BasicPizza.javapublic class BasicPizza { String type; String c.pdf
•
0 likes•2 views
BasicPizza.java public class BasicPizza { String type; String crust; String ingredients; double cost; public BasicPizza(String type) { super(); this.type = type; } public String getType() { return type; } public void setType(String type) { this.type = type; } public String getCrust() { return crust; } public void setCrust(String crust) { this.crust = crust; } public BasicPizza() { super(); } public String getIngredients() { return ingredients; } public void setIngredients(String ingredients) { this.ingredients = ingredients; } public double getCost() { return cost; } public void setCost() { this.cost = 5; } @Override public String toString() { return \"BasicPizza [type=\" + type + \", crust=\" + crust + \", ingredients=\" + ingredients + \", cost=\" + cost + \"]\"; } } ________________________________________________________________________ LiFiCheese.java public class LiFiCheese extends BasicPizza{ private String crust; private double cost; private String ingredients; public LiFiCheese() { super(\"Cheese\"); this.cost=5; } public void setCrust() { this.crust=\"thin\"; } public String getCrust() { return crust; } public double getCost() { return cost; } public void setCost(double cost) { } public String getIngredients() { return ingredients; } public void setIngredients(String ingredients) { this.ingredients = ingredients; } @Override public String toString() { System.out.println(\"You Ordered :\"); System.out.println(getType()); setCrust(); System.out.println(getCrust()); System.out.println(\"Total Cost of :\"+getCost()); return \"\"; } } _______________________________________________________________________ LiFiPizza.java import java.util.Scanner; public class LiFiPizza extends BasicPizza { private String type; private double cost; private String crust; private String ingredients; public LiFiPizza() { super(); this.type = \"Meat\"; this.cost=5; } public String getType() { return type; } public void setType(String type) { this.type = type; } public double getCost() { return cost; } public void setCost() { this.cost = this.cost+2; } public String getCrust() { return crust; } public void setCrust(String crust) { if(crust.equals(\"Thin\")) { this.crust=\"Thin\"; } else if(crust.equals(\"Thick\")) { this.crust=\"Thick\"; } } public String getIngredients() { return ingredients; } public void setIngredients(String ingredients) { this.ingredients = ingredients; } @Override public String toString() { System.out.println(\"You Ordered :\"); System.out.println(getType()); System.out.println(getIngredients()+\"<+$2.00>\"); System.out.println(getCrust()); System.out.println(\"Total Cost of :\"+getCost()); return \"\"; } } _____________________________________________________________________ LiFiUnit5Ch14.java import java.util.Scanner; public class LiFiUnit5Ch14 { public static void main(String[] args) { BasicPizza bp=null; String typeOfPizza; Scanner sc=new Scanner(System.in); System.out.print(\"What type of pizza would you like :\"); typeOfPizza=sc.nex.
Report
Share
Report
Share
Download to read offline
![this.cost = 5;
}
@Override
public String toString() {
return "BasicPizza [type=" + type + ", crust=" + crust + ", ingredients="
+ ingredients + ", cost=" + cost + "]";
}
}
________________________________________________________________________
LiFiCheese.java
public class LiFiCheese extends BasicPizza{
private String crust;
private double cost;
private String ingredients;
public LiFiCheese() {
super("Cheese");
this.cost=5;
}
public void setCrust()
{
this.crust="thin";
}
public String getCrust()
{
return crust;
}
public double getCost() {
return cost;
}
public void setCost(double cost) {
}](data:image/gif;base64,R0lGODlhAQABAIAAAAAAAP///yH5BAEAAAAALAAAAAABAAEAAAIBRAA7)
Recommended
BasicPizza.javapublic class BasicPizza { Declaring instance .pdf
BasicPizza.java
public class BasicPizza {
//Declaring instance variables
String type;
String crust;
String ingredients;
double cost;
//Default Constructor
public BasicPizza() {
super();
}
//Parameterized constructor
public BasicPizza(String type) {
super();
this.type = type;
}
//Setters and Getters
public String getType() {
return type;
}
public void setType(String type) {
this.type = type;
}
public String getCrust() {
return crust;
}
public void setCrust(String crust) {
this.crust = crust;
}
public String getIngredients() {
return ingredients;
}
public void setIngredients(String ingredients) {
this.ingredients = ingredients;
}
public double getCost() {
return cost;
}
public void setCost() {
this.cost = 5;
}
//toString() method is used to display the contents of the Object.inside it.
@Override
public String toString() {
return \"BasicPizza [type=\" + type + \", crust=\" + crust + \", ingredients=\"
+ ingredients + \", cost=\" + cost + \"]\";
}
}
________________________________________________________________
LiFiCheese.java
public class LiFiCheese extends BasicPizza{
//Declaring instance variables
private String crust;
private double cost;
private String ingredients;
//Default constructor
public LiFiCheese() {
super(\"Cheese\");
this.cost=5;
}
//Setters and getters
public void setCrust()
{
this.crust=\"thin\";
}
public String getCrust()
{
return crust;
}
public double getCost() {
return cost;
}
public void setCost(double cost) {
}
public String getIngredients() {
return ingredients;
}
public void setIngredients(String ingredients) {
this.ingredients = ingredients;
}
//toString() method is used to display the contents of the Object.inside it.
@Override
public String toString() {
System.out.println(\"You Ordered :\");
System.out.println(getType());
setCrust();
System.out.println(getCrust());
System.out.println(\"Total Cost of :\"+getCost());
return \"\";
}
}
__________________________________________________________________________
LiFiPizza.java
import java.util.Scanner;
public class LiFiPizza extends BasicPizza {
//Declaring instance variables
private String type;
private double cost;
private String crust;
private String ingredients;
//Default constructor
public LiFiPizza()
{
super();
this.type = \"Meat\";
this.cost=5;
}
//Setters and getters
public String getType() {
return type;
}
public void setType(String type) {
this.type = type;
}
public double getCost() {
return cost;
}
public void setCost() {
this.cost = this.cost+2;
}
public String getCrust() {
return crust;
}
public void setCrust(String crust) {
if(crust.equals(\"Thin\"))
{
this.crust=\"Thin\";
}
else if(crust.equals(\"Thick\"))
{
this.crust=\"Thick\";
}
}
public String getIngredients() {
return ingredients;
}
public void setIngredients(String ingredients) {
this.ingredients = ingredients;
}
//toString() method is used to display the contents of the Object.inside it.
@Override
public String toString() {
System.out.println(\"You Ordered :\");
System.out.println(getType());
System.ou.
Code Smells y Refactoring o haciendo que nuestro codigo huela (y se vea) mejo...
Code Smells y Refactoring o haciendo que nuestro codigo huela (y se vea) mejor
Mariano Sanchez
.NET Conf UY 2014
http://netconf.uy
VISUALIZAR REGISTROS EN UN JTABLE
This document discusses how to display records from a Northwind database in a JTable using NetBeans and SQL Server. It includes code to connect to the database, define a Product class with getters and setters, a ProductDAO class to retrieve data, and a GUI class to display the results in a JTable. The code retrieves product data including ID, name, category, supplier, price, quantity and units from the database and displays it in the table.
can do this in java please thanks in advance The code that y.pdf
can do this in java please thanks in advance
The code that you will write i would like it to be similar to snippets shown below for me to better
understand
the codes i have been given to fix:
1)
public abstract class BasePerson {
protected String name;
private boolean publish;
private int age;
private int id;
public BasePerson(String name,int age, boolean pub)
{
this.name =name;
this.age=age;
publish = pub;
}
public int getAge()
{
return age;
}
public abstract String getName();
protected void setId(int id)
{
this.id = id;
}
public int getId()
{
return id;
}
public boolean getPublish()
{
return publish;
}
}
2)
public class Person extends BasePerson implements Comparable<Person>
{
private static int nextId=0;
public Person(String name, int age, boolean willPublish)
{
super(name, age, willPublish);
super.setId(nextId);
nextId++;
}
public String getName()
{
return name;
}
public static String getPHeader()
{
String returnval = "IDtNametAgetWillPublish";
returnval+="n---------------------------------";
return returnval;
}
public String toString()
{
return(getId()+"t"+getName()+"t"+getAge()+"t"+getPublish());
}
public static void resetId()
{
nextId=0;
}
public int compareTo(Person other)
{
return other.getId() - this.getId();
}
3)
import java.util.ArrayList;
import java.util.Scanner;
import java.io.File;
import java.io.IOException;
public class VaccineBatch {
private int size;
private int balance=0;
private String name;
private int preference;
private ArrayList<String> contras;
public VaccineBatch( String name,int size, int preference, String contraIndicators)
{
this.size = size;
this.balance = size;
this.preference = preference;
this.name = name;
Scanner stringScan = new Scanner(contraIndicators);
contras = new ArrayList<String>();
stringScan.useDelimiter(",");
while (stringScan.hasNext())
contras.add(stringScan.next());
}
public int getSize()
{
return size;
}
public int getBalance()
{
return balance;
}
public int getPreference()
{
return preference;
}
public String getName()
{
return name;
}
public String getContras()
{
String returnval="";
for (int i=0; i<contras.size();i++)
{
returnval+=contras.get(i);
if (i<contras.size()-1)
returnval+=",";
}
return returnval;
}
public static String getVBHeader()
{
String returnval = "NametSizetBalancetPreferencetContraIndicators";
returnval+="n---------------------------------";
return returnval;
}
public boolean contraImpact(ArrayList<String> comorbs)
{
boolean found = false;
int i =0;
while((!found)&&(i<contras.size()))
{
int j=0;
while ((!found)&&(j<comorbs.size()))
{
if (contras.get(i).equals(comorbs.get(j)))
found=true;
else
j++;
}
i++;
}
return found;
}
//public int compareTo(VaccineBatch other)
//{
// return other.preference-this.preference ;
//}
public void reduceBalance()
{
balance--;
}
}
4)
import java.util.ArrayList;
public class ApprovedPerson extends BasePerson {
ArrayList<String> comorbidities;
public ApprovedPerson(int age, String name, boolean publish, int id)
{
super( name, age,publish);
super.
public class Person { private String name; private int age;.pdf
public class Person
{
private String name;
private int age;
public Person()
{
name=\"\";
age=0;
}
/**
Create a person with a given name and age.
@param name the name
@param age the age
*/
public Person(String name, int age)
{
this.name = name;
this.age = age;
}
/**
Get the name.
@return the name
*/
public String getName()
{
return name;
}
/**
Change the name.
@param name the name
*/
public void setName(String name)
{
this.name = name;
}
/**
Get the age.
@return the age
*/
public int getAge()
{
return age;
}
/**
Change the age.
@param age the age
*/
public void setAge()
{
this.age = age;
}
/**
Convert person to string form.
*/
public String toString()
{
return \"Name: \" + name + \"\\t\" + \"Age: \" + age;
}
}
OUTPUT should look like this!
Solution
solution
package com.prt.test;
public class Person
{
protected String name;
protected int age;
public Person()
{
name=\"\";
age=0;
}
/**
Create a person with a given name and age.
@param name the name
@param age the age
*/
public Person(String name, int age)
{
this.name = name;
this.age = age;
}
/**
Get the name.
@return the name
*/
public String getName()
{
return name;
}
/**
Change the name.
@param name the name
*/
public void setName(String name)
{
this.name = name;
}
/**
Get the age.
@return the age
*/
public int getAge()
{
return age;
}
/**
Change the age.
@param age the age
*/
public void setAge()
{
this.age = age;
}
/**
Convert person to string form.
*/
public String toString()
{
return \"Name: \" + name + \"\\t\" + \"Age: \" + age;
}
}
package com.prt.test;
public class Student extends Person implements Comparable{
private int studentId;
private String major;
/**
* @return the studentId
*/
public int getStudentId() {
return studentId;
}
/**
* @param studentId the studentId to set
*/
public void setStudentId(int studentId) {
this.studentId = studentId;
}
/**
* @return the major
*/
public String getMajor() {
return major;
}
/**
* @param major the major to set
*/
public void setMajor(String major) {
this.major = major;
}
public Student(String name, int age, int studentId, String major) {
super(name, age);
this.studentId = studentId;
this.major = major;
}
/* (non-Javadoc)
* @see java.lang.Object#toString()
*/
@Override
public String toString() {
return \"name:\" + name+ \"\\t\"+\"\\t\"+\"age:\"+ age+\"\\t\"+ \"studentId :\"+ studentId +
\"\\t\" +\" major:\"+ major;
}
public int compareTo(Student st){
if(studentId==st.studentId)
return 0;
else if(studentId>st.studentId)
return 1;
else
return -1;
}
}
package com.prt.test;
public class Instructor extends Person implements Comparable {
private double salary;
public Instructor(String name, int age, double salary) {
super(name, age);
this.salary = salary;
}
/**
* @return the salary
*/
public double getSalary() {
return salary;
}
/**
* @param salary
* the salary to set
*/
public void setSalary(double salary) {
this.salary = salary;
}
public int compareTo(Instructor is) {
if (salary == is.salary)
return 0;
else if (salary > is.salary)
return 1;
else
ret.
Hello. Im creating a class called Bill. I need to design the class.pdf
Hello. I\'m creating a class called Bill. I need to design the class Bill with data members to store
patient’s ID and the patient’s hospital charges such as pharmacy charges for medicine, and
doctor’s fee, and the room charges. And I need to add appropriate constructors and methods to
initialize, access, and manipulate the data members. I\'m struggling with this class. Thank you
for the help. I\'ll provide my current classes below.
Person.java
-----------
public class Person {
private String lastName;
private String firstName;
public Person(String last, String first)
{
this.lastName = last;
this.firstName = first;
}
public String getLastName() {
return lastName;
}
public void setLastName(String lastName) {
this.lastName = lastName;
}
public String getFirstName() {
return firstName;
}
public void setFirstName(String firstName) {
this.firstName = firstName;
}
public String toString()
{
return lastName + \", \" + firstName;
}
}
---------------
Doctor.java
----------------
public class Doctor extends Person { // doctor class that inherits the person class
String Speciality;
public Doctor(String last, String first) { // constructor
super(last, first);
}
@Override
public String toString() { // method that return the data of the doctor
return \"Doctor{\" + \"Speciality=\" + Speciality + \'}\';
}
public String getSpeciality() {
return Speciality;
}
public void setSpeciality(String Speciality) {
this.Speciality = Speciality;
}
}
------------
Patient.java
------------
public class Patient extends Person{
private int PatientId;
private int age;
private Doctor attendingPhysician;
private Date dob;
private Date admitted,discharged;
public Patient(String firstName,String lastName,int PatientId,int age,Doctor
attendingPhysician,Date dob,Date admitted,Date discharged)
{
super(lastName,firstName);
this.PatientId = PatientId;
this.age = age;
this.admitted = admitted;
this.discharged = discharged;
this.dob = dob;
this.attendingPhysician = attendingPhysician;
}
public int getPatientId()
{
return PatientId;
}
public int getAge()
{
return age;
}
public Date getAdmissionDate()
{
return admitted;
}
public Date getDischargedDate()
{
return discharged;
}
public Date getDOB()
{
return dob;
}
public Doctor getPhysician()
{
return attendingPhysician;
}
public void setPatientId(int PatientId)
{
this.PatientId = PatientId;
}
public void setAge(int age)
{
this.age = age;
}
public void setAdmissionDate(Date admitted)
{
this.admitted = admitted;
}
public void setDischargedDate(Date discharged)
{
this.discharged = discharged;
}
public void setDOB(Date dob)
{
this.dob = dob;
}
public void setPhysician(Doctor attendingPhysician)
{
this.attendingPhysician = attendingPhysician;
}
}
------------
Date.java
--------------
public class Date {
private int year;
private int month;
private int day;
public Date()
{
year = 1900;
month = 1;
day = 1;
}
public Date(int y, int m, int d)
{
year = y;
month = m;
day = d;
}
public String toString()
{
return month + \"/\" + day + \"/\" + year;
}
pu.
Inheritance compiler support
1. The document discusses various C++ concepts related to polymorphism and virtual functions including inheritance, upcasting, overriding virtual functions, pure virtual functions, virtual destructors, and operator overloading.
2. It provides code examples to demonstrate polymorphism with classes like Instrument, Wind, Pet and subclasses Dog and Cat.
3. It also shows examples of upcasting, downcasting using dynamic_cast, returning references/pointers to derived types, and ensuring proper object destruction with virtual destructors.
please help with java questionsJAVA CODEplease check my code and.pdf
please help with java questions
JAVA CODE
please check my code and help my questions
CLASS ADDRESS
public class Address{
private int streetNumber;
private String streetName;
private String city;
private String state;
private String country;
// streetNumber
// streetName
// city
// state
// country
public Address(int streetNumber, String streetName, String city, String state, String country) {
this.streetNumber = streetNumber;
this.streetName = streetName;
this.city = city;
this.state = state;
this.country = country;
}
//return the streetNumber
public int getStreetNumber() {
return streetNumber;
}
// set street number
public void setStreetNumber(int streetNumber) {
this.streetNumber = streetNumber;
}
//return the streetName
public String getStreetName() {
return streetName;
}
// set street name
public void setStreetName(String streetName) {
this.streetName = streetName;
}
//return the city
public String getCity() {
return city;
}
//set the city
public void setCity(String city) {
this.city = city;
}
//return the state
public String getState() {
return state;
}
//the state to set
public void setState(String state) {
this.state = state;
}
// return the country
public String getCountry() {
return country;
}
// tset country
public void setCountry(String country) {
this.country = country;
}
// see java.lang.Object#toString()
@Override
public String toString() {
return \" [streetNumber=\" + streetNumber + \", streetName=\" + streetName
+ \", city=\" + city + \", state=\" + state + \", country=\"
+ country + \"]\";
}
}
////////////////////////////////////////////////////////////////////////////////////////
CLASS PERSON
public class Person extends Address {
private String name;
public Person (int streetNumber, String streetName, String city, String state, String country,
String name) {
super(streetNumber, streetName, city, state, country);
this.name = name;
}
//retuurn name
public String getName() {
return name;
}
// set name
public void setName(String name) {
this.name = name;
}
//see java.lang.Object#toString()
@Override
public String toString() {
return \"Person [name=\" + name + \", getStreetNumber()=\"
+ getStreetNumber() + \", getStreetName()=\" + getStreetName()
+ \", getCity()=\" + getCity() + \", getState()=\" + getState()
+ \", getCountry()=\" + getCountry() + \", toString()=\"
+ super.toString() + \", getClass()=\" + getClass()
+ \", hashCode()=\" + hashCode() + \"]\";
}
}
/////////////////////////////////////////////////////////////////
CLASS STUDENT
import java.util.ArrayList;
import java.util.List;
public class Student extends Person {
private String CIN;
List courses;
public Student(int streetNumber, String streetName, String city, String state, String country,
String name, String CIN) {
super(streetNumber, streetName, city, state, country, name);
// Auto-generated constructor stub
this.CIN = CIN;
courses = new ArrayList();
}
// reutrn cin
public String getCIN() {
return CIN;
}
// set cin
public void setCIN(String cIN) {
CIN = cIN;
}
pub.
Recommended
BasicPizza.javapublic class BasicPizza { Declaring instance .pdf
BasicPizza.java
public class BasicPizza {
//Declaring instance variables
String type;
String crust;
String ingredients;
double cost;
//Default Constructor
public BasicPizza() {
super();
}
//Parameterized constructor
public BasicPizza(String type) {
super();
this.type = type;
}
//Setters and Getters
public String getType() {
return type;
}
public void setType(String type) {
this.type = type;
}
public String getCrust() {
return crust;
}
public void setCrust(String crust) {
this.crust = crust;
}
public String getIngredients() {
return ingredients;
}
public void setIngredients(String ingredients) {
this.ingredients = ingredients;
}
public double getCost() {
return cost;
}
public void setCost() {
this.cost = 5;
}
//toString() method is used to display the contents of the Object.inside it.
@Override
public String toString() {
return \"BasicPizza [type=\" + type + \", crust=\" + crust + \", ingredients=\"
+ ingredients + \", cost=\" + cost + \"]\";
}
}
________________________________________________________________
LiFiCheese.java
public class LiFiCheese extends BasicPizza{
//Declaring instance variables
private String crust;
private double cost;
private String ingredients;
//Default constructor
public LiFiCheese() {
super(\"Cheese\");
this.cost=5;
}
//Setters and getters
public void setCrust()
{
this.crust=\"thin\";
}
public String getCrust()
{
return crust;
}
public double getCost() {
return cost;
}
public void setCost(double cost) {
}
public String getIngredients() {
return ingredients;
}
public void setIngredients(String ingredients) {
this.ingredients = ingredients;
}
//toString() method is used to display the contents of the Object.inside it.
@Override
public String toString() {
System.out.println(\"You Ordered :\");
System.out.println(getType());
setCrust();
System.out.println(getCrust());
System.out.println(\"Total Cost of :\"+getCost());
return \"\";
}
}
__________________________________________________________________________
LiFiPizza.java
import java.util.Scanner;
public class LiFiPizza extends BasicPizza {
//Declaring instance variables
private String type;
private double cost;
private String crust;
private String ingredients;
//Default constructor
public LiFiPizza()
{
super();
this.type = \"Meat\";
this.cost=5;
}
//Setters and getters
public String getType() {
return type;
}
public void setType(String type) {
this.type = type;
}
public double getCost() {
return cost;
}
public void setCost() {
this.cost = this.cost+2;
}
public String getCrust() {
return crust;
}
public void setCrust(String crust) {
if(crust.equals(\"Thin\"))
{
this.crust=\"Thin\";
}
else if(crust.equals(\"Thick\"))
{
this.crust=\"Thick\";
}
}
public String getIngredients() {
return ingredients;
}
public void setIngredients(String ingredients) {
this.ingredients = ingredients;
}
//toString() method is used to display the contents of the Object.inside it.
@Override
public String toString() {
System.out.println(\"You Ordered :\");
System.out.println(getType());
System.ou.
Code Smells y Refactoring o haciendo que nuestro codigo huela (y se vea) mejo...
Code Smells y Refactoring o haciendo que nuestro codigo huela (y se vea) mejor
Mariano Sanchez
.NET Conf UY 2014
http://netconf.uy
VISUALIZAR REGISTROS EN UN JTABLE
This document discusses how to display records from a Northwind database in a JTable using NetBeans and SQL Server. It includes code to connect to the database, define a Product class with getters and setters, a ProductDAO class to retrieve data, and a GUI class to display the results in a JTable. The code retrieves product data including ID, name, category, supplier, price, quantity and units from the database and displays it in the table.
can do this in java please thanks in advance The code that y.pdf
can do this in java please thanks in advance
The code that you will write i would like it to be similar to snippets shown below for me to better
understand
the codes i have been given to fix:
1)
public abstract class BasePerson {
protected String name;
private boolean publish;
private int age;
private int id;
public BasePerson(String name,int age, boolean pub)
{
this.name =name;
this.age=age;
publish = pub;
}
public int getAge()
{
return age;
}
public abstract String getName();
protected void setId(int id)
{
this.id = id;
}
public int getId()
{
return id;
}
public boolean getPublish()
{
return publish;
}
}
2)
public class Person extends BasePerson implements Comparable<Person>
{
private static int nextId=0;
public Person(String name, int age, boolean willPublish)
{
super(name, age, willPublish);
super.setId(nextId);
nextId++;
}
public String getName()
{
return name;
}
public static String getPHeader()
{
String returnval = "IDtNametAgetWillPublish";
returnval+="n---------------------------------";
return returnval;
}
public String toString()
{
return(getId()+"t"+getName()+"t"+getAge()+"t"+getPublish());
}
public static void resetId()
{
nextId=0;
}
public int compareTo(Person other)
{
return other.getId() - this.getId();
}
3)
import java.util.ArrayList;
import java.util.Scanner;
import java.io.File;
import java.io.IOException;
public class VaccineBatch {
private int size;
private int balance=0;
private String name;
private int preference;
private ArrayList<String> contras;
public VaccineBatch( String name,int size, int preference, String contraIndicators)
{
this.size = size;
this.balance = size;
this.preference = preference;
this.name = name;
Scanner stringScan = new Scanner(contraIndicators);
contras = new ArrayList<String>();
stringScan.useDelimiter(",");
while (stringScan.hasNext())
contras.add(stringScan.next());
}
public int getSize()
{
return size;
}
public int getBalance()
{
return balance;
}
public int getPreference()
{
return preference;
}
public String getName()
{
return name;
}
public String getContras()
{
String returnval="";
for (int i=0; i<contras.size();i++)
{
returnval+=contras.get(i);
if (i<contras.size()-1)
returnval+=",";
}
return returnval;
}
public static String getVBHeader()
{
String returnval = "NametSizetBalancetPreferencetContraIndicators";
returnval+="n---------------------------------";
return returnval;
}
public boolean contraImpact(ArrayList<String> comorbs)
{
boolean found = false;
int i =0;
while((!found)&&(i<contras.size()))
{
int j=0;
while ((!found)&&(j<comorbs.size()))
{
if (contras.get(i).equals(comorbs.get(j)))
found=true;
else
j++;
}
i++;
}
return found;
}
//public int compareTo(VaccineBatch other)
//{
// return other.preference-this.preference ;
//}
public void reduceBalance()
{
balance--;
}
}
4)
import java.util.ArrayList;
public class ApprovedPerson extends BasePerson {
ArrayList<String> comorbidities;
public ApprovedPerson(int age, String name, boolean publish, int id)
{
super( name, age,publish);
super.
public class Person { private String name; private int age;.pdf
public class Person
{
private String name;
private int age;
public Person()
{
name=\"\";
age=0;
}
/**
Create a person with a given name and age.
@param name the name
@param age the age
*/
public Person(String name, int age)
{
this.name = name;
this.age = age;
}
/**
Get the name.
@return the name
*/
public String getName()
{
return name;
}
/**
Change the name.
@param name the name
*/
public void setName(String name)
{
this.name = name;
}
/**
Get the age.
@return the age
*/
public int getAge()
{
return age;
}
/**
Change the age.
@param age the age
*/
public void setAge()
{
this.age = age;
}
/**
Convert person to string form.
*/
public String toString()
{
return \"Name: \" + name + \"\\t\" + \"Age: \" + age;
}
}
OUTPUT should look like this!
Solution
solution
package com.prt.test;
public class Person
{
protected String name;
protected int age;
public Person()
{
name=\"\";
age=0;
}
/**
Create a person with a given name and age.
@param name the name
@param age the age
*/
public Person(String name, int age)
{
this.name = name;
this.age = age;
}
/**
Get the name.
@return the name
*/
public String getName()
{
return name;
}
/**
Change the name.
@param name the name
*/
public void setName(String name)
{
this.name = name;
}
/**
Get the age.
@return the age
*/
public int getAge()
{
return age;
}
/**
Change the age.
@param age the age
*/
public void setAge()
{
this.age = age;
}
/**
Convert person to string form.
*/
public String toString()
{
return \"Name: \" + name + \"\\t\" + \"Age: \" + age;
}
}
package com.prt.test;
public class Student extends Person implements Comparable{
private int studentId;
private String major;
/**
* @return the studentId
*/
public int getStudentId() {
return studentId;
}
/**
* @param studentId the studentId to set
*/
public void setStudentId(int studentId) {
this.studentId = studentId;
}
/**
* @return the major
*/
public String getMajor() {
return major;
}
/**
* @param major the major to set
*/
public void setMajor(String major) {
this.major = major;
}
public Student(String name, int age, int studentId, String major) {
super(name, age);
this.studentId = studentId;
this.major = major;
}
/* (non-Javadoc)
* @see java.lang.Object#toString()
*/
@Override
public String toString() {
return \"name:\" + name+ \"\\t\"+\"\\t\"+\"age:\"+ age+\"\\t\"+ \"studentId :\"+ studentId +
\"\\t\" +\" major:\"+ major;
}
public int compareTo(Student st){
if(studentId==st.studentId)
return 0;
else if(studentId>st.studentId)
return 1;
else
return -1;
}
}
package com.prt.test;
public class Instructor extends Person implements Comparable {
private double salary;
public Instructor(String name, int age, double salary) {
super(name, age);
this.salary = salary;
}
/**
* @return the salary
*/
public double getSalary() {
return salary;
}
/**
* @param salary
* the salary to set
*/
public void setSalary(double salary) {
this.salary = salary;
}
public int compareTo(Instructor is) {
if (salary == is.salary)
return 0;
else if (salary > is.salary)
return 1;
else
ret.
Hello. Im creating a class called Bill. I need to design the class.pdf
Hello. I\'m creating a class called Bill. I need to design the class Bill with data members to store
patient’s ID and the patient’s hospital charges such as pharmacy charges for medicine, and
doctor’s fee, and the room charges. And I need to add appropriate constructors and methods to
initialize, access, and manipulate the data members. I\'m struggling with this class. Thank you
for the help. I\'ll provide my current classes below.
Person.java
-----------
public class Person {
private String lastName;
private String firstName;
public Person(String last, String first)
{
this.lastName = last;
this.firstName = first;
}
public String getLastName() {
return lastName;
}
public void setLastName(String lastName) {
this.lastName = lastName;
}
public String getFirstName() {
return firstName;
}
public void setFirstName(String firstName) {
this.firstName = firstName;
}
public String toString()
{
return lastName + \", \" + firstName;
}
}
---------------
Doctor.java
----------------
public class Doctor extends Person { // doctor class that inherits the person class
String Speciality;
public Doctor(String last, String first) { // constructor
super(last, first);
}
@Override
public String toString() { // method that return the data of the doctor
return \"Doctor{\" + \"Speciality=\" + Speciality + \'}\';
}
public String getSpeciality() {
return Speciality;
}
public void setSpeciality(String Speciality) {
this.Speciality = Speciality;
}
}
------------
Patient.java
------------
public class Patient extends Person{
private int PatientId;
private int age;
private Doctor attendingPhysician;
private Date dob;
private Date admitted,discharged;
public Patient(String firstName,String lastName,int PatientId,int age,Doctor
attendingPhysician,Date dob,Date admitted,Date discharged)
{
super(lastName,firstName);
this.PatientId = PatientId;
this.age = age;
this.admitted = admitted;
this.discharged = discharged;
this.dob = dob;
this.attendingPhysician = attendingPhysician;
}
public int getPatientId()
{
return PatientId;
}
public int getAge()
{
return age;
}
public Date getAdmissionDate()
{
return admitted;
}
public Date getDischargedDate()
{
return discharged;
}
public Date getDOB()
{
return dob;
}
public Doctor getPhysician()
{
return attendingPhysician;
}
public void setPatientId(int PatientId)
{
this.PatientId = PatientId;
}
public void setAge(int age)
{
this.age = age;
}
public void setAdmissionDate(Date admitted)
{
this.admitted = admitted;
}
public void setDischargedDate(Date discharged)
{
this.discharged = discharged;
}
public void setDOB(Date dob)
{
this.dob = dob;
}
public void setPhysician(Doctor attendingPhysician)
{
this.attendingPhysician = attendingPhysician;
}
}
------------
Date.java
--------------
public class Date {
private int year;
private int month;
private int day;
public Date()
{
year = 1900;
month = 1;
day = 1;
}
public Date(int y, int m, int d)
{
year = y;
month = m;
day = d;
}
public String toString()
{
return month + \"/\" + day + \"/\" + year;
}
pu.
Inheritance compiler support
1. The document discusses various C++ concepts related to polymorphism and virtual functions including inheritance, upcasting, overriding virtual functions, pure virtual functions, virtual destructors, and operator overloading.
2. It provides code examples to demonstrate polymorphism with classes like Instrument, Wind, Pet and subclasses Dog and Cat.
3. It also shows examples of upcasting, downcasting using dynamic_cast, returning references/pointers to derived types, and ensuring proper object destruction with virtual destructors.
please help with java questionsJAVA CODEplease check my code and.pdf
please help with java questions
JAVA CODE
please check my code and help my questions
CLASS ADDRESS
public class Address{
private int streetNumber;
private String streetName;
private String city;
private String state;
private String country;
// streetNumber
// streetName
// city
// state
// country
public Address(int streetNumber, String streetName, String city, String state, String country) {
this.streetNumber = streetNumber;
this.streetName = streetName;
this.city = city;
this.state = state;
this.country = country;
}
//return the streetNumber
public int getStreetNumber() {
return streetNumber;
}
// set street number
public void setStreetNumber(int streetNumber) {
this.streetNumber = streetNumber;
}
//return the streetName
public String getStreetName() {
return streetName;
}
// set street name
public void setStreetName(String streetName) {
this.streetName = streetName;
}
//return the city
public String getCity() {
return city;
}
//set the city
public void setCity(String city) {
this.city = city;
}
//return the state
public String getState() {
return state;
}
//the state to set
public void setState(String state) {
this.state = state;
}
// return the country
public String getCountry() {
return country;
}
// tset country
public void setCountry(String country) {
this.country = country;
}
// see java.lang.Object#toString()
@Override
public String toString() {
return \" [streetNumber=\" + streetNumber + \", streetName=\" + streetName
+ \", city=\" + city + \", state=\" + state + \", country=\"
+ country + \"]\";
}
}
////////////////////////////////////////////////////////////////////////////////////////
CLASS PERSON
public class Person extends Address {
private String name;
public Person (int streetNumber, String streetName, String city, String state, String country,
String name) {
super(streetNumber, streetName, city, state, country);
this.name = name;
}
//retuurn name
public String getName() {
return name;
}
// set name
public void setName(String name) {
this.name = name;
}
//see java.lang.Object#toString()
@Override
public String toString() {
return \"Person [name=\" + name + \", getStreetNumber()=\"
+ getStreetNumber() + \", getStreetName()=\" + getStreetName()
+ \", getCity()=\" + getCity() + \", getState()=\" + getState()
+ \", getCountry()=\" + getCountry() + \", toString()=\"
+ super.toString() + \", getClass()=\" + getClass()
+ \", hashCode()=\" + hashCode() + \"]\";
}
}
/////////////////////////////////////////////////////////////////
CLASS STUDENT
import java.util.ArrayList;
import java.util.List;
public class Student extends Person {
private String CIN;
List courses;
public Student(int streetNumber, String streetName, String city, String state, String country,
String name, String CIN) {
super(streetNumber, streetName, city, state, country, name);
// Auto-generated constructor stub
this.CIN = CIN;
courses = new ArrayList();
}
// reutrn cin
public String getCIN() {
return CIN;
}
// set cin
public void setCIN(String cIN) {
CIN = cIN;
}
pub.
はじめてのGroovy
T.Yamamoto gave a presentation on July 24, 2009 in Nagoya about using Grails for web development. He mentioned that around 90% of his work involves Grails and that he is a member of JGGUG, a Japanese user group for Groovy and Grails. In the presentation, he discussed using the Acegi Plugin with Grails.
Solid
The Cooker class has private name and faceId fields. It contains getter and setter methods for each field to allow external classes to access and modify the field values. The class also contains a toString method to convert the object to a string representation and a new toXml method to convert it to XML format.
Better Software: introduction to good code
The document discusses good code practices and principles. It begins with an agenda that covers why code quality matters, object oriented principles like SOLID, code smells and heuristics for good code, and concludes with questions. Some key principles discussed include the single responsibility principle, open/closed principle, Liskov substitution principle, and interface segregation principle. Examples are given to illustrate how to apply these principles and improve code quality.
Getting the following errorsError 1 error C2436 {ctor} mem.pdf
Getting the following errors:
Error 1 error C2436: \'{ctor}\' : member function or nested class in constructor initializer list on
line 565
Error 2 error C2436: \'{ctor}\' : member function or nested class in constructor initializer list on
line 761
I need this code to COMPILE and RUN, but I cannot get rid of this error. Please Help!!
#include
#include
#include
#include
using namespace std;
enum contactGroupType
{// used in extPersonType
FAMILY,
FRIEND,
BUSINESS,
UNFILLED
};
class addressType
{
private:
string st_address;
string city;
string state;
int zip;
public:
void print(string, string, string, int)const;
void setStreet(string);
string getStreet()const;
void setCity(string);
string getCity()const;
void setState(string);
string getState()const;
void setZip(int);
int getZip()const;
void set(string, string, string, int);// set all address fields
string get()const;// get address as one concatenated string
addressType();
// ~addressType();
};
class personType
{
private:
string firstName;
string lastName;
public:
void print()const;
void setName(string first, string last);
string getFirstName()const;
string getLastName()const;
string get()const;// return First Last names concatenated
personType & operator=(const personType &);
personType(string, string);
personType();
};
class dateType
{
private:
int dMonth;
int dDay;
int dYear;
public:
void setDate(int month, int day, int year);
int getDay()const;
int getMonth()const;
int getYear()const;
void print()const;
string get()const;// return string representation as DD/MM/YYYY
dateType & operator=(const dateType & d);
dateType(int, int, int);
dateType();
};
class extPersonType :public personType {
private:
addressType address;// added members
dateType birthday;
contactGroupType group;
string phone;
public:
// methods
void setPhone(string);
string getPhone()const;
void setGroup(contactGroupType);
contactGroupType getGroup()const;
void setBirthday(int, int, int);
dateType getBirthday()const;
void print();
string get()const;// return string representation of ext person type
extPersonType & operator=(const extPersonType & p);
string groupToString(contactGroupType)const;
contactGroupType stringToGroup(string)const;
// constructors
extPersonType();
extPersonType(string first, string last);
};
// because we have no arrayListType, we are using our own
// implementation with a small subset of functions
class arrayListType
{
extPersonType array[500];
int size;
public:
arrayListType();
extPersonType & operator[](int i);
void removeLast();// remove last element
void add(const extPersonType &);// add new element
int getSize()const;// get array size
};
class addressBookType :public arrayListType
{
private:
static const char FS = \'\\t\';// field separator in file (TAB char)
int current;// current position
string fileName;// filename
fstream fileStream;// file as fstream
/* filiters */
contactGroupType fltGroup;
string fltFromLast, fltToLast;
dateType fltFromDate, fltTiDate;
/* flags for effective filters */
bool fl.
Oop php 5
The document discusses object-oriented programming concepts in PHP such as classes, objects, inheritance, visibility, static methods and properties, abstract classes, interfaces, design patterns, and singleton patterns. It provides examples of creating classes for products and writers, using inheritance between product classes, and implementing a singleton pattern. The document concludes by stating the learner's progress is 20% complete and recommends further studying object-oriented concepts and patterns at home.
PHPUnit でよりよくテストを書くために
The document defines a fib function that recursively calculates Fibonacci numbers and prints the 10th Fibonacci number. It then defines some unit tests for a Calculator class that test the add method by asserting the expected result. Finally, it defines some unit tests for a User class that test validating a user object.
Production.javapublic class Production { Declaring instance.pdf
The document defines classes for different types of productions - Production, Film, Play, and Musical. Production is the parent class that defines common properties like title, director, writer. Child classes like Film add properties specific to that type - box office gross for Film. The main method creates objects of each type and prints their details.
Adding Dependency Injection to Legacy Applications
Dependency Injection (DI) is a fantastic technique, but what if you what to use dependency injection in your legacy application. Fear not! As someone who as done this very thing, I will show how you can successful and incrementally add DI to any application. I will present a number of recipes and solutions to common problems and give a tour of the various PHP DI projects and how they can help.
Here is the codeimport java.util.; class GroceryItem { Stri.pdf
Here is the code
import java.util.*;
class GroceryItem
{
String name;
double value;
GroceryItem(String n, double v)
{
name=n;
value=v;
}
void setName(String n)
{
name=n;
}
void setValue(double n)
{
if(n>0)
value=n;
else value=0;
}
String getName()
{
return name;
}
double getValue()
{
return value;
}
public String toString()
{
return \"Name: \"+name+\", Price: \"+value;
}
boolean equals(GroceryItem m)
{
if(this.name.equals(m.name) && this.value==m.value) return true;
else return false;
}
}
public class GroceryList
{
class ListNode
{
GroceryItem data;
ListNode link;
ListNode(GroceryItem i)
{
data=i;
link=null;
}
ListNode()
{
data=null;
link=null;
}
}
ListNode head, current, previous;
GroceryList()
{
head=null;
current=head;
previous=head;
}
void addItem(String s, double v)
{
ListNode n=new ListNode(new GroceryItem(s,v));
if(head==null)
{
head=n;
}
else if(head.link==null)
{
head.link=n;
}
else
{
ListNode t=head;
while(t.link!=null)
{
t=t.link;
}
t.link=n;
}
}
void goToNext()
{
if(current.link!=null)
{
previous=current;
current=current.link;
}
}
String getDataAtCurrent()
{
return current.data.toString();
}
void setDataAtCurrent(GroceryItem n)
{
if(current!=null)
{
current.data.setName(n.getName());
current.data.setValue(n.getValue());
}
}
void insertAfterCurrent(GroceryItem m)
{
if(current!=null)
{
ListNode n= new ListNode(m);
n.link=current.link;
current.link=n;
System.out.println(\"Node Added\");
}
}
void deleteCurrentNode()
{
if(current!=null)
{
previous.link=current.link;
}
}
void showList()
{
ListNode t=head;
while(t!=null)
{
System.out.println(t.data+\"\ \");
t=t.link;
}
System.out.println(\"Done! \");
}
boolean contains(String n, double v)
{
ListNode t=head;
GroceryItem i = new GroceryItem(n,v);
while(t!=null)
{
if(t.data.equals(i))
{
return true;
}
else t=t.link;
}
return false;
}
double totalCost()
{
ListNode t=head;
double cost=0;
while(t!=null)
{
cost+=t.data.getValue();
t=t.link;
}
return cost;
}
public static void main(String a[])
{
System.out.println(\"Grocery List Tester\");
System.out.println(\"Creating Grocery List\");
GroceryList l = new GroceryList();
System.out.println(\"Adding 5 grocery items\");
l.addItem(\"Taco Shells\", 2.0);
l.addItem(\"Salsa\", 1.59);
l.addItem(\"Ground Beef\", 4.59);
l.addItem(\"Taco Shells\", 1.3);
l.addItem(\"Shredded Cheese\", 2.99);
l.showList();
System.out.println(\"Do I remember the salsa? \"+l.contains(\"Salsa\", 1.59));
System.out.println(\"Total Cost \"+l.totalCost());
}
}
Solution
Here is the code
import java.util.*;
class GroceryItem
{
String name;
double value;
GroceryItem(String n, double v)
{
name=n;
value=v;
}
void setName(String n)
{
name=n;
}
void setValue(double n)
{
if(n>0)
value=n;
else value=0;
}
String getName()
{
return name;
}
double getValue()
{
return value;
}
public String toString()
{
return \"Name: \"+name+\", Price: \"+value;
}
boolean equals(GroceryItem m)
{
if(this.name.equals(m.name) && this.value==m.value) return true;
else return false;
}
}
public class GroceryList
{
.
Scala in practice
This document provides an overview of Scala and compares it to Java. It discusses Scala's object-oriented and functional capabilities, how it compiles to JVM bytecode, and benefits like less boilerplate code and support for functional programming. Examples are given of implementing a simple Property class in both Java and Scala to illustrate concepts like case classes, immutable fields, and less lines of code in Scala. The document also touches on Java interoperability, learning Scala gradually, XML processing capabilities, testing frameworks, and tool/library support.
Java: Nie popełniaj tych błędów!
Jako opiekun praktyk, stażów, mentor młodszych kolegów i koleżanek z zespołu, osoba odpowiedzialna za rekrutację techniczną, a także programista, który każdego dnia pracuje z oprogramowaniem dane mi było widzieć wiele błędów, złych zachowań i pomyłek w podejściu do tworzenia czystego kodu. Chciałbym się z Wami podzielić tymi najczęstszymi wpadkami w pracy z językiem Java. To nie będzie zwyczajna pogawędka! Zobaczycie kod źródłowy i ostry refaktoring. Zobaczycie, jak proste zmiany i lepsze zrozumienie samego języka mogą poprawić wydajność i czytelność Waszych aplikacji. Na podstawie całkiem prostych fragmentów kodu pokażę, na co zwrócić uwagę, żeby - to zabrzmi banalnie - być lepszym. Prezentacja dla wszystkich, którzy są na początku (i nie tylko) wspaniałej przygody z programowaniem (i zawrotnej kariery!).
MenuItemvpublic class MenuItem .pdf
/*****************MenuItem**************/
v
public class MenuItem {
/*variable declaration*/
private String name;
private String description;
private double price;
/*getter and setter method*/
public String getName() {
return name;
}
public void setName(String name) {
this.name = name;
}
public String getDescription() {
return description;
}
public void setDescription(String description) {
this.description = description;
}
public double getPrice() {
return price;
}
public void setPrice(double price) throws Exception {
if(price>=0){
this.price = price;
}else{
throw new Exception(\"New price is nonpositive\");
}
}
}
/***************Menu***************/
public class Menu {
/*Variable declaration*/
static final int MAX_ITEMS=50;
/*array of menu*/
Object menuItems[];
/*Default constructor */
public Menu() {
menuItems=new Object[MAX_ITEMS];
}
/*Add Item into Menu array*/
public void addItem(MenuItem menuItem,int position){
menuItems[position]=menuItem;
}
/*Getting item from array and printing details*/
public void getItem(int position){
MenuItem menuItem=(MenuItem) menuItems[position];
if(menuItem!=null){
System.out.println(\" Name: \"+menuItem.getName()+\"\ Description:
\"+menuItem.getDescription()+\"\ Price: \"
+menuItem.getPrice());
}
}
/*Removing Element from array if exist*/
public void removeItem(String name){
MenuItem menuItem;
for(int i=0;i
Solution
/*****************MenuItem**************/
v
public class MenuItem {
/*variable declaration*/
private String name;
private String description;
private double price;
/*getter and setter method*/
public String getName() {
return name;
}
public void setName(String name) {
this.name = name;
}
public String getDescription() {
return description;
}
public void setDescription(String description) {
this.description = description;
}
public double getPrice() {
return price;
}
public void setPrice(double price) throws Exception {
if(price>=0){
this.price = price;
}else{
throw new Exception(\"New price is nonpositive\");
}
}
}
/***************Menu***************/
public class Menu {
/*Variable declaration*/
static final int MAX_ITEMS=50;
/*array of menu*/
Object menuItems[];
/*Default constructor */
public Menu() {
menuItems=new Object[MAX_ITEMS];
}
/*Add Item into Menu array*/
public void addItem(MenuItem menuItem,int position){
menuItems[position]=menuItem;
}
/*Getting item from array and printing details*/
public void getItem(int position){
MenuItem menuItem=(MenuItem) menuItems[position];
if(menuItem!=null){
System.out.println(\" Name: \"+menuItem.getName()+\"\ Description:
\"+menuItem.getDescription()+\"\ Price: \"
+menuItem.getPrice());
}
}
/*Removing Element from array if exist*/
public void removeItem(String name){
MenuItem menuItem;
for(int i=0;i.
多治見IT勉強会 Groovy Grails
The document discusses sample code for creating a Chat class with message, dateCreated, and lastUpdated properties in Groovy. It also defines a ChatController that uses scaffolding to automatically generate CRUD operations for the Chat class.
@author public class Person{ String sname, .pdf
/**
* @author
*
*/
public class Person
{
String sname, iname;
int fid, sid;
}
/**
* @author
*
*/
public class Student extends Person
{
String sname;
int sid;
int no_of_credits, tot_grade_pts;
/**
* @param sname
* @param sid
*/
public Student(String sname, int sid)
{
this.sname = sname;
this.sid = sid;
}
/**
* @return
*/
public String get_name()
{
return sname;
}
public int get_sid()
{
return sid;
}
public boolean two_equal(int sid)
{
if ((this.sid) == sid)
return true;
else
return false;
}
public void set_credits(int credits)
{
no_of_credits = credits;
}
public int get_credits()
{
return no_of_credits;
}
public void set_tot_gpts(int gpts)
{
tot_grade_pts = gpts;
}
public int get_tgpts()
{
return tot_grade_pts;
}
public float get_GPA()
{
return ((tot_grade_pts) / (no_of_credits));
}
}
/**
* @author
*
*/
public class Instructor extends Person
{
String iname;
int fid;
String dept;
/**
* @param iname
* @param fid
*/
public Instructor(String iname, int fid)
{
this.iname = iname;
this.fid = fid;
}
/**
* @param dept
*/
void set_dept(String dept)
{
this.dept = dept;
}
/**
* @return
*/
public String get_dept()
{
return dept;
}
}
import java.util.ArrayList;
/**
* @author
*
*/
public class Course
{
String cname, instructor_name;
int creg_code, max_students, no_of_students;
ArrayList reg_students = new ArrayList();
/**
* @param cname
* @param creg_code
* @param max_students
*/
Course(String cname, int creg_code, int max_students)
{
this.cname = cname;
this.creg_code = creg_code;
this.max_students = max_students;
}
/**
* @param instructor_name
*/
void set_instructor(String instructor_name)
{
this.instructor_name = instructor_name;
}
/**
* method to search student id
*
* @param sid
* @return
*/
public boolean search_student(int sid)
{
if (reg_students.contains(sid))
return true;
else
return false;
}
/**
* method to add student id
*
* @param sid
*/
public void add_student(int sid)
{
try {
if ((reg_students.size()) == max_students)
{
throw new MyException();
}
else
reg_students.add(sid);
}
catch (Exception e)
{
System.out.println(\"Course has maximum students\");
}
}
/**
* method to remove student id
*
* @param sid
*/
public void rem_student(int sid)
{
try {
if (reg_students.contains(sid))
reg_students.remove(new Integer(sid));
else
throw new MyException();
} catch (Exception e)
{
System.out.println(\"NO STUDENT FOUND WITH THE GIVEN id\");
}
}
}
/**
* @author
*
*/
public class MyException extends Exception
{
public MyException() {
// TODO Auto-generated constructor stub
super(\" Invalid Data\");
}
}
import java.io.BufferedReader;
import java.io.IOException;
import java.io.InputStreamReader;
public class Registrar
{
/**
* @param args
* @throws NumberFormatException
* @throws IOException
*/
public static void main(String args[]) throws NumberFormatException,
IOException
{
Course c1 = new Course(\"default_course\", 123, 10);
int ch, regcode, max_stu, sid;
String cname, sname;
BufferedReader br = new BufferedReader(new InputStreamReader(System.in));
do {
System..
PHP for Adults: Clean Code and Object Calisthenics
The document discusses principles and techniques for writing clean code in PHP, including:
- The S.O.L.I.D. principles for object-oriented design (single responsibility, open/closed, Liskov substitution, etc.)
- Object calisthenics rules for PHP functions/methods like using single indentation levels and early returns.
- Refactoring code examples to follow these principles and rules to improve readability, maintainability and testability of PHP code.
29. Code an application program that keeps track of student informat.pdf
29. Code an application program that keeps track of student information at your college. Include
their names, identification numbers, and grade point averages in a fully encapsulated,
homogeneous sorted singly linked list structure. When launched, the user will be asked to input
the initial number of students and the initial data set. Once this is complete, the user will be
presented with the following menu: Enter: 1 to insert a new student\'s information, 2 to fetch and
output a student\'s information, 3 to delete a student\'s information, 4 to update a student\'s
information, 5 to output all the student information in sorted order, and 6 to exit the program.
The program should perform an unlimited number of operations until the user enters a 6 to exit
the program. If the user requests an operation on a node not in the structure, the program output
should be “node not in structure.” Otherwise, the message “operation complete” should be
output. in java
Solution
Dear Asker,
Following 3 classes consist the colution to this problem. This will give you an idea to approach
this problem:
//Student Class
package studentinfo;
public class Student implements Comparable {
private String name;
private String id;
private double gpa;
public Student(String id, String name, double gpa) {
this.name = name;
this.id = id;
this.gpa = gpa;
}
/**
* @return the name
*/
public String getName() {
return name;
}
/**
* @param name the name to set
*/
public void setName(String name) {
this.name = name;
}
/**
* @return the id
*/
public String getId() {
return id;
}
/**
* @param id the id to set
*/
public void setId(String id) {
this.id = id;
}
/**
* @return the gpa
*/
public double getGpa() {
return gpa;
}
/**
* @param gpa the gpa to set
*/
public void setGpa(double gpa) {
this.gpa = gpa;
}
@Override
public int compareTo(Student o) {
if (this.id.compareTo(o.id) < 0) {
return -1;
} else if (this.id.compareTo(o.id) > 0) {
return 1;
} else if (this.gpa < o.gpa) {
return -1;
} else if (this.gpa > o.gpa) {
return 1;
}
return 0;
}
public boolean equals(Student o) {
if (this.name == o.name && this.id == o.id && this.gpa == o.gpa) {
return true;
}
return false;
}
}
//Student container class
package studentinfo;
import java.util.Collections;
import java.util.LinkedList;
public class StudentContainer {
LinkedList studentList;
public StudentContainer() {
this.studentList = new LinkedList();
}
public boolean hasStudent(String id, String name, double gpa) {
return this.studentList.contains(new Student(id, name, gpa));
}
public boolean insertStudent(String id, String name, double gpa) {
if (!this.isValidString(id) || !this.isValidString(name) || !this.isValidGpa(gpa)) {
return false;
}
this.studentList.add(new Student(id, name, gpa));
return true;
}
public boolean deleteStudentById(String id) {
Student toRemove = null;
for (Student e : studentList) {
if (e.getId() == id) {
toRemove = e;
break;
}
}
if (toRemove != null) {
this.studentList.remove(toRemove);
return true;
}
return false;.
Modul Praktek Java OOP
Modul untuk Praktikum Pengolahan Database di Java dengan menggunakan konsep OOP Mata Pelajaran Pemrograman Internet dengan Java-JSP SMK Telkom Sandhy Putra Malang
Oops in php
OOPS in PHP - Here we are concentrating on Learning OOPS concept. We are learning with Real World Example.
import java.util.Arrays;import java.util.List;public class Bursa.pdf
import java.util.Arrays;
import java.util.List;
public class BursarOfficeService {
package edu.nku.csc364.bursar;
public enum ClassStatus {
SENIOR, JUNIOR, SOPHOMORE, FRESHMEN
}
package edu.nku.csc364.bursar;
public class Event {
EventType type;
T data;
public Event(EventType type) {
this(type, null);
}
public Event(EventType type, T data) {
this.type = type;
this.data = data;
}
public EventType getType() {
return type;
}
public T getData() {
return data;
}
}
public void receiveEvent(Event event) {
}
public List runReport() {
return Arrays.asList();
}
}
package edu.nku.csc364.bursar;
public enum EventType {
NEW_REQUEST, REQUEST_COMPLETED;
}
package edu.nku.csc364.bursar;
public class Student {
private String name;
private double gpa;
private ClassStatus status;
private int token;
public Student(String name, double gpa, ClassStatus status) {
this.name = name;
this.gpa = gpa;
this.status = status;
}
public Student(String name, double gpa, int token) {
this.name = name;
this.gpa = gpa;
this.token = token;
}
public String getName() {
return name;
}
public double getGpa() {
return gpa;
}
public ClassStatus getStatus() {
return status;
}
public int getToken() {
return token;
}
public String toString() {
return \"{\" + name + \", \" + gpa + \", \" + status + \", \" + token + \"}\";
}
}
package edu.nku.csc364.bursar;
import org.junit.Before;
import org.junit.Test;
import java.util.List;
import static edu.nku.csc364.bursar.EventType.NEW_REQUEST;
import static edu.nku.csc364.bursar.EventType.REQUEST_COMPLETED;
import static org.assertj.core.api.Assertions.assertThat;
public class BursarOfficeServiceTest {
BursarOfficeService service;
public void setup() {
service = new BursarOfficeService();
}
public void happyPathExample() {
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"John\", 3.75,
ClassStatus.SENIOR)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Mark\", 3.8,
ClassStatus.FRESHMEN)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Shawn\", 3.7,
ClassStatus.JUNIOR)));
service.receiveEvent(new Event<>(REQUEST_COMPLETED));
service.receiveEvent(new Event<>(REQUEST_COMPLETED));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Sam\", 3.85,
ClassStatus.SENIOR)));
service.receiveEvent(new Event<>(REQUEST_COMPLETED));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Ashley\", 3.9,
ClassStatus.SOPHOMORE)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Mary\", 3.6,
ClassStatus.FRESHMEN)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Andrew\", 3.95,
ClassStatus.JUNIOR)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Dan\", 3.95,
ClassStatus.SENIOR)));
service.receiveEvent(new Event<>(REQUEST_COMPLETED));
List report = service.runReport();
assertThat(report).isNotEmpty();
assertThat(report).hasSize(4);
assertThat(report).containsSequence(\"Andrew\", \"Ashley\", \"Mark\", \"Mary\");
}
}
java.lang.Object
java.util.AbstractCollection
java.util.AbstractQueu.
I have the following code and I need to know why I am receiving the .pdf
Edwards Manufacturing Company purchases two component parts from three different suppliers.
The suppliers have limited capacity, and no one supplier can meet all the company’s needs. In
addition, the suppliers charge different prices for the components. Component price data (in
price per unit) are as follows:
Each supplier has a limited capacity in terms of the total number of components it can supply.
However, as long as Edwards provides sufficient advance orders, each supplier can devote its
capacity to component 1, component 2, or any combination of the two components, if the total
number of units ordered is within its capacity. Supplier capacities are as follows:
If the Edwards production plan for the next period includes 1000 units of component 1 and 800
units of component 2, what purchases do you recommend? That is, how many units of each
component should be ordered from each supplier? Round your answers to the nearest whole
number.
What is the total purchase cost for the components? Round your answer to the nearest dollar.
$ ????SupplierComponent1231$11$10$132$10$11$11
Solution
For component 1:
supplier 2 have minimum cost and capacity 1050.
So all the component 1 (1000) can be purchased from supplier 2.
So, supplier 2 have 50 more capacity.
Now, supplier 1 have minimum cost for component 2 and have capacity of 650.
so, number of component 2 from supplier1 can be 650.
Now, we need 150 more component 2.
supplier 2 and 3 have same cost for component 2.
supllier have only 50 capacity now and supplier have 850.
So, 150 component 2 can be purchased from supplier 3.
Let y be the number of components fromSupplier123TotalcostComponent
1010000100010000Component 265001508008150Total cost18150.
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
The document shows the step-by-step solution to simplify the expression (7x*14x)^1/2. It first writes the expression as (7x*14x)^1/2, then simplifies the terms inside the radical to get (2*7*7*x^2)^1/2, and finally further simplifies the terms to get the final expression of 7x(2)^1/2.
You can think of H as being heat energy added ( + ), or heat removed.pdf
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids.
Solution
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids..
More Related Content
Similar to BasicPizza.javapublic class BasicPizza { String type; String c.pdf
はじめてのGroovy
T.Yamamoto gave a presentation on July 24, 2009 in Nagoya about using Grails for web development. He mentioned that around 90% of his work involves Grails and that he is a member of JGGUG, a Japanese user group for Groovy and Grails. In the presentation, he discussed using the Acegi Plugin with Grails.
Solid
The Cooker class has private name and faceId fields. It contains getter and setter methods for each field to allow external classes to access and modify the field values. The class also contains a toString method to convert the object to a string representation and a new toXml method to convert it to XML format.
Better Software: introduction to good code
The document discusses good code practices and principles. It begins with an agenda that covers why code quality matters, object oriented principles like SOLID, code smells and heuristics for good code, and concludes with questions. Some key principles discussed include the single responsibility principle, open/closed principle, Liskov substitution principle, and interface segregation principle. Examples are given to illustrate how to apply these principles and improve code quality.
Getting the following errorsError 1 error C2436 {ctor} mem.pdf
Getting the following errors:
Error 1 error C2436: \'{ctor}\' : member function or nested class in constructor initializer list on
line 565
Error 2 error C2436: \'{ctor}\' : member function or nested class in constructor initializer list on
line 761
I need this code to COMPILE and RUN, but I cannot get rid of this error. Please Help!!
#include
#include
#include
#include
using namespace std;
enum contactGroupType
{// used in extPersonType
FAMILY,
FRIEND,
BUSINESS,
UNFILLED
};
class addressType
{
private:
string st_address;
string city;
string state;
int zip;
public:
void print(string, string, string, int)const;
void setStreet(string);
string getStreet()const;
void setCity(string);
string getCity()const;
void setState(string);
string getState()const;
void setZip(int);
int getZip()const;
void set(string, string, string, int);// set all address fields
string get()const;// get address as one concatenated string
addressType();
// ~addressType();
};
class personType
{
private:
string firstName;
string lastName;
public:
void print()const;
void setName(string first, string last);
string getFirstName()const;
string getLastName()const;
string get()const;// return First Last names concatenated
personType & operator=(const personType &);
personType(string, string);
personType();
};
class dateType
{
private:
int dMonth;
int dDay;
int dYear;
public:
void setDate(int month, int day, int year);
int getDay()const;
int getMonth()const;
int getYear()const;
void print()const;
string get()const;// return string representation as DD/MM/YYYY
dateType & operator=(const dateType & d);
dateType(int, int, int);
dateType();
};
class extPersonType :public personType {
private:
addressType address;// added members
dateType birthday;
contactGroupType group;
string phone;
public:
// methods
void setPhone(string);
string getPhone()const;
void setGroup(contactGroupType);
contactGroupType getGroup()const;
void setBirthday(int, int, int);
dateType getBirthday()const;
void print();
string get()const;// return string representation of ext person type
extPersonType & operator=(const extPersonType & p);
string groupToString(contactGroupType)const;
contactGroupType stringToGroup(string)const;
// constructors
extPersonType();
extPersonType(string first, string last);
};
// because we have no arrayListType, we are using our own
// implementation with a small subset of functions
class arrayListType
{
extPersonType array[500];
int size;
public:
arrayListType();
extPersonType & operator[](int i);
void removeLast();// remove last element
void add(const extPersonType &);// add new element
int getSize()const;// get array size
};
class addressBookType :public arrayListType
{
private:
static const char FS = \'\\t\';// field separator in file (TAB char)
int current;// current position
string fileName;// filename
fstream fileStream;// file as fstream
/* filiters */
contactGroupType fltGroup;
string fltFromLast, fltToLast;
dateType fltFromDate, fltTiDate;
/* flags for effective filters */
bool fl.
Oop php 5
The document discusses object-oriented programming concepts in PHP such as classes, objects, inheritance, visibility, static methods and properties, abstract classes, interfaces, design patterns, and singleton patterns. It provides examples of creating classes for products and writers, using inheritance between product classes, and implementing a singleton pattern. The document concludes by stating the learner's progress is 20% complete and recommends further studying object-oriented concepts and patterns at home.
PHPUnit でよりよくテストを書くために
The document defines a fib function that recursively calculates Fibonacci numbers and prints the 10th Fibonacci number. It then defines some unit tests for a Calculator class that test the add method by asserting the expected result. Finally, it defines some unit tests for a User class that test validating a user object.
Production.javapublic class Production { Declaring instance.pdf
The document defines classes for different types of productions - Production, Film, Play, and Musical. Production is the parent class that defines common properties like title, director, writer. Child classes like Film add properties specific to that type - box office gross for Film. The main method creates objects of each type and prints their details.
Adding Dependency Injection to Legacy Applications
Dependency Injection (DI) is a fantastic technique, but what if you what to use dependency injection in your legacy application. Fear not! As someone who as done this very thing, I will show how you can successful and incrementally add DI to any application. I will present a number of recipes and solutions to common problems and give a tour of the various PHP DI projects and how they can help.
Here is the codeimport java.util.; class GroceryItem { Stri.pdf
Here is the code
import java.util.*;
class GroceryItem
{
String name;
double value;
GroceryItem(String n, double v)
{
name=n;
value=v;
}
void setName(String n)
{
name=n;
}
void setValue(double n)
{
if(n>0)
value=n;
else value=0;
}
String getName()
{
return name;
}
double getValue()
{
return value;
}
public String toString()
{
return \"Name: \"+name+\", Price: \"+value;
}
boolean equals(GroceryItem m)
{
if(this.name.equals(m.name) && this.value==m.value) return true;
else return false;
}
}
public class GroceryList
{
class ListNode
{
GroceryItem data;
ListNode link;
ListNode(GroceryItem i)
{
data=i;
link=null;
}
ListNode()
{
data=null;
link=null;
}
}
ListNode head, current, previous;
GroceryList()
{
head=null;
current=head;
previous=head;
}
void addItem(String s, double v)
{
ListNode n=new ListNode(new GroceryItem(s,v));
if(head==null)
{
head=n;
}
else if(head.link==null)
{
head.link=n;
}
else
{
ListNode t=head;
while(t.link!=null)
{
t=t.link;
}
t.link=n;
}
}
void goToNext()
{
if(current.link!=null)
{
previous=current;
current=current.link;
}
}
String getDataAtCurrent()
{
return current.data.toString();
}
void setDataAtCurrent(GroceryItem n)
{
if(current!=null)
{
current.data.setName(n.getName());
current.data.setValue(n.getValue());
}
}
void insertAfterCurrent(GroceryItem m)
{
if(current!=null)
{
ListNode n= new ListNode(m);
n.link=current.link;
current.link=n;
System.out.println(\"Node Added\");
}
}
void deleteCurrentNode()
{
if(current!=null)
{
previous.link=current.link;
}
}
void showList()
{
ListNode t=head;
while(t!=null)
{
System.out.println(t.data+\"\ \");
t=t.link;
}
System.out.println(\"Done! \");
}
boolean contains(String n, double v)
{
ListNode t=head;
GroceryItem i = new GroceryItem(n,v);
while(t!=null)
{
if(t.data.equals(i))
{
return true;
}
else t=t.link;
}
return false;
}
double totalCost()
{
ListNode t=head;
double cost=0;
while(t!=null)
{
cost+=t.data.getValue();
t=t.link;
}
return cost;
}
public static void main(String a[])
{
System.out.println(\"Grocery List Tester\");
System.out.println(\"Creating Grocery List\");
GroceryList l = new GroceryList();
System.out.println(\"Adding 5 grocery items\");
l.addItem(\"Taco Shells\", 2.0);
l.addItem(\"Salsa\", 1.59);
l.addItem(\"Ground Beef\", 4.59);
l.addItem(\"Taco Shells\", 1.3);
l.addItem(\"Shredded Cheese\", 2.99);
l.showList();
System.out.println(\"Do I remember the salsa? \"+l.contains(\"Salsa\", 1.59));
System.out.println(\"Total Cost \"+l.totalCost());
}
}
Solution
Here is the code
import java.util.*;
class GroceryItem
{
String name;
double value;
GroceryItem(String n, double v)
{
name=n;
value=v;
}
void setName(String n)
{
name=n;
}
void setValue(double n)
{
if(n>0)
value=n;
else value=0;
}
String getName()
{
return name;
}
double getValue()
{
return value;
}
public String toString()
{
return \"Name: \"+name+\", Price: \"+value;
}
boolean equals(GroceryItem m)
{
if(this.name.equals(m.name) && this.value==m.value) return true;
else return false;
}
}
public class GroceryList
{
.
Scala in practice
This document provides an overview of Scala and compares it to Java. It discusses Scala's object-oriented and functional capabilities, how it compiles to JVM bytecode, and benefits like less boilerplate code and support for functional programming. Examples are given of implementing a simple Property class in both Java and Scala to illustrate concepts like case classes, immutable fields, and less lines of code in Scala. The document also touches on Java interoperability, learning Scala gradually, XML processing capabilities, testing frameworks, and tool/library support.
Java: Nie popełniaj tych błędów!
Jako opiekun praktyk, stażów, mentor młodszych kolegów i koleżanek z zespołu, osoba odpowiedzialna za rekrutację techniczną, a także programista, który każdego dnia pracuje z oprogramowaniem dane mi było widzieć wiele błędów, złych zachowań i pomyłek w podejściu do tworzenia czystego kodu. Chciałbym się z Wami podzielić tymi najczęstszymi wpadkami w pracy z językiem Java. To nie będzie zwyczajna pogawędka! Zobaczycie kod źródłowy i ostry refaktoring. Zobaczycie, jak proste zmiany i lepsze zrozumienie samego języka mogą poprawić wydajność i czytelność Waszych aplikacji. Na podstawie całkiem prostych fragmentów kodu pokażę, na co zwrócić uwagę, żeby - to zabrzmi banalnie - być lepszym. Prezentacja dla wszystkich, którzy są na początku (i nie tylko) wspaniałej przygody z programowaniem (i zawrotnej kariery!).
MenuItemvpublic class MenuItem .pdf
/*****************MenuItem**************/
v
public class MenuItem {
/*variable declaration*/
private String name;
private String description;
private double price;
/*getter and setter method*/
public String getName() {
return name;
}
public void setName(String name) {
this.name = name;
}
public String getDescription() {
return description;
}
public void setDescription(String description) {
this.description = description;
}
public double getPrice() {
return price;
}
public void setPrice(double price) throws Exception {
if(price>=0){
this.price = price;
}else{
throw new Exception(\"New price is nonpositive\");
}
}
}
/***************Menu***************/
public class Menu {
/*Variable declaration*/
static final int MAX_ITEMS=50;
/*array of menu*/
Object menuItems[];
/*Default constructor */
public Menu() {
menuItems=new Object[MAX_ITEMS];
}
/*Add Item into Menu array*/
public void addItem(MenuItem menuItem,int position){
menuItems[position]=menuItem;
}
/*Getting item from array and printing details*/
public void getItem(int position){
MenuItem menuItem=(MenuItem) menuItems[position];
if(menuItem!=null){
System.out.println(\" Name: \"+menuItem.getName()+\"\ Description:
\"+menuItem.getDescription()+\"\ Price: \"
+menuItem.getPrice());
}
}
/*Removing Element from array if exist*/
public void removeItem(String name){
MenuItem menuItem;
for(int i=0;i
Solution
/*****************MenuItem**************/
v
public class MenuItem {
/*variable declaration*/
private String name;
private String description;
private double price;
/*getter and setter method*/
public String getName() {
return name;
}
public void setName(String name) {
this.name = name;
}
public String getDescription() {
return description;
}
public void setDescription(String description) {
this.description = description;
}
public double getPrice() {
return price;
}
public void setPrice(double price) throws Exception {
if(price>=0){
this.price = price;
}else{
throw new Exception(\"New price is nonpositive\");
}
}
}
/***************Menu***************/
public class Menu {
/*Variable declaration*/
static final int MAX_ITEMS=50;
/*array of menu*/
Object menuItems[];
/*Default constructor */
public Menu() {
menuItems=new Object[MAX_ITEMS];
}
/*Add Item into Menu array*/
public void addItem(MenuItem menuItem,int position){
menuItems[position]=menuItem;
}
/*Getting item from array and printing details*/
public void getItem(int position){
MenuItem menuItem=(MenuItem) menuItems[position];
if(menuItem!=null){
System.out.println(\" Name: \"+menuItem.getName()+\"\ Description:
\"+menuItem.getDescription()+\"\ Price: \"
+menuItem.getPrice());
}
}
/*Removing Element from array if exist*/
public void removeItem(String name){
MenuItem menuItem;
for(int i=0;i.
多治見IT勉強会 Groovy Grails
The document discusses sample code for creating a Chat class with message, dateCreated, and lastUpdated properties in Groovy. It also defines a ChatController that uses scaffolding to automatically generate CRUD operations for the Chat class.
@author public class Person{ String sname, .pdf
/**
* @author
*
*/
public class Person
{
String sname, iname;
int fid, sid;
}
/**
* @author
*
*/
public class Student extends Person
{
String sname;
int sid;
int no_of_credits, tot_grade_pts;
/**
* @param sname
* @param sid
*/
public Student(String sname, int sid)
{
this.sname = sname;
this.sid = sid;
}
/**
* @return
*/
public String get_name()
{
return sname;
}
public int get_sid()
{
return sid;
}
public boolean two_equal(int sid)
{
if ((this.sid) == sid)
return true;
else
return false;
}
public void set_credits(int credits)
{
no_of_credits = credits;
}
public int get_credits()
{
return no_of_credits;
}
public void set_tot_gpts(int gpts)
{
tot_grade_pts = gpts;
}
public int get_tgpts()
{
return tot_grade_pts;
}
public float get_GPA()
{
return ((tot_grade_pts) / (no_of_credits));
}
}
/**
* @author
*
*/
public class Instructor extends Person
{
String iname;
int fid;
String dept;
/**
* @param iname
* @param fid
*/
public Instructor(String iname, int fid)
{
this.iname = iname;
this.fid = fid;
}
/**
* @param dept
*/
void set_dept(String dept)
{
this.dept = dept;
}
/**
* @return
*/
public String get_dept()
{
return dept;
}
}
import java.util.ArrayList;
/**
* @author
*
*/
public class Course
{
String cname, instructor_name;
int creg_code, max_students, no_of_students;
ArrayList reg_students = new ArrayList();
/**
* @param cname
* @param creg_code
* @param max_students
*/
Course(String cname, int creg_code, int max_students)
{
this.cname = cname;
this.creg_code = creg_code;
this.max_students = max_students;
}
/**
* @param instructor_name
*/
void set_instructor(String instructor_name)
{
this.instructor_name = instructor_name;
}
/**
* method to search student id
*
* @param sid
* @return
*/
public boolean search_student(int sid)
{
if (reg_students.contains(sid))
return true;
else
return false;
}
/**
* method to add student id
*
* @param sid
*/
public void add_student(int sid)
{
try {
if ((reg_students.size()) == max_students)
{
throw new MyException();
}
else
reg_students.add(sid);
}
catch (Exception e)
{
System.out.println(\"Course has maximum students\");
}
}
/**
* method to remove student id
*
* @param sid
*/
public void rem_student(int sid)
{
try {
if (reg_students.contains(sid))
reg_students.remove(new Integer(sid));
else
throw new MyException();
} catch (Exception e)
{
System.out.println(\"NO STUDENT FOUND WITH THE GIVEN id\");
}
}
}
/**
* @author
*
*/
public class MyException extends Exception
{
public MyException() {
// TODO Auto-generated constructor stub
super(\" Invalid Data\");
}
}
import java.io.BufferedReader;
import java.io.IOException;
import java.io.InputStreamReader;
public class Registrar
{
/**
* @param args
* @throws NumberFormatException
* @throws IOException
*/
public static void main(String args[]) throws NumberFormatException,
IOException
{
Course c1 = new Course(\"default_course\", 123, 10);
int ch, regcode, max_stu, sid;
String cname, sname;
BufferedReader br = new BufferedReader(new InputStreamReader(System.in));
do {
System..
PHP for Adults: Clean Code and Object Calisthenics
The document discusses principles and techniques for writing clean code in PHP, including:
- The S.O.L.I.D. principles for object-oriented design (single responsibility, open/closed, Liskov substitution, etc.)
- Object calisthenics rules for PHP functions/methods like using single indentation levels and early returns.
- Refactoring code examples to follow these principles and rules to improve readability, maintainability and testability of PHP code.
29. Code an application program that keeps track of student informat.pdf
29. Code an application program that keeps track of student information at your college. Include
their names, identification numbers, and grade point averages in a fully encapsulated,
homogeneous sorted singly linked list structure. When launched, the user will be asked to input
the initial number of students and the initial data set. Once this is complete, the user will be
presented with the following menu: Enter: 1 to insert a new student\'s information, 2 to fetch and
output a student\'s information, 3 to delete a student\'s information, 4 to update a student\'s
information, 5 to output all the student information in sorted order, and 6 to exit the program.
The program should perform an unlimited number of operations until the user enters a 6 to exit
the program. If the user requests an operation on a node not in the structure, the program output
should be “node not in structure.” Otherwise, the message “operation complete” should be
output. in java
Solution
Dear Asker,
Following 3 classes consist the colution to this problem. This will give you an idea to approach
this problem:
//Student Class
package studentinfo;
public class Student implements Comparable {
private String name;
private String id;
private double gpa;
public Student(String id, String name, double gpa) {
this.name = name;
this.id = id;
this.gpa = gpa;
}
/**
* @return the name
*/
public String getName() {
return name;
}
/**
* @param name the name to set
*/
public void setName(String name) {
this.name = name;
}
/**
* @return the id
*/
public String getId() {
return id;
}
/**
* @param id the id to set
*/
public void setId(String id) {
this.id = id;
}
/**
* @return the gpa
*/
public double getGpa() {
return gpa;
}
/**
* @param gpa the gpa to set
*/
public void setGpa(double gpa) {
this.gpa = gpa;
}
@Override
public int compareTo(Student o) {
if (this.id.compareTo(o.id) < 0) {
return -1;
} else if (this.id.compareTo(o.id) > 0) {
return 1;
} else if (this.gpa < o.gpa) {
return -1;
} else if (this.gpa > o.gpa) {
return 1;
}
return 0;
}
public boolean equals(Student o) {
if (this.name == o.name && this.id == o.id && this.gpa == o.gpa) {
return true;
}
return false;
}
}
//Student container class
package studentinfo;
import java.util.Collections;
import java.util.LinkedList;
public class StudentContainer {
LinkedList studentList;
public StudentContainer() {
this.studentList = new LinkedList();
}
public boolean hasStudent(String id, String name, double gpa) {
return this.studentList.contains(new Student(id, name, gpa));
}
public boolean insertStudent(String id, String name, double gpa) {
if (!this.isValidString(id) || !this.isValidString(name) || !this.isValidGpa(gpa)) {
return false;
}
this.studentList.add(new Student(id, name, gpa));
return true;
}
public boolean deleteStudentById(String id) {
Student toRemove = null;
for (Student e : studentList) {
if (e.getId() == id) {
toRemove = e;
break;
}
}
if (toRemove != null) {
this.studentList.remove(toRemove);
return true;
}
return false;.
Modul Praktek Java OOP
Modul untuk Praktikum Pengolahan Database di Java dengan menggunakan konsep OOP Mata Pelajaran Pemrograman Internet dengan Java-JSP SMK Telkom Sandhy Putra Malang
Oops in php
OOPS in PHP - Here we are concentrating on Learning OOPS concept. We are learning with Real World Example.
import java.util.Arrays;import java.util.List;public class Bursa.pdf
import java.util.Arrays;
import java.util.List;
public class BursarOfficeService {
package edu.nku.csc364.bursar;
public enum ClassStatus {
SENIOR, JUNIOR, SOPHOMORE, FRESHMEN
}
package edu.nku.csc364.bursar;
public class Event {
EventType type;
T data;
public Event(EventType type) {
this(type, null);
}
public Event(EventType type, T data) {
this.type = type;
this.data = data;
}
public EventType getType() {
return type;
}
public T getData() {
return data;
}
}
public void receiveEvent(Event event) {
}
public List runReport() {
return Arrays.asList();
}
}
package edu.nku.csc364.bursar;
public enum EventType {
NEW_REQUEST, REQUEST_COMPLETED;
}
package edu.nku.csc364.bursar;
public class Student {
private String name;
private double gpa;
private ClassStatus status;
private int token;
public Student(String name, double gpa, ClassStatus status) {
this.name = name;
this.gpa = gpa;
this.status = status;
}
public Student(String name, double gpa, int token) {
this.name = name;
this.gpa = gpa;
this.token = token;
}
public String getName() {
return name;
}
public double getGpa() {
return gpa;
}
public ClassStatus getStatus() {
return status;
}
public int getToken() {
return token;
}
public String toString() {
return \"{\" + name + \", \" + gpa + \", \" + status + \", \" + token + \"}\";
}
}
package edu.nku.csc364.bursar;
import org.junit.Before;
import org.junit.Test;
import java.util.List;
import static edu.nku.csc364.bursar.EventType.NEW_REQUEST;
import static edu.nku.csc364.bursar.EventType.REQUEST_COMPLETED;
import static org.assertj.core.api.Assertions.assertThat;
public class BursarOfficeServiceTest {
BursarOfficeService service;
public void setup() {
service = new BursarOfficeService();
}
public void happyPathExample() {
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"John\", 3.75,
ClassStatus.SENIOR)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Mark\", 3.8,
ClassStatus.FRESHMEN)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Shawn\", 3.7,
ClassStatus.JUNIOR)));
service.receiveEvent(new Event<>(REQUEST_COMPLETED));
service.receiveEvent(new Event<>(REQUEST_COMPLETED));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Sam\", 3.85,
ClassStatus.SENIOR)));
service.receiveEvent(new Event<>(REQUEST_COMPLETED));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Ashley\", 3.9,
ClassStatus.SOPHOMORE)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Mary\", 3.6,
ClassStatus.FRESHMEN)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Andrew\", 3.95,
ClassStatus.JUNIOR)));
service.receiveEvent(new Event<>(NEW_REQUEST, new Student(\"Dan\", 3.95,
ClassStatus.SENIOR)));
service.receiveEvent(new Event<>(REQUEST_COMPLETED));
List report = service.runReport();
assertThat(report).isNotEmpty();
assertThat(report).hasSize(4);
assertThat(report).containsSequence(\"Andrew\", \"Ashley\", \"Mark\", \"Mary\");
}
}
java.lang.Object
java.util.AbstractCollection
java.util.AbstractQueu.
I have the following code and I need to know why I am receiving the .pdf
Edwards Manufacturing Company purchases two component parts from three different suppliers.
The suppliers have limited capacity, and no one supplier can meet all the company’s needs. In
addition, the suppliers charge different prices for the components. Component price data (in
price per unit) are as follows:
Each supplier has a limited capacity in terms of the total number of components it can supply.
However, as long as Edwards provides sufficient advance orders, each supplier can devote its
capacity to component 1, component 2, or any combination of the two components, if the total
number of units ordered is within its capacity. Supplier capacities are as follows:
If the Edwards production plan for the next period includes 1000 units of component 1 and 800
units of component 2, what purchases do you recommend? That is, how many units of each
component should be ordered from each supplier? Round your answers to the nearest whole
number.
What is the total purchase cost for the components? Round your answer to the nearest dollar.
$ ????SupplierComponent1231$11$10$132$10$11$11
Solution
For component 1:
supplier 2 have minimum cost and capacity 1050.
So all the component 1 (1000) can be purchased from supplier 2.
So, supplier 2 have 50 more capacity.
Now, supplier 1 have minimum cost for component 2 and have capacity of 650.
so, number of component 2 from supplier1 can be 650.
Now, we need 150 more component 2.
supplier 2 and 3 have same cost for component 2.
supllier have only 50 capacity now and supplier have 850.
So, 150 component 2 can be purchased from supplier 3.
Let y be the number of components fromSupplier123TotalcostComponent
1010000100010000Component 265001508008150Total cost18150.
Similar to BasicPizza.javapublic class BasicPizza { String type; String c.pdf (20)
Getting the following errorsError 1 error C2436 {ctor} mem.pdf
Getting the following errorsError 1 error C2436 {ctor} mem.pdf
Production.javapublic class Production { Declaring instance.pdf
Production.javapublic class Production { Declaring instance.pdf
Adding Dependency Injection to Legacy Applications
Adding Dependency Injection to Legacy Applications
Here is the codeimport java.util.; class GroceryItem { Stri.pdf
Here is the codeimport java.util.; class GroceryItem { Stri.pdf
PHP for Adults: Clean Code and Object Calisthenics
PHP for Adults: Clean Code and Object Calisthenics
29. Code an application program that keeps track of student informat.pdf
29. Code an application program that keeps track of student informat.pdf
import java.util.Arrays;import java.util.List;public class Bursa.pdf
import java.util.Arrays;import java.util.List;public class Bursa.pdf
I have the following code and I need to know why I am receiving the .pdf
I have the following code and I need to know why I am receiving the .pdf
More from rdtraders2007
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
The document shows the step-by-step solution to simplify the expression (7x*14x)^1/2. It first writes the expression as (7x*14x)^1/2, then simplifies the terms inside the radical to get (2*7*7*x^2)^1/2, and finally further simplifies the terms to get the final expression of 7x(2)^1/2.
You can think of H as being heat energy added ( + ), or heat removed.pdf
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids.
Solution
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids..
wait, i am posting the solution.Solutionwait, i am posting the.pdf
This very short document does not provide any substantive information to summarize in 3 sentences or less. It simply states that the author is waiting to post a solution, but does not provide any details on the problem or nature of the solution.
There are many other contributing factors to the norms of culture th.pdf
There are many other contributing factors to the norms of culture that assert the statement
Solution
There are many other contributing factors to the norms of culture that assert the statement.
Thermal dimorphism is the capacity to form different structures at d.pdf
Thermal dimorphism is the capacity to form different structures at different temperatures. For
example, some fungi exhibit thermal dimorphism. They exist as molds when outside the human
body and as yeasts when they are in the human body. For example Penicillium marneffei grows
at room temperature as a mold and, it grows as yeast at body temperature.
The morphologic shift between hyphae or molds and yeast is the significant step for the
virulence, pathogenesis, and lifecycle of the dimorphic fungi. In the soil, the thermally dimorphic
fungi grow at 22–25°C as mycelia that produce infectious spores. Following soil disturbance,
aerosolized spores inhaled into the lungs of a mammalian host at 37°C convert to yeast to cause
pneumonia and various disorders.
Solution
Thermal dimorphism is the capacity to form different structures at different temperatures. For
example, some fungi exhibit thermal dimorphism. They exist as molds when outside the human
body and as yeasts when they are in the human body. For example Penicillium marneffei grows
at room temperature as a mold and, it grows as yeast at body temperature.
The morphologic shift between hyphae or molds and yeast is the significant step for the
virulence, pathogenesis, and lifecycle of the dimorphic fungi. In the soil, the thermally dimorphic
fungi grow at 22–25°C as mycelia that produce infectious spores. Following soil disturbance,
aerosolized spores inhaled into the lungs of a mammalian host at 37°C convert to yeast to cause
pneumonia and various disorders..
The prime factor of 210=2357 Anyways, numbers can only be divid.pdf
The prime factor of 210=2*3*5*7
Anyways, numbers can only be divided by their prime factors or combinations of their prime
factors and it is divisible by all of them
Now let n = n_1 * n_2 * ... * n_k
Then n * n=n^2 =( n_1 * n_2 * ... * n_k) *( n_1 * n_2 * ... * n_k) are all the prime numbers that
divide n^2 and no other prime number can divide them (or it would be in that multiplication).
Because 210 is a multiplication of prime factors (2*3*5*7) that divides n^2, then 210 must be in
that multiplication. Hence 210 divides n.
Solution
The prime factor of 210=2*3*5*7
Anyways, numbers can only be divided by their prime factors or combinations of their prime
factors and it is divisible by all of them
Now let n = n_1 * n_2 * ... * n_k
Then n * n=n^2 =( n_1 * n_2 * ... * n_k) *( n_1 * n_2 * ... * n_k) are all the prime numbers that
divide n^2 and no other prime number can divide them (or it would be in that multiplication).
Because 210 is a multiplication of prime factors (2*3*5*7) that divides n^2, then 210 must be in
that multiplication. Hence 210 divides n..
The OSI Reference Model layers, in order from top to bottomD. Appl.pdf
The OSI Reference Model layers, in order from top to bottom
D. Application, Presentation, Session, Transport, Network, Data Link, Physical
1. Application Layer
topmost layer of the OSI reference model, is the application layer. This layer directly support
user applications, like software for file transfers, database access, and e-mail. It serves as a
window through which application processes can access network services.
2.Presentation Layer
It defines the format used to exchange data among networked computers. It is a network\'s
translator. When dissimilar systems want to communicate, certain translation and byte reordering
is done. It translates data from the format from the application layer into a recognized format. At
the receiving computer, this layer translates intermediary format into format that can be useful to
that computer\'s application layer.
3. Session Layer
It allows two applications on different computers to open, use, and close a connection called a
session. It performs name-recognition and other functions, such as security, that are needed to
allow two applications to communicate over the network.
4. Transport Layer
It provides an additional connection level beneath the session layer. It ensures that packets are
delivered error free, in sequence, and without losses or duplications. At the sending computer,
this layer repackages messages, dividing long messages into several packets and collecting small
packets together in one package. T
5. Network Layer
It is responsible for addressing messages and translating logical addresses and names into
physical addresses. This layer also determines the route from the source to the destination
computer. It determines which path the data should take based on network conditions
6. Data-Link Layer
It sends data frames from the network layer to the physical layer. It controls the electrical
impulses that enter and leave the network cable. On the receiving end, the data-link layer
packages raw bits from the physical layer into data frames.
7. Physical Layer
This layer transmits the unstructured, raw bit stream over a physical medium (such as the
network cable). The physical layer is totally hardware-oriented and deals with all aspects of
establishing and maintaining a physical link between communicating computers. The physical
layer also carries the signals that transmit data generated by each of the higher layers.
Solution
The OSI Reference Model layers, in order from top to bottom
D. Application, Presentation, Session, Transport, Network, Data Link, Physical
1. Application Layer
topmost layer of the OSI reference model, is the application layer. This layer directly support
user applications, like software for file transfers, database access, and e-mail. It serves as a
window through which application processes can access network services.
2.Presentation Layer
It defines the format used to exchange data among networked computers. It is a network\'s
translator. When dissimilar systems want .
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an interrupt signal on
the bus when it requires CPU’s attention.
Programmed I/O :
* It is used only in low end microcomputers.
* It has only single output and single input instruction.
* In this procees each instructions selects one I/O device and transfers a single character (byte).
Working:
I/O operation is requested by CPU.
Operation is performed by I/O module.
Status bits is being set by I/O module
Status bits are checked periodically by CPU.
CPU is not directly informed by I/O module.
CPU is not interrupted by I/O module.
CPU may wait or come back after some time.
Advantages :
It is easy to program and understand.
Disadvantages :
It has single input and single output instruction.
CPU spends most of its time in a tight loop waiting for the device to become ready.(Busy
Waiting)
Interrupt-driven I/O
Advantages :
Fast and efficient
Disadvantages :
* Interrupting a running process is an expensive business (requires saving context).
* Requires extra hardware (DMA controller chip).
Working :
CPU is interupted bye the I/O module.
Data is requested by CPU.
The data is trasferres by I/O module.
DMA ensures that CPU grants I/O module authority to read from or write to memory without
involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Solution
Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an in.
SolutionSolutionSolution.pdf
The document discusses a solution to an unspecified problem. It states that the solution involves taking certain steps, but provides no details on what the actual problem or steps are. The summary is unable to extract any meaningful information due to the lack of context and specifics provided in the document.
slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf
The document shows how to calculate the slope of a linear function by taking the change in y-values (f(x)) over the change in x-values. It gives an example where f(x) is 120 and x is 12, so the slope is 120/12 = 10. The slope is calculated to be 10.
Question not visible. Please update the question and then i can answ.pdf
Question not visible. Please update the question and then i can answer it
Solution
Question not visible. Please update the question and then i can answer it.
Please find the required program along with the comments against eac.pdf
Please find the required program along with the comments against each line, also find the output
at last :
#include
#include
#include
#include
using namespace std;
void listCodonPositions(string dna, string codon){
vector positions; // holds all the positions that codon occurs within dna
size_t pos = dna.find(codon, 0); // finds the first occurance of codon
if(pos != string::npos) //if no codon is found
cout << pos << \" \" << flush;
else
cout << \"No occurance\" << flush;
while(pos != string::npos) //iterate till no occurance is found in a dna
{
pos = dna.find(codon,pos+1); //find next occurance
if(pos != string::npos) //if no codon is found
cout << pos << \" \" << flush;
}
cout << endl;
}
int main()
{
string humanDNA =
\"CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCA
GCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGA
CCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTT
CCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTG
TCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAGCTGAGCACTGGAGTGGAG
TTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATG\";
string mouseDNA =
\"CGCAATTTTTACTTAATTCTTTTTCTTTTAATTCATATATTTTTAATATGTTTACTAT
TAATGGTTATCATTCACCATTTAACTATTTGTTATTTTGACGTCATTTTTTTCTATTTC
CTCTTTTTTCAATTCATGTTTATTTTCTGTATTTTTGTTAAGTTTTCACAAGTCTAATA
TAATTGTCCTTTGAGAGGTTATTTGGTCTATATTTTTTTTTCTTCATCTGTATTTTTAT
GATTTCATTTAATTGATTTTCATTGACAGGGTTCTGCTGTGTTCTGGATTGTATTTTTC
TTGTGGAGAGGAACTATTTCTTGAGTGGGATGTACCTTTGTTCTTG\";
string unknownDNA =
\"CGCATTTTTGCCGGTTTTCCTTTGCTGTTTATTCATTTATTTTAAACGATATTTATAT
CATCGGGTTTCATTCACTATTTTTCTTTTCGATAAATTTTTGTCAGCATTTTCTTTTAC
CTCTTCTTTCTGTTTATGTTAATTTTCTGTTTCTTAACCCAGTCTTCTCGATTCTTATCT
ACCGGACCTATTATAGGTCACAGGGTCTTGATGCTTTGGTTTTCATCTGCAAGAGTCT
GACTTCCTGCTAATGCTGTTCTGTGTCAGGGTGCATCTGAGCACTGATGTGGAGTTTT
CTTGTGGATATGAGCCATTCATAGTGTGGGATGTGCCATAGTTCATG\";
string codon;
cout << \"Enter codon : \" << endl;
cin >> codon;
char exit[] = \"*\";
while(strcmp(codon.c_str(),exit)!=0){
cout << \"Occurances in humanDNA : \"<< endl;
listCodonPositions(humanDNA,codon);
cout << \"Occurances in mouseDNA : \"<< endl;
listCodonPositions(mouseDNA,codon);
cout << \"Occurances in unknownDNA : \"<< endl;
listCodonPositions(unknownDNA,codon);
cout << \"Enter codon : \" << endl;
cin >> codon;
}
}
--------------------------------------------------------------------------------
OUTPUT :
Enter codon :
AAA
Occurances in humanDNA :
3 43
Occurances in mouseDNA :
No occurance
Occurances in unknownDNA :
43 91
Enter codon :
TGC
Occurances in humanDNA :
8 22 31 52 95 141 208 224 248 258 266 310
Occurances in mouseDNA :
269
Occurances in unknownDNA :
8 22 208 224 242 248 266 326
Enter codon :
*
Solution
Please find the required program along with the comments against each line, also find the output
at last :
#include
#include
#include
#include
using namespace std;
void listCodonPositions(string dna, string codon){
vector positions; // holds all the positions that codon occurs within dna
size_t pos = dna.find(codon, 0); // finds the first oc.
Order the steps of the viral life cycle.1. viral entry into host.pdf
Order the steps of the viral life cycle.
1. viral entry into host
2. disassembly of virus
3. replication of virus
4. transcription of virus
5. assembly of new viral units
6. release of new virus
Order these human vaccines by year of introduction from earliest to most recent.
1. Smallpox - 1796
2. plague - 1890
3. tetanus - 1930
4. polio - 1955
5. rubella - 1963
Question 10.
Gamma rays and X rays are ionizing radiations
Question 13.
The disadvantages of intravenous injection for drug administration are:
Risk of overdose
Risk of infection
Solution
Order the steps of the viral life cycle.
1. viral entry into host
2. disassembly of virus
3. replication of virus
4. transcription of virus
5. assembly of new viral units
6. release of new virus
Order these human vaccines by year of introduction from earliest to most recent.
1. Smallpox - 1796
2. plague - 1890
3. tetanus - 1930
4. polio - 1955
5. rubella - 1963
Question 10.
Gamma rays and X rays are ionizing radiations
Question 13.
The disadvantages of intravenous injection for drug administration are:
Risk of overdose
Risk of infection.
Listing of the type of alleles present in an organisms cellGenotyp.pdf
Listing of the type of alleles present in an organisms cell
Genotype
The allele for polydactylism (extra finger or toe) is expressed to different digrees in different
individuals that have it
Variable expressivity
Height in humans is determined by the interaction of genes on different loci
Polygenic inheritance
Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB
Codominance
All the genes in a cell of organism
Genome
Solution
Listing of the type of alleles present in an organisms cell
Genotype
The allele for polydactylism (extra finger or toe) is expressed to different digrees in different
individuals that have it
Variable expressivity
Height in humans is determined by the interaction of genes on different loci
Polygenic inheritance
Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB
Codominance
All the genes in a cell of organism
Genome.
An Operating System (OS) is an interface between a computer user and.pdf
An Operating System (OS) is an interface between a computer user and computer hardware. An
operating system is a software which performs all the basic tasks like file management, memory
management, process management, handling input and output.
The kernel is a used for operating system need to be protected from user programs to maintain
the proper operation of the computer system .The kernel is a computer program that constitutes
the central core of a computer\'s operating system. It has complete control over everything that
occurs in the system.As such, it is the first program loaded on startup, and then manages the
remainder of the startup, as well as input/output requests from software, translating them into
data processing instructions for the central processing unit.
kernel is usually loaded into a protected area of memory, which prevents it from being
overwritten by other, less frequently used parts of the operating system or by applications. The
kernel performs its tasks, such as executing processes and handling interrupts, in kernel space,
whereas everything a user normally does, such as writing text in a text editor or running
programs in a GUI, is done in user space. This separation prevents user data and kernel data from
interfering with each other and thereby diminishing performance or causing the system to
become unstable.
Solution
An Operating System (OS) is an interface between a computer user and computer hardware. An
operating system is a software which performs all the basic tasks like file management, memory
management, process management, handling input and output.
The kernel is a used for operating system need to be protected from user programs to maintain
the proper operation of the computer system .The kernel is a computer program that constitutes
the central core of a computer\'s operating system. It has complete control over everything that
occurs in the system.As such, it is the first program loaded on startup, and then manages the
remainder of the startup, as well as input/output requests from software, translating them into
data processing instructions for the central processing unit.
kernel is usually loaded into a protected area of memory, which prevents it from being
overwritten by other, less frequently used parts of the operating system or by applications. The
kernel performs its tasks, such as executing processes and handling interrupts, in kernel space,
whereas everything a user normally does, such as writing text in a text editor or running
programs in a GUI, is done in user space. This separation prevents user data and kernel data from
interfering with each other and thereby diminishing performance or causing the system to
become unstable..
Internal Evidence General.pdf
Internal Evidence General Ledger Files canceled Payrolled
Checks Payroll time records Receiving Reports Minutes of the Board of
Directors Cancelled Notes Payable
External Evidence Vendors Invoices Bank Statements
Purchase Requisitions Remittance Advices Signed Leased Agreements
Duplicate Copies of bills of Lading Notes Receivable
External Evidence are more reliable than the internal evidences because External evidences
are the evidences which we gets from the third party there is no involvement of the
management or employee of the organisations. Internal Evidences are prepared internally
within the organisation and the chances of manipulation in internal evidences are more than
the external evidences.
Solution
Internal Evidence General Ledger Files canceled Payrolled
Checks Payroll time records Receiving Reports Minutes of the Board of
Directors Cancelled Notes Payable
External Evidence Vendors Invoices Bank Statements
Purchase Requisitions Remittance Advices Signed Leased Agreements
Duplicate Copies of bills of Lading Notes Receivable
External Evidence are more reliable than the internal evidences because External evidences
are the evidences which we gets from the third party there is no involvement of the
management or employee of the organisations. Internal Evidences are prepared internally
within the organisation and the chances of manipulation in internal evidences are more than
the external evidences..
In reaction # 3 either the cis or trans diol may .pdf
In reaction # 3 either the cis or trans diol may be used as a reactant. These isomers
are rapidly interconverted under the rearrangement conditions, indicating that the initial water
loss is reversible; a result confirmed by isotopic oxygen exchange. The clear preference for a
methylene group shift versus a methyl group shift may reflect inherent migratory aptitudes, or
possibly group configurations in the 3º-carbocation intermediate. In the conformation shown
here both methyl and methylene groups may shift, or an epoxide ring may be formed reversibly.
An alternative chair-like conformation having an equatorial methyl group should be more stable,
but would not be suitable for a methyl shift. The predominant ring contraction is therefore
understandable. Reaction # 4 is an unusual case in which a strained ring contracts to an even
smaller ring. Phenyl groups generally have a high migratory aptitude, so the failure to obtain 2,2-
diphenylcyclobutanone as a product might seem surprising. However, the carbocation resulting
from a phenyl shift would be just as strained as its precursor; whereas the shift of a ring
methylene group generates an unstrained cation stabilized by phenyl and oxygen substituents.
Conjugative stabilization of the phenyl ketone and absence of sp2 hybridized carbon atoms in the
small ring may also contribute to the stability of the observed product. Finally, reaction # 5
clearly shows the influence of reaction conditions on product composition, but explaining the
manner in which different conditions perturb the outcome is challenging. Treatment with cold
sulfuric acid should produce the more stable diphenyl 3º-carbocation, and a methyl group shift
would then lead to the observed product. The action of a Lewis acid in acetic anhydride, on the
other hand, may selectively acetylate the less hindered dimethyl carbinol. In this event the
acetate becomes the favored leaving group (presumably coordinated with acid), followed by a
1,2-phenyl shift. It is reported that the symmetrically substituted isomeric diol (drawn in the
shaded box) rearranges exclusively by a methyl shift, but the configuration of the starting
material was not stated (two diastereomers are possible). Because of the influence of other
factors (above), it has not been possible to determine an unambiguous migratory order for
substituents in the pinacol rearrangement. However, some general trends are discernible.
Benzopinacol, (C6H5)2C(OH)C(OH)(C6H5)2, undergoes rapid rearrangement to
(C6H5)3CCOC6H5 under much milder conditions than required for pinacol. Indeed, it is often
the case that phenyl or other aromatic substituents adjacent to a forming carbocation will
facilitate that ionization in the course of their migration to the cationic site. In non-aromatic
compounds of the type (CH3)2C(OH)C(OH)RCH3, migration of R increases in the manner R =
CH3 < R = C2H5 << R = (CH3)3C. Since the shifting alkyl group must carry part of the overall
positive charge, alkyl substit.
Intermolecular forces exist between molecules and.pdf
Intermolecular forces exist between molecules and influence the physical
properties. We can think of H2O in its three forms, ice, water and steam. ... However, the
physical properties of H2O are very different in the three states.
Solution
Intermolecular forces exist between molecules and influence the physical
properties. We can think of H2O in its three forms, ice, water and steam. ... However, the
physical properties of H2O are very different in the three states..
H2 concentration will decrease and H2O concentrat.pdf
H2 concentration will decrease and H2O concentration will increase
Solution
H2 concentration will decrease and H2O concentration will increase.
More from rdtraders2007 (20)
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
You can think of H as being heat energy added ( + ), or heat removed.pdf
You can think of H as being heat energy added ( + ), or heat removed.pdf
wait, i am posting the solution.Solutionwait, i am posting the.pdf
wait, i am posting the solution.Solutionwait, i am posting the.pdf
There are many other contributing factors to the norms of culture th.pdf
There are many other contributing factors to the norms of culture th.pdf
Thermal dimorphism is the capacity to form different structures at d.pdf
Thermal dimorphism is the capacity to form different structures at d.pdf
The prime factor of 210=2357 Anyways, numbers can only be divid.pdf
The prime factor of 210=2357 Anyways, numbers can only be divid.pdf
The OSI Reference Model layers, in order from top to bottomD. Appl.pdf
The OSI Reference Model layers, in order from top to bottomD. Appl.pdf
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf
slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf
Question not visible. Please update the question and then i can answ.pdf
Question not visible. Please update the question and then i can answ.pdf
Please find the required program along with the comments against eac.pdf
Please find the required program along with the comments against eac.pdf
Order the steps of the viral life cycle.1. viral entry into host.pdf
Order the steps of the viral life cycle.1. viral entry into host.pdf
Listing of the type of alleles present in an organisms cellGenotyp.pdf
Listing of the type of alleles present in an organisms cellGenotyp.pdf
An Operating System (OS) is an interface between a computer user and.pdf
An Operating System (OS) is an interface between a computer user and.pdf
In reaction # 3 either the cis or trans diol may .pdf
In reaction # 3 either the cis or trans diol may .pdf
Intermolecular forces exist between molecules and.pdf
Intermolecular forces exist between molecules and.pdf
H2 concentration will decrease and H2O concentrat.pdf
H2 concentration will decrease and H2O concentrat.pdf
Recently uploaded
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
CACJapan - GROUP Presentation 1- Wk 4.pdf
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Assessment and Planning in Educational technology.pptx
In an education system, it is understood that assessment is only for the students, but on the other hand, the Assessment of teachers is also an important aspect of the education system that ensures teachers are providing high-quality instruction to students. The assessment process can be used to provide feedback and support for professional development, to inform decisions about teacher retention or promotion, or to evaluate teacher effectiveness for accountability purposes.
How to Manage Your Lost Opportunities in Odoo 17 CRM
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...Nguyen Thanh Tu Collection
https://app.box.com/s/y977uz6bpd3af4qsebv7r9b7s21935vdclinical examination of hip joint (1).pdf
described clinical examination all orthopeadic conditions .
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)Academy of Science of South Africa
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.Advanced Java[Extra Concepts, Not Difficult].docx
This is part 2 of my Java Learning Journey. This contains Hashing, ArrayList, LinkedList, Date and Time Classes, Calendar Class and more.
The History of Stoke Newington Street Names
Presented at the Stoke Newington Literary Festival on 9th June 2024
www.StokeNewingtonHistory.com
PCOS corelations and management through Ayurveda.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
Natural birth techniques - Mrs.Akanksha Trivedi Rama UniversityAkanksha trivedi rama nursing college kanpur.
Natural birth techniques are various type such as/ water birth , alexender method, hypnosis, bradley method, lamaze method etcRecently uploaded (20)
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
Liberal Approach to the Study of Indian Politics.pdf
Liberal Approach to the Study of Indian Politics.pdf
Film vocab for eal 3 students: Australia the movie
Film vocab for eal 3 students: Australia the movie
Assessment and Planning in Educational technology.pptx
Assessment and Planning in Educational technology.pptx
How to Manage Your Lost Opportunities in Odoo 17 CRM
How to Manage Your Lost Opportunities in Odoo 17 CRM
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
Digital Artefact 1 - Tiny Home Environmental Design
Digital Artefact 1 - Tiny Home Environmental Design
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance.pptx
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
BasicPizza.javapublic class BasicPizza { String type; String c.pdf
- 1. BasicPizza.java public class BasicPizza { String type; String crust; String ingredients; double cost; public BasicPizza(String type) { super(); this.type = type; } public String getType() { return type; } public void setType(String type) { this.type = type; } public String getCrust() { return crust; } public void setCrust(String crust) { this.crust = crust; } public BasicPizza() { super(); } public String getIngredients() { return ingredients; } public void setIngredients(String ingredients) { this.ingredients = ingredients; } public double getCost() { return cost; } public void setCost() {
- 2. this.cost = 5; } @Override public String toString() { return "BasicPizza [type=" + type + ", crust=" + crust + ", ingredients=" + ingredients + ", cost=" + cost + "]"; } } ________________________________________________________________________ LiFiCheese.java public class LiFiCheese extends BasicPizza{ private String crust; private double cost; private String ingredients; public LiFiCheese() { super("Cheese"); this.cost=5; } public void setCrust() { this.crust="thin"; } public String getCrust() { return crust; } public double getCost() { return cost; } public void setCost(double cost) { }
- 3. public String getIngredients() { return ingredients; } public void setIngredients(String ingredients) { this.ingredients = ingredients; } @Override public String toString() { System.out.println("You Ordered :"); System.out.println(getType()); setCrust(); System.out.println(getCrust()); System.out.println("Total Cost of :"+getCost()); return ""; } } _______________________________________________________________________ LiFiPizza.java import java.util.Scanner; public class LiFiPizza extends BasicPizza { private String type; private double cost; private String crust; private String ingredients; public LiFiPizza() { super(); this.type = "Meat"; this.cost=5; } public String getType() { return type;
- 4. } public void setType(String type) { this.type = type; } public double getCost() { return cost; } public void setCost() { this.cost = this.cost+2; } public String getCrust() { return crust; } public void setCrust(String crust) { if(crust.equals("Thin")) { this.crust="Thin"; } else if(crust.equals("Thick")) { this.crust="Thick"; } } public String getIngredients() { return ingredients; } public void setIngredients(String ingredients) { this.ingredients = ingredients; } @Override public String toString() { System.out.println("You Ordered :"); System.out.println(getType()); System.out.println(getIngredients()+"<+$2.00>"); System.out.println(getCrust());
- 5. System.out.println("Total Cost of :"+getCost()); return ""; } } _____________________________________________________________________ LiFiUnit5Ch14.java import java.util.Scanner; public class LiFiUnit5Ch14 { public static void main(String[] args) { BasicPizza bp=null; String typeOfPizza; Scanner sc=new Scanner(System.in); System.out.print("What type of pizza would you like :"); typeOfPizza=sc.next(); if(typeOfPizza.equalsIgnoreCase("Meat")) { bp=new LiFiPizza(); System.out.print("Thin or Thick Crust:"); String crust=sc.next(); bp.setCrust(crust); System.out.print("What ingredient, sorry, only 1 :"); String ingredient=sc.next(); bp.setIngredients(ingredient); bp.setCost(); bp.toString(); } else if(typeOfPizza.equalsIgnoreCase("Cheese")) { bp=new LiFiCheese(); bp.toString(); } }
- 6. } _________________________________________________________________ Output: What type of pizza would you like :Meat Thin or Thick Crust:Thin What ingredient, sorry, only 1 :Sausage You Ordered : Meat Sausage<+$2.00> Thin Total Cost of :7.0 __________________________________________ Output: What type of pizza would you like :Cheese You Ordered : Cheese thin Total Cost of :5.0 _______________________________________________________ Solution BasicPizza.java public class BasicPizza { String type; String crust; String ingredients; double cost; public BasicPizza(String type) { super(); this.type = type; } public String getType() { return type; }
- 7. public void setType(String type) { this.type = type; } public String getCrust() { return crust; } public void setCrust(String crust) { this.crust = crust; } public BasicPizza() { super(); } public String getIngredients() { return ingredients; } public void setIngredients(String ingredients) { this.ingredients = ingredients; } public double getCost() { return cost; } public void setCost() { this.cost = 5; } @Override public String toString() { return "BasicPizza [type=" + type + ", crust=" + crust + ", ingredients=" + ingredients + ", cost=" + cost + "]"; } } ________________________________________________________________________ LiFiCheese.java public class LiFiCheese extends BasicPizza{ private String crust;
- 8. private double cost; private String ingredients; public LiFiCheese() { super("Cheese"); this.cost=5; } public void setCrust() { this.crust="thin"; } public String getCrust() { return crust; } public double getCost() { return cost; } public void setCost(double cost) { } public String getIngredients() { return ingredients; } public void setIngredients(String ingredients) { this.ingredients = ingredients; } @Override public String toString() { System.out.println("You Ordered :"); System.out.println(getType()); setCrust(); System.out.println(getCrust());
- 9. System.out.println("Total Cost of :"+getCost()); return ""; } } _______________________________________________________________________ LiFiPizza.java import java.util.Scanner; public class LiFiPizza extends BasicPizza { private String type; private double cost; private String crust; private String ingredients; public LiFiPizza() { super(); this.type = "Meat"; this.cost=5; } public String getType() { return type; } public void setType(String type) { this.type = type; } public double getCost() { return cost; } public void setCost() { this.cost = this.cost+2; } public String getCrust() { return crust; } public void setCrust(String crust) {
- 10. if(crust.equals("Thin")) { this.crust="Thin"; } else if(crust.equals("Thick")) { this.crust="Thick"; } } public String getIngredients() { return ingredients; } public void setIngredients(String ingredients) { this.ingredients = ingredients; } @Override public String toString() { System.out.println("You Ordered :"); System.out.println(getType()); System.out.println(getIngredients()+"<+$2.00>"); System.out.println(getCrust()); System.out.println("Total Cost of :"+getCost()); return ""; } } _____________________________________________________________________ LiFiUnit5Ch14.java import java.util.Scanner; public class LiFiUnit5Ch14 { public static void main(String[] args) { BasicPizza bp=null; String typeOfPizza; Scanner sc=new Scanner(System.in); System.out.print("What type of pizza would you like :");
- 11. typeOfPizza=sc.next(); if(typeOfPizza.equalsIgnoreCase("Meat")) { bp=new LiFiPizza(); System.out.print("Thin or Thick Crust:"); String crust=sc.next(); bp.setCrust(crust); System.out.print("What ingredient, sorry, only 1 :"); String ingredient=sc.next(); bp.setIngredients(ingredient); bp.setCost(); bp.toString(); } else if(typeOfPizza.equalsIgnoreCase("Cheese")) { bp=new LiFiCheese(); bp.toString(); } } } _________________________________________________________________ Output: What type of pizza would you like :Meat Thin or Thick Crust:Thin What ingredient, sorry, only 1 :Sausage You Ordered : Meat Sausage<+$2.00> Thin Total Cost of :7.0 __________________________________________ Output:
- 12. What type of pizza would you like :Cheese You Ordered : Cheese thin Total Cost of :5.0 _______________________________________________________