctgatagacgctatctggctatccaGgtacTtaggtcctctgtgcgaatctatgcgtttccaaccat
agtactggtgtacatttgatCcAtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
aaacgtTAgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtCcAtataca
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaCcgtacgGc
• Can we still find the motif now?
43. Defining Motifs
• To define a motif, lets say we know where the motif starts in
the sequence.
• The motif start positions in their sequences can be represented
as s = (s1,s2,s3,…,st).
44. Motifs: Profiles and Consensus
• Line up the patterns by their
start indexes
s = (s1, s2, …, st)
• Construct profile matrix with
frequencies of each nucleotide
in columns
• Consensus nucleotide in each
position has the highest score
in column
a G g t a c T t
C c A t a c g t
Alignment a c g t T A g t
a c g t C c A t
C c g t a c g G
_________________
A 3 0 1 0 3 1 1 0
Profile C 2 4 0 0 1 4 0 0
G 0 1 4 0 0 0 3 1
T 0 0 0 5 1 0 1 4
_________________
Consensus A C G T A C G T
45. Consensus String
• Think of the consensus string as an “ancestor” motif, from
which mutated motifs emerged
• The distance between a real motif and the consensus sequence
is generally less than the distance between two real motifs
47. Evaluating Motifs
• We have a guess about the consensus sequence, but how
“good” is this consensus?
• We need to introduce a scoring function to compare different
consensus strings.
• Keep in mind that we really want to choose the starting
positions, but since the consensus is obtained from an array of
starting positions, we will determine how to compare
consensus strings and then work backward to choosing starting
positions.
48. Parameters: Definitions
• t - number of sample DNA sequences
• n - length of each DNA sequence
• DNA - sample of DNA sequences (stored as a t x n array)
• l - length of the motif (l-mer)
• si - starting position of an l-mer in sequence i
• s = (s1, s2,… st) - array of motif’s starting positions
50. Scoring Motifs
• Given starting positions s = (s1, … st )
and DNA:
score(s, DNA) =
• Here count(k, i) represents the
frequency of nucleotide k in the motif
starting at si
• At right is an example for a given array
of starting positions
l
t
l
i GCTAk
ikcount
1 },,,{
),(max
Profile
a G g t a c T t
C c A t a c g t
a c g t T A g t
a c g t C c A t
C c g t a c g G
_________________
A 3 0 1 0 3 1 1 0
C 2 4 0 0 1 4 0 0
G 0 1 4 0 0 0 3 1
T 0 0 0 5 1 0 1 4
_________________
Consensus a c g t a c g t
Score 3+4+4+5+3+4+3+4=30
51. Finding the Best Profile Matrix
• If starting positions s = (s1, s2,… st ) are given, finding the
consensus is easy even with mutations in the sequences
because we can simply construct the profile matrix in order to
find the consensus string.
• But…the starting positions s are usually not given. How can
we find the “best” profile matrix?
52. The Motif Finding Problem: Formal Statement
• Goal: Given a set of DNA sequences, find a set of tl-mers, one
from each sequence, that maximizes the consensus score
• Input: A t x n matrix of DNA, and l, the length of the pattern to
find
• Output: An array of t starting positions s = (s1, s2, … st )
maximizing score(s, DNA)
53. The Motif Finding Problem: Brute Force Method
• Compute the scores for each possible combination of starting
positions s.
• The best score will determine the best profile and the
consensus pattern in DNA.
• The goal is to maximize Score(s, DNA) by varying the starting
positions si, where:
si = [1, …, n-l+1]
i = [1, …, t]
54. BruteForceMotifSearch: Pseudocode
1. BruteForceMotifSearch(DNA, t, n, l )
2. bestScore 0
3. for each s=(s1,s2 , . . ., st ) from (1,1 . . . 1)
to (n-l+1, . . ., n-l+1)
4. if score (s, DNA) >bestScore
5. bestScore score (s, DNA)
6. bestMotif (s1,s2 , . . . , st)
7. return bestMotif
55. BruteForceMotifSearch: Running Time
• Varying (n – l + 1) positions in each of t sequences, we’re
looking at (n – l + 1)t sets of starting positions
• For each set of starting positions, the scoring function
makes l operations, so the algorithm’s complexity is
l (n – l + 1)t = O(l nt)
• That means that for t = 8, n = 1000,l = 10 we must perform
approximately 1020 computations – the algorithm will take
billions of years to complete on such a problem instance
56. BruteForceMotifSearch: Running Time
• Varying (n – l + 1) positions in each of t sequences, we’re
looking at (n – l + 1)t sets of starting positions
• For each set of starting positions, the scoring function
makes l operations, so the algorithm’s complexity is
l (n – l + 1)t = O (l nt )
• That means that for t = 8, n = 1000,l = 10 we must perform
approximately 1020 computations – the algorithm will take
billions of years to complete on such a problem instance
• Conclusion: We need to view the problem in a new light
57. Changing Gears: The Median String Problem
• Given a set of t DNA sequences, find a pattern that appears in
all t sequences with the minimum number of mutations.
• This pattern will be the motif.
• Key Difference: Rather than varying the starting positions and
trying to find a consensus string representing a motif, we will
instead vary all possible motifs directly.
58. Hamming Distance
• Given two nucleotide strings v and w, dH(v,w) is the number of
nucleotide pairs that do not match when v and w are aligned.
• For example:
dH(AAAAAA, ACAAAC) = 2
59. Total Distance: Definition
• For each DNA sequence i, compute all dH(v, x), where x is an
l-mer with starting position si (1 < si < n – l + 1)
• Find minimum of dH(v, x) among all l-mers in sequence i
• TotalDistance(v, DNA) is the sum of the minimum Hamming
distances for each DNA sequencei
• TotalDistance(v, DNA) = minsdH(v, s), where s is the set of
starting positions s1, s2,… st
60. Total Distance: Example
• Given v = “acgtacgt” and s the starting points below:
acgtacgt
cctgatagacgctatctggctatccacgtacAtaggtcctctgtgcgaatctatgcgtttccaaccat
acgtacgt
agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
acgtacgt
aaaAgtCcgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
acgtacgt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca
acgtacgt
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtaGgtc
v is the sequence in red, x is the sequence in blue
61. Total Distance: Example
• Given v = “acgtacgt” and s the starting points below:
acgtacgt
cctgatagacgctatctggctatccacgtacAtaggtcctctgtgcgaatctatgcgtttccaaccat
acgtacgt
agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
acgtacgt
aaaAgtCcgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
acgtacgt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca
acgtacgt
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtaGgtc
v is the sequence in red, x is the sequence in blue
dH(v, x) = 1
62. Total Distance: Example
• Given v = “acgtacgt” and s the starting points below:
acgtacgt
cctgatagacgctatctggctatccacgtacAtaggtcctctgtgcgaatctatgcgtttccaaccat
acgtacgt
agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
acgtacgt
aaaAgtCcgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
acgtacgt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca
acgtacgt
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtaGgtc
v is the sequence in red, x is the sequence in blue
dH(v, x) = 1
dH(v, x) = 0
63. Total Distance: Example
• Given v = “acgtacgt” and s the starting points below:
acgtacgt
cctgatagacgctatctggctatccacgtacAtaggtcctctgtgcgaatctatgcgtttccaaccat
acgtacgt
agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
acgtacgt
aaaAgtCcgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
acgtacgt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca
acgtacgt
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtaGgtc
v is the sequence in red, x is the sequence in blue
dH(v, x) = 2
dH(v, x) = 1
dH(v, x) = 0
64. Total Distance: Example
• Given v = “acgtacgt” and s the starting points below:
acgtacgt
cctgatagacgctatctggctatccacgtacAtaggtcctctgtgcgaatctatgcgtttccaaccat
acgtacgt
agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
acgtacgt
aaaAgtCcgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
acgtacgt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca
acgtacgt
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtaGgtc
v is the sequence in red, x is the sequence in blue
dH(v, x) = 2
dH(v, x) = 1
dH(v, x) = 0
dH(v, x) = 0
65. Total Distance: Example
• Given v = “acgtacgt” and s the starting points below:
acgtacgt
cctgatagacgctatctggctatccacgtacAtaggtcctctgtgcgaatctatgcgtttccaaccat
acgtacgt
agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
acgtacgt
aaaAgtCcgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
acgtacgt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca
acgtacgt
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtaGgtc
v is the sequence in red, x is the sequence in blue
dH(v, x) = 2
dH(v, x) = 1
dH(v, x) = 0
dH(v, x) = 0
dH(v, x) = 1
66. Total Distance: Example
• Given v = “acgtacgt” and s the starting points below:
acgtacgt
cctgatagacgctatctggctatccacgtacAtaggtcctctgtgcgaatctatgcgtttccaaccat
acgtacgt
agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc
acgtacgt
aaaAgtCcgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt
acgtacgt
agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca
acgtacgt
ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtaGgtc
v is the sequence in red, x is the sequence in blue
• TotalDistance(v, DNA) = 1+0+2+0+1 = 4
dH(v, x) = 2
dH(v, x) = 1
dH(v, x) = 0
dH(v, x) = 0
dH(v, x) = 1
67. The Median String Problem: Formulation
• Goal: Given a set of DNA sequences, find a median string.
• Input: A t x n matrix DNA, and l, the length of the pattern to
find.
• Output: A (median) string v of l nucleotides that minimizes
TotalDistance(v, DNA) over all strings of that length.
68. The Median String Problem: Formulation
• Goal: Given a set of DNA sequences, find a median string.
• Input: A t x n matrix DNA, and l, the length of the pattern to
find.
• Output: A (median) string v of l nucleotides that minimizes
TotalDistance(v, DNA) over all strings of that length.
• Note: This implies the natural brute force algorithm of
calculating TotalDistance(v, DNA) for all strings v (next slide)
69. MedianStringSearch: Pseudocode
1. MedianStringSearch (DNA, t, n, l )
2. bestWord AAA…A
3. bestDistance ∞
4. for each l-mer v from AAA…A to TTT…T
5. if TotalDistance (v, DNA) < bestDistance
6. bestDistance TotalDistance (v, DNA)
7. bestWord v
8. return bestWord
70. Motif Finding Problem = Median String Problem
• The Motif Finding is a maximization problem while Median
String is a minimization problem.
• However, the Motif Finding problem and Median String
problem are computationally equivalent.
• We need to show that minimizing TotalDistance is equivalent
to maximizing Score.
71. Motif Finding Problem == Median String Problem
• At any column i
Scorei + TotalDistancei = t
• Because there are l columns
Score + TotalDistance = l * t
• Rearranging:
Score = l * t - TotalDistance
• l * t is constant, so the minimization
of the right side is equivalent to the
maximization of the left side
l
t
a G g t a c T t
C c A t a c g t
Alignment a c g t T A g t
a c g t C c A t
C c g t a c g G
_________________
A 3 0 1 0 3 1 1 0
Profile C 2 4 0 0 1 4 0 0
G 0 1 4 0 0 0 3 1
T 0 0 0 5 1 0 1 4
_________________
Consensus a c g t a c g t
Score 3+4+4+5+3+4+3+4
TotalDistance 2+1+1+0+2+1+2+1
Sum 5 5 5 5 5 5 5 5
72. Motif Finding Problem vs. Median String Problem
• Why bother reformulating the Motif Finding problem into the
Median String problem?
• The Motif Finding Problem needs to examine all possible
choices for s. Recall that this is (n — l + 1)t possibilities!!!
• The Median String Problem needs to examine all 4l
combinations for v. This number is typically smaller,
although if l is large using brute force will still be
infeasible.
73. Median String: Improving the Running Time
1. MedianStringSearch (DNA, t, n, l )
2. bestWord AAA…A
3. bestDistance ∞
4. for each l-mer v from AAA…A to TTT…T
5. if TotalDistance (v, DNA) < bestDistance
6. bestDistance TotalDistance (v, DNA)
7. bestWord v
8. return bestWord
74. Structuring the Search
• For the Median String Problem we need to consider all 4l
possible l-mers:
aa… aa
aa… ac
aa… ag
aa… at
.
.
tt… tt
How to organize this search?
l
75. Alternative Representation of the Search Space
• Let A = 1, C = 2, G = 3, T = 4
• Then the sequences from AA…A to TT…T become:
11…11
11…12
11…13
11…14
.
.
44…44
• Notice that the sequences above simply list all numbers as if we
were counting on base 4 without using 0 as a digit.
l
76. First Try: Linked List
• Suppose l = 2
aa ac ag at ca cc cg ct ga gc gg gt ta tc tg tt
• We need to visit all the predecessors of a sequence before
visiting the sequence itself.
• Unfortunately this isn’t very efficient.
Start
77. Better Structure: Search Tree
• Instead, let’s try grouping the sequences by their prefixes.
aa ac ag at ca cc cg ct ga gc gg gt ta tc tg tt
78. Better Structure: Search Tree
• Instead, let’s try grouping the sequences by their prefixes
aa ac ag at ca cc cg ct ga gc gg gt ta tc tg tt
a- c- g- t-
79. Better Structure: Search Tree
• Instead, let’s try grouping the sequences by their prefixes
aa ac ag at ca cc cg ct ga gc gg gt ta tc tg tt
a- c- g- t-
--
root
80. Analyzing Search Trees
• Characteristics of search trees:
• The sequences are contained in its leaves
• The parent of a node is the prefix of its children
• How can we move through the tree?
81. Moving through the Search Trees
• Four common moves in a search tree that we are about to
explore:
1. Move to the next leaf
2. Visit all the leaves
3. Visit the next node
4. Bypass the children of a node
82. Move 1: Visit the Next Leaf
1. NextLeaf( a, L, k ) // a : the array of digits
2. for i L to 1 // L: length of the array
3. if ai <k // k : max digit value
4. ai ai + 1
5. return a
6. ai 1
7. return a
• Given a current leaf a , we need to compute the “next” leaf:
Note: In the case of the nucleotide alphabet, we are using k = 4
83. Move 1: Visit the Next Leaf
• The algorithm is common addition base-k:
1. Increment the least significant digit
2. “Carry the one” to the next digit position when the digit is
at maximal value
84. NextLeaf: Example
• Moving to the next leaf:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Current Location
85. NextLeaf: Example
• Moving to the next leaf:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Next Location
86. NextLeaf: Example
• Moving to the next leaf:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Next Location
87. NextLeaf: Example
• Moving to the next leaf:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Next Location
88. NextLeaf: Example
• Moving to the next leaf:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Next Location
89. NextLeaf: Example
• Moving to the next leaf:
• Etc.
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Next Location
90. Move 2: Visit All Leaves
• Printing all l-mers in ascending order:
1. AllLeaves(L, k) // L: length of the sequence
2. a (1,...,1) // k : max digit value
3. while forever // a: array of digits
4. output a
5. a NextLeaf(a, L, k)
6. if a = (1,...,1)
7. return
91. Visit All Leaves: Example
• Moving through all the leaves in order:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
--
Order of steps
92. Depth First Search
• So we can search through the leaves.
• How about searching through all vertices of the tree?
• We will do this with a depth firstsearch.
• Specifically we need an algorithm to visit the next vertex.
93. Move 3: Visit the Next Vertex
1. NextVertex(a, i, L, k ) // a: the array of digits
2. if i < L // i : prefix length
3. ai+1 1 // L: max length
4. return (a, i +1 ) // k: max digit value
5. else
6. for j l to 1
7. if aj < k
8. aj aj +1
9. return (a, j )
10. return (a,0)
94. Next Vertex: Example
• Moving to the next vertex:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Current Location
95. Next Vertex: Example
• Moving to the next vertex:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
96. Next Vertex: Example
• Moving to the next vertex:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
97. Next Vertex: Example
• Moving to the next vertex:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
98. Next Vertex: Example
• Moving to the next vertex:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
99. Next Vertex: Example
• Moving to the next vertex:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Location after 5
next vertex moves
100. Move 4: Bypass
• Given a prefix (internal vertex), find the next vertex after
skipping all the prefix’s children.
1. ByPass(a, i, L, k) // a: array of digits
2. for j i to 1 // i : prefix length
3. if aj < k // L: maximum length
4. aj aj +1 // k : max digit value
5. return (a, j )
6. return (a, 0)
101. Bypass: Example
• Bypassing the descendants of “2-”:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Current Location
102. Bypass: Example
• Bypassing the descendants of “2-”:
1- 2- 3- 4-
11 12 13 14 21 22 23 24 31 32 33 34 41 42 43 44
--
Next Location
103. Revisiting Brute Force Search
• Now that we have method for navigating the tree, lets look again
at BruteForceMotifSearch.
104. Brute Force Search Revisited
1. BruteForceMotifSearchAgain(DNA, t, n, l)
2. s (1,1,…, 1)
3. bestScore score (s, DNA)
4. while forever
5. s NextLeaf (s, t, n — l +1 )
6. if score (s,DNA) >bestScore
7. bestScore score (s, DNA)
8. bestMotif (s1,s2 , . . . , st)
9. return bestMotif
105. Can We Streamline the Algorithm?
• Sets of s = (s1, s2, …, st) may have a weak profile for the first i
positions (s1, s2, …, si)
• Every row of the alignment matrix may add at most l to score
• Optimistic View: all subsequent (t-i) positions (si+1, …st) add
(t – i ) * l to score(s, i, DNA)
• So if score(s, i, DNA) + (t – i ) * l < bestScore, it makes no
sense to search through vertices of the current subtree
• In this case, we can use ByPass() to skip frivolous branches.
• This leads to what is called in general a “branch and bound”
method for motif finding.
106. Branch and Bound Algorithm for Motif Search
• Since each level of the tree goes
deeper into search, discarding a
prefix discards all following
branches.
• This saves us from looking at
(n – l + 1)t-i leaves.
• We use NextVertex() and
ByPass() to navigate the tree.
107. Branch and Bound Motif Search: Pseudocode
1. BranchAndBoundMotifSearch(DNA, t, n,l )
2. s (1,…,1)
3. bestScore 0
4. i 1
5. while i > 0
6. if i <t
7. optimisticScore score(s, i, DNA) + (t – i ) * l
8. if optimisticScore < bestScore
9. (s, i) ByPass(s, i, n – l +1)
10. else
11. (s, i) NextVertex(s, i, n – l +1)
12. else
13. if score(s, DNA) > bestScore
14. bestScore score(s)
15. bestMotif (s1, s2, s3, …, st )
16. (s, i) NextVertex(s, i, t, n – l + 1)
17. return bestMotif
108. Median String Search Improvements
• Recall the computational differences between motif search and
median string search.
• The Motif Finding Problem needs to examine all (n – l +1)t
combinations for s.
• The Median String Problem needs to examine 4l
combinations of v. This number is usually relatively small.
• We want to use the median string algorithm with the Branch
and Bound trick!
109. Median String Search with Branch and Bound
• Note that if the total distance for a prefix is greater than that
for the best word so far:
TotalDistance (prefix, DNA) >BestDistance
then there is no use exploring the remaining part of the word.
• We can eliminate that branch and BYPASS exploring that
branch further.
110. Median String Search with Branch and Bound
1. BranchAndBoundMedianStringSearch(DNA, t, n, l )
2. s (1,…,1)
3. bestDistance ∞
4. i 1
5. while i > 0
6. if i < l
7. prefix string corresponding to the first i nucleotides of s
8. optimisticDistance TotalDistance(prefix, DNA)
9. if optimisticDistance > bestDistance
10. (s, i ) ByPass(s, i, l, 4)
11. else
12. (s, i )NextVertex(s, i, l, 4)
13. else
14. word nucleotide string corresponding to s
15. if TotalDistance(s, DNA ) < bestDistance
16. bestDistance TotalDistance(word, DNA)
17. bestWord word
18. (s, i ) NextVertex(s, i, l, 4)
19. return bestWord
111. Improving the Bounds
• Given an l-mer w, divided into two parts at point i:
• u : prefix w1, …, wi,
• v : suffix wi+1, ..., wl
• Find minimum distance for u in a sequence.
• No instances of u in the sequence have distance less than the
minimum distance.
• Note: this doesn’t tell us anything about whether u is part of
any motif. We only get a minimum distance for prefix u.
112. Improving the Bounds
• Repeating the process for the suffix v gives us a
minimum distance for v.
• Since u and v are two substrings of w, and included in
motif w, we can assume that the minimum distance of
u plus minimum distance of v can only be less than
the minimum distance for w.
114. Improving the Bounds
• If d(prefix) + d(suffix) > bestDistance:
• Motif w (prefix.suffix) cannot give a better (lower) score
than d(prefix) + d(suffix)
• In this case, we can ByPass()
115. Better Bounded Median String Search
1. ImprovedBranchAndBoundMedianString(DNA, t, n, l )
2. s= (1, 1, …, 1)
3. bestDistance = ∞
4. i = 1
5. while i > 0
6. if i < l
7. prefix = nucleotide string corresponding to (s1, s2, s3, …, si )
8. optimisticPrefixDistance = TotalDistance (prefix, DNA )
9. if optimisticPrefixDistance <bestSubstring [i ]
10. bestSubstring[i ] = optimisticPrefixDistance
11. if (l – i <i )
12. optimisticSuffixDistance = bestsubstring [l -i ]
13. else
14. optimisticSuffixDistance = 0;
15. if optimisticPrefixDistance + optimisticSuffixDistance > bestDistance
16. (s, i ) = ByPass(s, i, l, 4)
17. else
18. (s, i ) = NextVertex(s, i, l, 4)
19. else
20. word = nucleotide string corresponding to (s1,s2, s3, …, st)
21. if TotalDistance(word, DNA ) < bestDistance
22. bestDistance = TotalDistance(word, DNA)
23. bestWord = word
24. (s,i ) = NextVertex(s, i, l, 4)
25. return bestWord
116. Notes on Motif Finding
• Exhaustive Search and Median String are both exact
algorithms.
• They always find the optimal solution, though they may be too
slow to perform practical tasks.
• Many algorithms sacrifice optimal solution for speed.
117. CONSENSUS: Greedy Motif Search
• Finds two closest l -mers in sequences 1 and 2 and forms
2 x l alignment matrix with score(s, 2, DNA).
• At each of the following t-2 iterations CONSENSUS finds a
“best” l -mer in sequence i from the perspective of the already
constructed (i-1) x l alignment matrix for the first (i-1)
sequences.
• In other words, it finds an l - mer in sequence i maximizing
score(s, i, DNA)
under the assumption that the first (i-1) l -mers have been
already chosen.
• CONSENSUS sacrifices optimal solution for speed: in fact
the bulk of the time is actually spent locating the first 2 l -mers.
118. Some Motif Finding Programs
• CONSENSUS
Hertz, Stromo (1989)
• GibbsDNA
Lawrence et al (1993)
• MEME
Bailey, Elkan (1995)
• RandomProjections
Buhler, Tompa (2002)
• MULTIPROFILER Keich,
Pevzner (2002)
• MITRA
Eskin, Pevzner (2002)
• Pattern Branching
Price et al.,
lo (2003)