SlideShare a Scribd company logo
1 of 59
Download to read offline
An Essay About Environment
Writing an essay on the topic of the environment is no easy task. It requires a deep understanding
of various ecological issues, scientific concepts, and a grasp of the complexities surrounding
environmental challenges. The difficulty lies not only in presenting factual information but also
in conveying a sense of urgency and importance to the reader.
To begin with, researching the latest data and statistics on environmental issues can be time-
consuming. The field is vast, ranging from climate change and biodiversity loss to pollution and
deforestation. Gathering accurate and relevant information is crucial to constructing a well-
informed and persuasive essay.
Organizing the vast amount of information in a coherent and logical manner poses another
challenge. A successful environmental essay should have a clear structure, with each section
flowing seamlessly into the next. Balancing the scientific aspects with the human impact and
societal responsibility requires careful consideration.
Moreover, addressing the complexity of the environmental crisis involves delving into the
political, economic, and ethical dimensions. Understanding the interconnectedness of these
factors and presenting a nuanced perspective adds another layer of difficulty to the writing
process.
Crafting a compelling introduction that captures the reader's attention while introducing the
significance of the topic is a skill in itself. Similarly, concluding the essay with a powerful call to
action or a thought-provoking statement requires finesse.
The language used in an environmental essay should strike a balance between being accessible to
a broad audience and conveying the gravity of the issues discussed. Finding the right tone that
instills a sense of responsibility without overwhelming the reader is a delicate task.
In summary, writing an essay about the environment demands not only comprehensive research
and organization skills but also a deep understanding of the subject matter and the ability to
communicate complex ideas effectively. It is a challenging endeavor that requires dedication and
a genuine passion for environmental issues.
If you find yourself struggling with such assignments, you might consider seeking assistance.
Websites like HelpWriting.net offer a range of writing services, including essays on
environmental topics and much more. Professionals can provide support, ensuring that your essay
meets the required standards and effectively communicates your ideas.
An Essay About Environment An Essay About Environment
The 80s Research Paper
The 1980s are pretty interesting to look back upon in terms of what happened to
the music industry. The decade cradled the beginnings of electronic music and
produced the first commercial compact discs (CDs). At the very least all rock
bands were expected to house a vocalist who could sing notes into the stratosphere
or a virtuosic guitar player who could play at inhuman speeds. Michael Jackson was
reborn as the King of Pop, and Madonna would follow him in her own right. There
was a lot of dancing, a lot of leather, and a lot of Aquanet. This was pop culture, but
the most interesting thing about the 80s didn t happen until 1991, because as far as I
m concerned that s when everything 80s met the guillotine.
In 1991 Nirvana released their breakthrough album Nevermind closely preceded by
the album s defining hit single Smells Like Teen Spirit. The mainstream music
audience wouldn t have heard anything like Nevermind up to the point in time
when it was released on September 24, 1991. It created a schism in pop culture
between decades. Frontman Kurt Cobain was the main creative engine for
Nevermind and the majority of Nirvana s catalog until the band met its end in 1994
due Cobain s death. Understanding Cobain s tendencies as a writer of music, and
where they may have come from, is crucial to understanding why Nevermind is so
different from what came before it.
On more than one occasion Cobain cited The Beatles, and bands in, or stemming
from, the punk rock genre as major
Eating Habits And Culinary Practices
Food ways can be defined as: the eating habits and culinary practices of a people,
region, or historical period. My daily food ways consist of having three main
course meals throughout the day; Breakfast, Lunch, and Dinner. My current food
ways are based off what is available at the Lawrence dining hall and Sykes dining
hall. For breakfast I tend to always have the same foods every day, either being an
omelet, cereal, yogurt with granola, and the occasional banana. Considering being
a college student it s hard to come by a variety of foods you can have for breakfast
especially when you re in a rush to your next class. Lunch has become quite the
difficulty to keep on a regular schedule with my classes all being back to back
during lunch time. But, on the days I do have time for lunch I always have a big
bowl of salad consisting of some leafy greens, onions, celery, carrots, croutons, and
all topped with my favorite dressing balsamic vinaigrette. Dinnertime is my favorite
time of the day to eat because it s right after practice and everyone from the team is
all siting together scarfing down dishes after dishes of foodto replenish our staving
stomachs after a long practice. At dinner time, I always make sure to eat a protein
source and heavy carbohydrate to refuel my body so depending on what is
available I ll always have a wheat Italian sandwich wrap with some pasta. I also
make sure to have some fruit along with a small side salad. At the end of dinner,
depending on the
Relational-Emotive Behavior Therapy Case Study
In the Carl Rogers interview the interactions with the client reflected a person
centered approach which allowed the client to realize that she was responsible for
themselves and was able to make her own decisions. When Gloria began speaking of
her past relationship with her father, I feel the interactions were not dead on with the
client centered approach because this approach normally does not focus on the
causes of the conflict but on the current feelings being experienced. It was interesting
to observe how Gloria expressed her conflict of feeling promiscuous as being outside
of herself, not taking full responsibility for her actions. Okun Kantrowitz (2014)
describes this as individual experiences that remain part of the environment,... Show
more content on Helpwriting.net ...
. . and denying responsibility for their own choices (Moreira, et all, 2011, p. 177).
Perls points out how Gloria projects as being phony, and analyzes her non verbal
communication, making her extremely uncomfortable and defensive with him. Okun
and Kantrowitz (2014) explain her thoughts of being afraid but yet smiling as an
inconsistency between the organism and its environment that create conflict that is,
avoidance of contact and denying negating covering up a present experience rather
than accepting it, and emphasizing what is not present rather than what is present
(134). This orgasmic balance that Gestalt therapy aims to achieve is obtained by
promoting strong feelings which produce the energy to experience the I and thou
of the here and now (Perls, 1965). My observation was that this balance was
achieved when Gloria realized that she was not experiencing fear of Perls, but was
angry with him for now fulfilling her need to be respected and comforted by him.
Her defense levels appear to drop when she realized that he really isn t superior to
her, and he is no different than her in the fact that she could accept him as a child
like herself that could be comforted like a baby. Thus her
Impact Of Technology On Law Enforcement
Law Enforcement and Technology
Introduction
Revolutionary progress in the field of information technology has ushered in
numerous changes in the ways police officers and law enforcement agencies use to
identify, trail and make cases against suspects. Throughout the last century, most of
the technological advances in surveillance by law enforcement revolved around
establishing and enhancing methods of communication: telephones, radio calls and
other emergency communications. In this century, surveillance has become
technological and is real time. The following are some of the latest surveillance
technologies available to law enforcers.
Surveillance Technologies in Law Enforcement
Drones
Unmanned drones have become arguably the most widely ... Show more content on
Helpwriting.net ...
Stingray is a sophisticated, portable device that is able to trail cell phone signals
inside homes, vehicles and even insulated buildings. In this system, Stingray
trackers operate as fake cell towers. This allows law enforcers to pin down the
location of a targeted mobile device by sucking up data such as emails, text
messages and cell site information. Consequently, when a suspect makes a phone
call, the system will trick the cell into sending its signal back to law enforcers,
thereby preventing the signal from travelling back to the individual s wireless carrier.
Stingray is also capable of extracting data off other cell phone users in that location.
Facial Recognition Software In this surveillance system, law enforcers take a
photograph of a person s face and then compare the biometrics to other pictures
stored in a database. If the person s photograph was in the database, there will be a
match. This will enable the officers to identify the person behind the face. This
software has since been incorporated into CCTV surveillance systems in order to
track down suspects in real time. On an individual case, the system can easily be
placed on the back of a smartphone since it weighs only 12.5
Essay Bulimia Nervosa
BULIMIA NERVOSA 307.51 (F50.2)
Introduction
Individuals diagnosed with bulimia nervosa undertake frequent binge eating,
followed by expelling the food, typically by inducing vomiting, but also through
exercising and the use of laxative agents, diuretics, and enemas (American
Psychiatric Association, 2013). The binge eating occurrences are often prompted by
a negative perception of one s body image, temporarily alleviated by the binge eating
episode. Since the individual with bulimia nervosa is overanxious about body weight,
purging of the food is viewed as a necessity. This is in contrast to binge eating
disorder, which does not involve the purging of food after an excess of food
consumption (Bulik et al., 2012). Furthermore, although ... Show more content on
Helpwriting.net ...
There is an additional feature that must be present alongside these symptoms in
order for a patient to be diagnosed with bulimia nervosa: any binge eating events
followed by compensation needs to be relatively frequent. Specifically, if these
events take place at a minimum of one time per week over a 3 month timespan then
a diagnosis of bulimia nervosa may be made. Although these are the symptoms that
must be present in order for a diagnosis of bulimia nervosa to be made, there are
often other symptoms that accompany bulimia nervosa. Signs of psychosis have been
found in patients with eating disorders like bulimia nervosa (Miotto et al., 2010).
Moreover, those with bulimia nervosa frequently have the feeling that there is
something flawed with their mind, and that others are at fault for their problems
(Miotto et al., 2010). In addition, there is evidence that a feeling of loneliness is
correlated with the occurrence of bulimia nervosa (Levine, 2012), highlighting the
psychological dynamics that are at play behind this disorder.
Causes of Bulimia Nervosa: from genetics to environment
The environmental and biological mechanisms that underlie bulimia nervosa have
been researched in some depth. The principle mechanisms that give rise to bulimia
nervosa may be classified into two groups: genetic variables at play and
environmental factors that impact the patient.
There is a considerable body of evidence
Ooiujigvy Ytu Ftyoyugo Y
Critical Writing Packet Harris, REA 095 This purpose of this packet is to aid you
in your Critical Writing Assignments for REA 095. TOPIC: Extra Large, Please Go
to page 636 of your reading textbook and read #3 beneath the topic Extra Large,
Please. This question and essay assignment corresponds to your textbook s Chapter
3 Implied Main Ideas Review Test #2 on pages 113 117. Reread the article Extra
Large, Please by Alice M. Davies. Then, use the following packet to help guide you
through the brainstorming and organizational parts of your essay s prewriting.
BRAINSTORMING: In the space below, write out three notes from the reading that
you found interesting:1. 2. 3. Now consider, What can parents do to encourage their...
Show more content on Helpwriting.net ...
Expresses ideas fluently and gracefully.| Displays clear thinking. Expresses ideas
clearly.| Conveys basically intelligible ideas. Style is bland, pedantic or formulaic|
Conveys simplistic ideas. Lack of vocabulary hinders clarity of expression.| Reveals
confusion or takes an extremely simplistic approach to the prompt.| Demonstrates
confusion or inability to comprehend the prompt.| Thesis Voice Audience|
Demonstrates effective sense of voice, audience and purpose, one that is evident in
such elements as thesis, topic selection and/approach to topic. Discussion is fully
developed and convincing.| Demonstrates adequate and clear sense of voice,
audience and purpose through thesis, topic selection and/or approach. Lacks
sophisticated approach.| Lacks mastery of voice, sense of audience, and/or purpose.
Thesis weak or unclear. Support is weak.| Fails to convey a clear sense of voice or
Chick Fila Essay
CASE 7
CHICK FIL A: BIRD OF A DIFFERENT FEATHER
STRATEGY MANAGEMENT COMPETIVENESS AND GLOBALIZATION,
CONCEPT AND CASES
BY
02/23/2016
Executive Summary.
This case analysis evaluates Chick fil A. It is designed to show the Strength,
weakness, opportunities and threat. It delineates how the founding principles have
guided the company over the years, and how it has responded slowly to change over
the years. CFA has grown to be a force to reckon with in the industry with strength in
customer experience and sandwich trademark. However, the emerging markets, social
changes, economic issues and intense rivalry will continue to pose threat to this
strong cultured company. At the end of the case analysis, we would have been able to
... Show more content on Helpwriting.net ...
He demanded enduring loyalty among customers and customers. CFA s customers
spans through the entire population spectrum, however, it focuses on family. The
high expectations by CFA are obviously because of the need to preserve the
founding heritage and culture. As CFA strives to be the best quick service restaurant
, key external factors affect CFA. Demographics is a major threat, this includes race,
age and gender. CFA is family oriented and believes in marriage, but a comment he
made on this issue earned him a bad publicity. However, that created an opportunity
in the Christian community. Despite the harm of this factor, revenue went up same
year. His adherence to his principles proved to people that CFA would not downplay
its core values. Another threat are rivalry and intense competitors. The industry is a
120 million dollar industry with about 50 percent offering the hamburger entrees.
(hoovers.com 2008). Some of these competitors are KFC, Subway, Burger King,
McDonalds and Taco Bell. New entrants is a threat to CFA, example is Oporto who
just made its way into the United States. There is also the threat from substitutes.
Since Sundays are off days for CFA, customers will like to look for substitutes, and
if rivals provided them, this might affect CFA. Example of substitute from rival is
McDonalds southern chicken sandwich which in fact can come with biscuit and
pickles in the morning. The crave for
Sydney Olympic Park Proposal Essay
This project aims to analyze The GPT Group s masterplan proposal for the Central
Precinct of Sydney Olympic Park. An initial compliance study indicated how the
proposal responded to the broader objectives of the Sydney Olympic Park Authority
and the specific objectives of the Master Plan 2030 for the Central Precinct. A gap
analysis was then undertaken for the proposal s compliance with the Living
Community Challenge. From the results of the gap analysis, design and
programming recommendations were made. Overall, this project outlines
recommended changes for how GPT can achieve a masterplan that maximizes
sustainability, is prepared to achieve Living Community Challenge certification, and
ultimately positions itself as a world s best practice... Show more content on
Helpwriting.net ...
FSC Certification for Timber
Insulating Panels
Made From Recycled Glass
Reduces thermal loads losses
Less Energy consumption
On Site Water Treatment
To reduce strain on storm water system
Micro Collectors
Reduce need for community supply
Greywater Separation
For agricultural and sanitary use
Microgeneration of Solar Energy
Panels also provide shading
Off Setting peaks
Production and Demand
CREATE SHARING COMMUNITIES
+ FAIR ACCESS TO NATURAL RESOURCES
Communal use of energy inside the precinct and adjacent communities
NET POSITIVE ENERGY Programs.
Communal use of water resources inside the precinct and adjacent communities
NET POSITIVE WATER Programs.
Key features of development and their impact, include sustainability summary (is it
truly sustainable, why/why not?)
Recommendations for Certification level *Must decide if we are doing Living
Community Certification or Petal Community Certification
How can it become a blueprint for future projects?
RESILIENCE
REDENSIFICATION OF BUILDING HEIGHTS:
Bring natural light to the central public areas in Ground floor
Less height and more floor area
Grow horizontally
Less overshadow for neighboring
1800s Factory System
During the 1800s, industrialization was the sole purpose everywhere in Europe.
Industrialization was the reason for pushing forwards. Industrialization has led to
what we live in today in the twenty first century it also had many downsides. The one
major fault was the introduction to the factory system. The factorysystem was created
in order to speed up the production of goods. It made productivity skyrocket and the
output of goods increased as well. The factory system that was implanted decades
ago is still in place to this very day. Production finally was able to become large
scale everywhere in the nation. The use and implementation of the factory system
was inevitable. The public quickly realized the effects of the factory system and...
Show more content on Helpwriting.net ...
It created this culture of treating workers unfairly and unjustly. A culture that is
okay to treat workers the way John Wright displayed how kids were treated. It
created a culture of sending kids to work at a young age where it is unsafe and not
healthy. A culture of long work days and weeks in which it puts people in pain.
This really shows how great the serration each class faced. The factory workers
were made up of the lower class. That was the only job people could find. The rich
were the factory owner in which they only had to receive the benefits of the labour.
This shows how the social structure in the 1800s was but that same aspect of the
difference between the lower and upper class never truly changed. This culture
that was created has seeped through the nineteenth century up until now. There is
still to this day a gap between the lower and upper class. Now it is easier to get out
of but there is still a gap. Lower class people like teacher are treated more fairly
now and have unions but are still not treated as well as other higher paying jobs.
Teachers are paid little to none compared to others but they are pessary for educating
people. This is exactly the same for factory workers. They were paid little to nothing
but without them, industrialization would not have been able to happen or it would
not have been able to reach the scale it
Police Relations with Minority Ethnic Communities Essay
Police Relations with Minority Ethnic Communities
The Macpherson report was published in 1999 amidst problems of racial inequality
and a lack of faith in the police amongst minority ethnic communities. There is an
ongoing debate on whether Macpherson s report was a help or a hindrance with
regards to minority ethnic relations and the police; it is this dispute that the essay
shall examine. To begin with the paper will look at the problems, which existed
prior to Sir William Macpherson s publication and which led to the publication of
his report. It will then proceed to examine the failures of the Scarman report, in
order to look at both the prior problems and failures regarding the 1981 Scarman ...
Show more content on Helpwriting.net ...
The Bradford riots in 1995, and other public outcries showed the growing
animosity that was being felt toward the police by minority ethnic communities.
Another factor, which led the opinions of minority ethnic citizens of the police to
become additionally hostile, is the ever advancing statistical and research evidence
of racism within the police force. In 1978 Stuart Hall et al showed most clearly
how, largely on the basis of pre existing stereotypes minority ethnic people (in
particular black people) were being criminalized and subjected to extraordinary
policing and punishment. Both these factors increased the feelings of hatred for
the police amongst minority ethnic communities. This was then furthered by the
subsequent failings of the Scarman report. These included his failure to explain
properly in his report the main reason why black people were so angry with the
police this was to do with the oppressive policing that they were being subjected to.
He was unsuccessful in looking at police powers (particularly stop and search)
(Bridges 1982, Howe 1988 cited in Bowling et al 2002) and most importantly he
failed to take a proper account of institutional racism . Consequently because of the
growing
Unit 2 TASK 1 Decoding the Jargon
TASK 1: Decoding the Jargon
a. Create a booklet which explain the function of hardware components and identify
communication between components. The pages should include photographs and
diagrams to illustrate the information you include. (P1)
Components communication
The following diagram shows how components communicate each other s.
CPU
Also known as the processor, the CPU is the heart of the computer and has two part:
Control Unit
The control unit controls the flow of data through the processor.
Arithmetic/Logic unit (ALU)
The ALU performs mathematical, logical, and decision operations in a computer and
is the final processing performed by the processor.
RAM
A computer can only run a program when it is in memory ... Show more content on
Helpwriting.net ...
DOS is the basic system that people have to using Command line prompt to
communicate with computer via simple interface which is not friendly user interface.
The DOS can t run multitask on computer which can only load one program until it
finished. But some of the features still quite useful that people still use it. Such as:
5. CHKDSK
6. GBUPDATE
7. IPCONFIG
8. PING
9. FDISK
Comparison of two operating systems
We can see there are many different between those two computer operating system
which the Windows 8 operating system have a lots of advance features and higher
performance that suit to nowadays. The DOS system usually used to be run a
specific program which prevents any virus or hacker attack in the solo computer
such as sale program, data base in the hospital or council data base.
Features
Windows 8
DOS
Network
Yes
N/A
GUI
Yes
N/A
Multiuser
Yes
N/A
Server Administration
Yes
N/A
Command line interface
Yes
Yes
Entertain
Yes
N/A
Sound
Yes
Yes
Multitask
Yes
N/A
c. In your document explain the purpose of different software utilities which is
available. Explain how software utilities can improve the performance of computer
systems (P3, D1)
Windows 8 Utility
Virus Protection
The specific program used to prevent viruses, worms and Trojans which attached in
the email or website.
Every computer need to install an anti virus software and
Hans Albert Einstein And The Life Of Albert Einstein
Albert Einstein was born to secular Jewish family in Ulm, Germany on March 14,
1879. Einstein is best known for the development of the theory of relativity, a major
structure of physics. However, before he became this revered figure in science,
Einstein worked at a patent office in Bern, Switzerland where he developed his first
scientific theories. Much of his work at the patent office presented questions about
transmission of electric signals and electrical mechanical synchronization of time,
two technical problems that eventually led Einstein to his revolutionary conclusions
about the nature of light and the fundamental connection between space and time.
While attending college at the Swiss Federal Polytechnic, Einstein met Mileva Maric,
with whom he developed a close relationship with. In January 1903, Einstein married
Maric, and they later had two children. The first son, Hans Albert Einstein, born in
Bern, Switzerland, and the second, Eduard Einstein, born in Zurich July 1910.
Einstein and Mileva are believed to have had their first child in 1902, a daughter
they named Lieserl, who is believed to have either been given up for adoption or
died of scarlet fever. Hans later went on to become a professor of Hydraulic
Engineering at the University of California, Berkeley, and received honorable
recognition for his research regarding sediment transport. Eduard studied medicine in
hopes of becoming a psychiatrist, but unfortunately suffered a breakdown, which led
to the
A Look at Myelin and Myelin-Related Disorders Essay
A Look at Myelin and Myelin Related Disorders
Myelin is the protective sheath around axons in the nervous system, and is often
referred to as white matter. It acts as an insulator to the electrical signal that is
conducted down the axon as a neuron fires, and can well be compared to the
insulation around an electrical wire. The myelin sheath contains a variety of fatty
substances (lipids), and contains at least ten distinct chemicals (2). . From what is
known, axons are not fully myelinated at birth, but myelin is formed from birth on
into the second decade of life (3). The way myelination takes place is through glial
cells wrapping around the axons in a spiral fashion. The axons are originally
embedded in these glial cells, and the ... Show more content on Helpwriting.net ...
After patches of myelin are taken off the axon, oligodendrocytes repair the damage,
but in the process cause scar tissue (gliotic plaques). These hard plaques then begin to
interfere with the flow of electrical impulses that move through the axon (6).. In most
cases, the disease is characterized by alternating phases of relapsing and remission,
where the remission phases get increasingly shorter. The symptoms include spasticity,
double sightedness (diplopia), and an unsteady gait (5).. This may suggest that it is
not the case that myelin in the CNS in general is targeted, but that rather myelin in
specific regions is affected. In case of the symptoms above, we might suspect
demyelination of some motor neurons, or neurons related to the function of the visual
cortex.
The second group of demyelinating diseases,hereditary metabolic disorders, are
degenerative diseases and include, among others, the eight identified
leukodystrophies (5). Here, leuko means white , and refers to the white matter
(myelin sheaths) of the central nervous system, and dystrophy means imperfect
growth or development (2).. The majority of the leukodystrophies are storage
disorders, where the absence or malfunctioning of an enzyme results in the toxic
accumulation of chemical substances (5) In each of the so far identified
leukodystrophies only one of the
Physical Description Of The Piazza Del Campo In Siena,
Italy
Introduction During the Late Middle Ages town squares and piazzas were starting to
become more common around the world for the purpose of getting people together
and entertainment. It can be argued that Piazza del Campo in Siena, Italy is the most
influential example of these types of structures. The Piazza del Campohelped the
advancement of the Medieval piazzas, by incorporating different materials and
design elements while still reflecting their original style of design. The typology of
this site is a civic space and a space for entertainment. This paper will describe the
Piazza del Campo and provide a historical view of the piazza in the way of its
cultural form. This paper will first talk about its physical description, it will explore
topics such as the structure, decorative aspects and materials used. After talking about
the physical description, the historical context of the Piazza will be discussed, as well
as the principles of deign which will include the form, function, environmental
context and social context. The Piazza del Campo acted as a precedent for art,
architecture and town planning. Physical Description
Figure 1: Plan of Piazza del Campo, showing the open space and its conventional
shape.
The structure of the Piazza del Campo demonstrates the Gothic, Romanesque and
renaissance architectural styles of the Late Middle Ages. The piazza is located at the
center or the Heart of Siena, Italy (Centre, U.W, n.d.). It is situated between Siena
Town Hall
I M the King of the Castle
I am the King of the Castle The novel begins on a deathly note. Three months
before the main events of the story, the grandmother of the Hooper household dies.
Her son Joseph then refuses to live at Warings, the family home, until he owns it,
i.e. until his father dies and he inherits it. This tells the reader knows immediately
that the relationship between Joseph and his father is poor. Soon afterwards it b
ecomes clear that the relationship he has with his own son is no better.
Communication between Joseph and Edmund Hooper is limited and a cause of
some concern to Joseph. Edmund s mother died six years previously. This has not
made him sensitive to death, and on seeing his dying grandfather he remarks coldly,
All he looks like is one... Show more content on Helpwriting.net ...
The crow is gone when he comes back from the bathroom in the morning. Nothing
is ever said about the incident. Hooper actually feels impressed that Kingshaw kept
his cool, but becomes even more determined to find ways to get to him. His next
move is to take him to the Red Room. Kingshaw finds the moths and smell of
preservatives oppressive and is reluctant to enter. When he finally does go in,
Hooper runs out and locks the door. Kingshaw tries to escape via the windows but
they are locked so he can t get out; he is on the edge of panic. He finally escapes
when the adults find him. He makes excuses and runs away quickly without telling
on Hooper. He is violently sick in the bathroom. Despite the signs, the adults don t
notice that anything is wrong and think the boys are becoming friends. At this
stage Kingshaw is finding life at Warings intolerable. He longs for his school,
where he is happy and comfortable. Chapter Four Hooper goes on a daytrip to
London with his father. Joseph attempts to deliver a stern speech, and is insistent
that Hooper should make more effort to befriend Kingshaw. His son listens silently
but continues to plan ways to inflict further terrors. Meanwhile back at Warings,
Kingshaw finds a room on the top floor to hide away in. He likes the room because
it doesn t seem to belong to anyone. Amazingly, he manages to keep his
The Oil Major Of Mexico
Houston is one of the most active energy exporters in the United States and home to
over 300 petroleum refineries, and over 200 private oil companies. Technological
innovation has led to major developments in the upstream energy exploration and
production and, as a result, has evolved into rapid business growth locally. Although
this has seemingly boosted market capital and broadened energy output in domestic
markets that didn t exist a century ago, nationalized foreign oil dependency still
represents one of the top aggregate forces influencing current domestic energy. This
can be examined in recently the approved Mexican constitutional changes that are
opening up the energy sector to private and foreign investment. PEMEX, the
premier oil major of Mexico, has been troubled recently by its declining oil supply
and reserves. Plagued by illegal activity near its plants, and internal corruption,
PEMEX turned to the Mexican government for legislative reform in energy trade
with the hopes that it will help bolster its position in North American markets. The
opening of Mexico s oil industry is expected to increase energy trade and open new
opportunities for U.S. companies and those who are already invested in the upstream
infrastructure and oil field services. If this legislation reform influences growth and
investment in Mexico, it will help Mexico compete in the North American energy
market, and ultimately affect the Houston economy.
Chemical Kinetcs – the Hydrolysis of Pna Ester
Chemical Kinetcs The hydrolysis of PNA Ester
Introduction: Reaction of a compound with water can result in a splitting, or lysis,
of the compound into two parts. Organic molecules containing a group of atoms
called an ester can be hydrolyzed by water to form a COOH group (carboxylic acid)
and an HO group (alcohol) as follows:
RCOOR + H2O ( RCOOH + HOR
This reaction is spontaneous for almost all esters but can be very slow under typical
conditions of temperature and pressure. The reaction occurs at a much faster rate if
there is a significant amount of base (OH ) in the solution. In this lab experiment, the
rate of this reaction will be studied using an ester called para nitrophenyl acetate
(PNA), which produces an alcohol, ... Show more content on Helpwriting.net ...
|Table 1 |
|Varying Exp |Test Tube|PNA [45mg/0.5L] |(PO4)3 Buffer| |H2O |Catalyst | | | |
|1.5x[PNA] |2 |3 |7 |2 |0 | | | | |
|1/2 [PNA] |3 |1 |7 |2 |2 | | | | |
|Imidazole |4 |2 |7 |2 |0 |Imidazole |0.025 |1 |0.005 |
|Super (10x) Imidazole|5 |2 |7 |2 |0 |Super (10x) Imidazole|0.25 |1 |0.05 |
|2 Me. Imid. |6 |2 |7 |2 |0 |2 Me. Imid. |0.025 |1 |0.005 |
|4 Me. Imid. |7 |2 |7 |2 |0 |4 Me. Imid. |0.025 |1 |0.005 |
|Acidic pH 6.5 |8 |2 |6.5 |2 |1 | | | | |
|Basic pH 7.5 |9 |2 |7.5 |2 |1 | | | | |
|Basic pH 8.0 |10
An Investigation Based On The Arrhenius Law
INTRODUCTION
This investigation is based on the Arrhenius law, A formula created by Professor
Svante Arrhenius that combines the Boltzmann distribution law with the concept of
activation energy (Stephen Lower 2011a) to depict one of the most important
relationships between temperature and rate of reaction in chemistry to date. In the
formula,
K = e ≈ 2.71828
A = Arrhenius constant = Activation Energy
RT = Average kinetic energy (Universal gas constant Г
— Temperature in Kelvins) In
this experiment, the main focus is placed on the Arrhenius plot, which is derived
through the manipulation of the Arrhenius equation to remove its exponential form
by taking the natural log of both sides of the equation which forms lnk=lnA E_A/RT A
... Show more content on Helpwriting.net ...
This topic appealed to me, as it seemed like a sound concept in theory, but could not
find any discussion based on using the Arrhenius plot for physical processes.
BACKGROUND INFORMATION
2.1 Sublimation; an endothermic process
Sublimation is the term describing the transition of a substance from the solid phase
to the gas phase without passing through an intermediary liquid phase. (Anne Marie
Helmenstine 2014a) It is a physical change of state, which occurs at temperatures
and pressures below the triple point of the substance, the point where the temperature
and pressure causes the 3 phases: solid, liquid and vapour, of a single component
system to be in equilibrium. (Blackwell Scientific Publications Oxford 1997) This
definition shows that sublimation is a purely physical process; so a substance does
not undergo a chemical reaction during sublimation.
This diagram represents a typical endothermic reaction: Fig. 2: Endothermic reaction
enthalpy change (hferrier n.d.)
As displayed in figure 2, a substance requires kinetic energy greater or equal to its
activation energy in order for it to change from its initial form to its product. The
activation energy shown is one of the pathways that a reaction takes with respect to
the pressure that it is subjected to. Consider that for a substance to change from its
solid phase to its gas phase the bonds are all fixed in a position and when the
particles have enough energy, they are able to
Wound Infection
2.1.1.Most common pathogenic strains that cause wound infection
The most common pathogenic strains that cause wound infection is Staphylococcus
aureus (35%), Escherichia coli (15%), Pseudomonas aeruginosa (13%) and other
bacteria (37%) (Amit Kumar Gupta et al., 2015). In another study, Staphylococcus
aureus has been reported as the major cause of wound infection with (24.2%),
followed by Pseudomonas aeruginosa (21.4 %), Escherichia coli (14.8 %) and
another different organism (39.6 %) (Jyoti Sangwan et al., 2016). Staphylococcus
aureus (Methicillin Resistant Staphylococcus aureus) is gram positive bacteria and
can be a lethally opportunistic pathogen or human commensal, it is one of the leading
organisms causing a variety of hospital acquired infection and community acquired
infection (Brown et al., 2014). S. aureus has ... Show more content on Helpwriting.net
...
S. aureus responsible for 70% skin infection in children, moreover, the incidence of
skin infection caused by MRSA is in a continuous increasing (Nataraj et al., 2014).
Pseudomonas aeruginosa is gram negative bacteria, it is classic opportunistic
bacteria and are often severe, life threatening and difficult to treat due to it has an
innate resistance to many of antibiotic and disinfection (Bangera D et al., 2015;
Wendell Lou B. Ladion et al., 2015). P. aeruginosa recently acquired significant as
one of the most important organisms that cause nosocomial infection due to having
an ability to survive in hospital environments, in addition, it has the ability to
develop resistance against many antimicrobial agents (Nagoba et al., 2013). Wound
infection caused by P. aeruginosa rapidly deteriorating and lead to systemic spread
and therefore death within days or weeks (Turner et al., 2014). Escherichia coli is
gram negative bacteria and considered as a member of the Enterobacteriaceae, it is
innocuous resident in a gastrointestinal tract, but at the same time has the ability to
cause
Effective Performance Management With The Balanced...
Effective Performance Management with the Balanced Scorecard Technical Report
Writers: Liz Murby Stathis Gould
CIMA CIMA
CIMA gratefully acknowledges the contributions of Gary Ashworth, Philip Barden,
Peter Brewer, Gavin Lawrie, Bernard Marr, Professor Bob Scapens, Dr Mostafa
Jazayeri Dezfuli, and Francesco Zingales. Contact: liz.murby@cimaglobal.com
Copyright CIMA 2005 First published in 2005 by: The Chartered Institute of
Management Accountants 26 Chapter Street London SW1P 4NP Printed in Great
Britain The publishers of this document consider that it is a worthwhile contribution
to discussion, without necessarily sharing the views expressed. No responsibility for
loss occasioned to any person acting or refraining from action ... Show more content
on Helpwriting.net ...
27 7.2 Public sector: Health Action Zone . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . 30 Appendices 1. The value dynamics framework at Dell . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . 35 2. The Business Modelling Approach s if then matrices . . . . . . . . . . .
. . . . . . 36 3. The Business Modelling Approach s implementation questionnaire . . . .
. 37 References and further information sources . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . 38
2
Effective Performance Management
Introduction
To manage and deploy organisational resources in such a way as to deliver and fulfil
organisational objectives is a vital role of senior finance and management
professionals. Many tools, techniques and frameworks have evolved to assist
managers in this: value based management, total quality management, the
performance prism, and more.
This report focuses on one such framework: the balanced scorecard. Of the tools
designed to improve corporate performance, the balanced scorecard has probably
been the most popular. Originally developed as a performance measurement tool, the
scorecard is now associated increasingly with strategy implementation. It acts as a
management framework with the potential to identify and exploit organisations key
value drivers to their best strategic advantage. This report considers the more recent
developments in scorecard thinking, in particular the key role of strategy mapping. It
outlines
General Review of Algorithms Presented for Image
Segmentation
Image segmentation commonly known as partitioning of an image is one of the
intrinsic parts of any image processing technique. In this image pre processing step,
the digital image of choice is segregated into sets of pixels on the basis of some
predefined and preselected measures or standards. There have been presented many
algorithms for segmenting a digital image. This paper presents a general review of
algorithms that have been presented for the purpose of image segmentation.
Segmenting or dividing a digital image into region of interests or meaningful
structures in general plays a momentous role in quite a few image processing tasks.
Image analysis, image visualization, object representation are some of them. The
prime objective of segmenting a digital image is to change its representation so that
it looks more expressive for image analysis. During the course of action in image
segmentation, each and every pixel of the image segmentation is assigned a label or
value. The pixels that share the same value also share homogeneous traits. The
examples can include color, texture, intensity or some other features. Image
segmentation can be defined as the technique to divide the an image f (x, y) into a
non empty subset f1, f2, ...., fn which is continuous and disconnected. This step
contributes in feature extraction. There are quite a few applications where image
segmentation plays a pivotal role. These applications vary from image filtering, face
recognition, medical imaging
Washington, The Man Of The Revolutionary Era
Allison McNamara D Abbene, p.4 American History 8 18 December 2015
Washington, the Man of the Revolutionary Era On February 22nd, 1732, George
Washington was born in Virginia, but little did his parents know that he would
change America forever. George Washington worked hard to raise soldiers spirits
and help them to survive the winter at Valley Forge. He did anything in his power to
get the necessary supplies and best living conditions for his soldiers. George
Washington lead the Culper Spy Ring which was vital in winning the war. In the spy
ring, anonymous spies worked around the clock to find any information that could
give hints to plans of the British. He lead the Continental Army successfully at
Yorktown. He faced many... Show more content on Helpwriting.net ...
From morning until night he taught his army the art of war. He worked as hard as
he could to make sure his soldiers were ready for anything and everything that
could happen on the battle field. But, training his soldiers was not the only thing
that needed to be done. Although the soldiers were making due at the camp,
conditions were far from perfection. He ordered that camp to be laid out in a way
that best fit the soldiers. His instructions were to build a log hut 14 by 16 ft for
every 12 men. He also ordered his men to build a bridge over the Schuylkill River
to resupply his army more efficiently. Washington wanted the best for his troops,
and in order have that he needed help from sources outside of Valley Forge. As
early as September, 1777, Washington contacted Alexander Hamilton to ask for
supplies such as clothes and blankets, which the soldiers were in need of. He
desperately wrote a letter to congress to inform them of the harsh conditions, and
asking them for any supplies that they would give to his troops. He wrote, From
my soul... I pity these miseries, which it is neither in my power to relieve or
prevent (Bruns, 63 64). Washington also sent men on large expeditions to get food
for his soldiers. These men were successful and most likely saved the army. With all
of these efforts combined, his troops supply dilemma eased and they got back on
track for the war. Although the winter was harsh, conditions gradually improved
under the leadership of
The Importance Of Understanding The English Language
In...
An article published by the New York Times, History for dollars by David Brooks,
emphasizes the importance of understanding the English language. He suggests
that you major in English and liberal arts majors instead of accounting or other
majors that might pay twice as well. You will have enormous power if you are the
person in office who can write a clear and concise memo (Brooks). He also states
that you will use the english language in whatever job you find. He thinks that any
business must have people who understand English very well to succeed. You can
have a great product, but someone has to be very good with the language to get
people to buy the product. Studying the humanities will give you a wealth of
analogies (Brooks). Everyone thinks in analogies every day according to Brooks.
Whether it s going to the store and comparing two products or comparing two
colleges everyone makes comparisons. Then Brooks starts to explain The Big
Shaggy, which is a concept he came up with. It consists of ideas that deep down
people have passions that don t lend themselves to systemic modeling. Brooks
suggests people choose systemic modeling because it pays better. Most of america is
very economic based when choosing jobs. That is the reason computer scienceis the
fastest growing major right now. But going into those fields won t get you very far
in the big shaggy. Many people end up not doing well in the idea of the Big
Shaggy. I disagree with a lot of points in this article. I believe the goal of college is
to best prepare you for a future job. If you get a degree in liberal arts, you already
start behind. There is a low demand for jobs that require an English major. They
don t pay well because the amount of jobs is slim, and there is a surplus of people
in that field. The fastest growing majors right now are in the computer field.
Technology is growing exponentially and now everybody is connected to the
internet daily. You don t need to know english that well to make a lot of money.
Most companies now and days aren t even American based. So knowing english isn t
the key to be successful. If you major in a STEM field you will be ahead of most
college students. Every company now has a website and
The Rise Of Honey Bees
Where did all the honey bees go? Honey Bees pollinate crops, and fruits and
vegetables. Crops feed livestock, Humans eat both fruits and vegetables and
livestock. Therefore humans along with all other living things need honey bees. But
where have they all gone? Nationally honeybees are disappearing all over the United
Statesfor many reasons such as pesticides, Colony Collapse Disorder (CCD), and
other issues still being investigated but here in the Chicagoland area the colonies
are dying off due to the freezing weather. Head beekeeper for the Morton Arboretum
and the rooftop hives at the Chicago Marriott, he doesn t want a repeat of last winter
s massacre, when 80 percent of his colonies perished (Lauren Williamson). Bee
keepers here in
Classic Rummy Research Paper
Explore playing, learning and earning with Classic Rummy
If you are free and want to relax in the comfort of your room cuddled up in a
blanket and also want the thrill and experience of winning real money by just
playing a game, then try free online rummy just once. Anyone can bet that you will
be glued to it for the life time; such is the charm of this traditional amazing game
that has now gone online and can be played with anyone at any time of the day in
the world. The mobile version is easily downloadable free on your smart phone so
even if you are travelling or has some time to spare in between work, you would
never want to lose a chance to play and win cash.
There are many online rummy game sites and all of them boast of safe cash
transactions,
Essay On The Colony Of Virginia
The colony of Virginia was founded by a stock company: the Virginia Company. To
attract people Virginia made a wonderful charter. Emigrants who paid their own way
to Virginia got fifty acres of land. There would not be mere tenants. Civil authority
would control the military. A council of burgesses, representatives chosen by the
inhabitants of the colony for their government, would be convened as the House of
Burgesses. The governor could veto their actions and the company still had overall
control of the venture, but the settlers would have a say in their own government,
including the right of the House of Burgesses to introduce money bills. The King s
court appointed a royal governor, someone who had never set foot on the land of...
Show more content on Helpwriting.net ...
The governor chose six people in the colony to be in his council. The other fifteen
people were chosen by the king because of their family and wealth. In all, there were
twenty two members that attended. All the representatives were English. Each of the
Virginian counties had sent a representative to the house. The first meeting was on
July 30, 1619. It was held in the choir of the church on Jamestown Island. It lasted
for six days, but was cut short by the disease, Malaria. Problems began to strike, like
a massacre from the Native Americans where they killed 400 colonists. As hard as the
government tried to conceal the problems, the king heard about them. He made
virginia a crown colony. The king divided the colony into eight shires. By 1643,
there were 15 shires! Most jobs were simply commanded to people. Only the
representatives got votes to represent. Each shire would send a vote for a
representative to go and work in the House, rather than have it be just rich people.
White men that were seventeen years old or older and owned land were able to vote
for these representatives. In 1652, Oliver Cromwell forced Jamestown to admit that
they had been taken over. However, that did not mean that their
A Research Study On The Stress Hormone And Cortisol
Levels
Well conducted research is essential to the advancement of knowledge. Through poor
research design, incorrect statistical analysis or inappropriate conclusions,
experimenters can conduct virtually useless studies, or worse, call into question the
integrity of researchers. However, analysis of poorly conducted research is essential
to the improvement of the scientific method. Presented shall firstly be a literature
review regarding a growing contemporary body of literature, premised on the
association between stressors, management strategies and cortisollevels. Additionally,
a replication study examining powerful poses and cortisol levels shall be analysed
and critically and constructively evaluated.
Cortisol commonly known as the stress hormone is a steroid hormone regulated by
the hypothalamic pituitary adrenal axis, an interaction of endocrine glands thought to
be crucial in adapting to behavioural and environmental changes. Cortisol effects
many functions within the body, including control of blood sugar levels, regulating
the metabolism, reducing inflammation and assisting in immune responses (Randall,
2010; Shu Fen et al. 2015). The main function of cortisol is to restore homeostasis to
the body following stress, and it is the primary hormone responsible for the stress
response. Fluctuation of cortisol levels throughout the day is normal for humans,
however, sustained high levels of cortisol can have adverse effects. These can include
serious health implications
Direct Marketing Communication Plan for Market Solutions
Direct Marketing Communication Plan for Marketing Solutions
14. INFORMATION NEEDS
Target Markets
At the center of any effective marketing strategy is the ability to define what makes
a service unique and highly valuable to a given target market. When selling services,
which are inherently intangible, the need exists for creating value quickly and with
many forms of tangible proof of expertise sold. When selling information services the
need to generate trust and a strong sense of value has to preclude any long term
purchasing relationship (Laurence, 2001). Market Solutions needs to create a
foundation of trust with the following target markets if their information services
business is going to establish itself and thrive over time.
Trust must be the foundation of the company for it to succeed in the segments it has
chosen. These include automotive, banking, FMCG, food and beverages, hospitality
services and telecommunication services industries. Each of these industries has
unique information challenges or problems, yet all share a common interest in
customer satisfaction analysis. The customer satisfaction analysis service will be
offered to all of these industries, in addition to Ad Tracking. These two services are
foundational for the successful operation of any business and will also serve over
time to create a system of record, or master data management (MDM) platform that
will illustrate each of these industries well. One of the most critical factors of success
The Origins Of Christianity By Najr пїЅпїЅ N
5.2 Origins of Christianity in NajrДЃn
The story of arriving Christianity to NajrДЃn is shrouded by controversy Muslim and
Christian sources. This controversy can be seen in arguing particular issues such as
the approximate date of arrival, the country where Christianity came from and the
first person who evangelised to Christian faith.
For Eastern Christian sources, the oldest date was claimed by Д«bn MattaМЃ (1896),
tells that the Saint Mar Marry, one of the 70th evangelists who spread after the time
Jesus Christ, preached to Christianity in Arab lands, residents of tents, Yemen and
NajrДЃn. Differently, the history of Church introduces other versions of that arrival,
one of them offered by Eusebius (1998), who lived in the first half of the ... Show
more content on Helpwriting.net ...
The Nestorian works, especially the Chronicle of Seert (anonymous, 1907) and
AkhbaМ„r fatМЈaМ„rikat kursiМ„ al Mashriq min KitaМ„b al Majda (Д«bn
SulaymaМ„n, 1899) provide another version for the introduction of Christianity to
NajrДЃn. Both tell that the NajrДЃnite trader called HМЈayyДЃn traveled to the
capital of Byzantium, Constantinople for trade and then he went to al HД«ra
(HД«rat al Nu man), an ancient city in south of Mesopotamia (Iraq), in the reign of
the Sasanian emperor, Yazdegerd I 399 420 AD (ibid). The story states that
HМЈayyДЃn saw how Christians prayed and worshiped and subsequently he
converted to Christianity and had baptized in its church (ibid). After returning to
NajrДЃn, HМЈayyДЃn invited his family and other NajrДЃnites to his religion and
Christianity became spread among many people of NajrДЃn and near HМЈimyarite
regions (ibid: 3).
In addition, there is Abyssinian version for reaching the Christianity to Najran, states
that the priest Azkir could establish new church and baptised 38 Christians in Najran
by the second half of fifth century (Budge, 1928).
For Muslim sources, there are two similar versions of arriving Christianity to
NajrДЃn. In the first, historians such as Ibn IshМЈДЃq (1955), al Mas udi (1981) and
Ibn HishМЊaМ„m (1994) relate that Christianity brought by a Christian ascetic
called FaymiyЕ«n (Phemion), coming from Syria (ShaМ„m) to Arabia for working
as a
Sin, Consequences And Redemption In Le Morte DArthur
The Sin, Consequences, and Redemption of Sir Lancelot Sir Lancelot is the
dominant figure in Le Morte D Arthur who presents us with the theme of sin and
redemption. Sir Agravaine and Sir Mordred expose the courtly romance or otherwise
adulterous affair between Sir Lancelot and Queen Guenever. This sets in motion the
conflicts and other events leading up to the death of Sir Lancelotand many other
noteworthy characters. Sir Lancelot betrays both King Arthurand Queen Guenever. If
he is truly a noble character as Sir Gawaine, Sir Gareth, and Sir Gaheris describe,
would he have involved himself in such a treacherous act? Sir Agravaine says, I
marvel that we all be not ashamed both to see and to know how Sir Launcelot lieth
daily and nightly by the queen, and all we know it so; and it is shamefully suffered
of us all, that we all should suffer so noble a king as King Arthur is so to be
shamed (Location 12810). Sir Lancelot s betrayal raises opposition between the
knights and breaks up that which should remain united. His betrayal reaches beyond
the king and queen. Thus, it is not a surprise that the consequences of his sin affect
the lives of so many. Now, Sir Agravaine and Sir Mordredplot to find Sir Lancelot
and Queen Guenever alone together, while the king is away. The king warns Sir
Agravaine and Sir Mordred, ...he will fight with him that bringeth up the noise, and I
know no knight that is able to match him (Location 12836). With King Arthur s
consent, they gather a
The Fundamental International Charter For Human Rights
The topic of universal human rights is a complex and largely contested area of
international relations. Though often highly regarded in Western states, the notion of
individual rights is highly debatable in other parts of the world. In a struggle to
reconcile regional traditions and world cultures, efforts to create implement a
universally accepted charter of human rightshave met many obstacles. Key issues
including minority groups, gender, and the concept of individuality versus
collectivism make up the many complicated shades of grey within this debate. To
better understand the challenges that the concept of universal human rights faces, it
is necessary to analyse the cultural, religious, and developmental dilemmas that
jeopardise its legitimacy on a global scale.
The foundational international charter for human rights is the United Nation s
Universal Declaration of Human Rights. This declaration adopted in 1948, contains
thirty articles, listing the UN s defined entitlements and rights of human beings.
During the 1993 World Human Rights Conference, the Vienna Declaration and
Programme of Action, stressed that the universal nature of these rights and freedoms
is beyond question. [1] Though it is lauded by many in the UN as universal,
opposition is also widespread. The consensus of Western nations that human rights are
universal has been heavily scrutinised by critics around the world. Such critics often
pose the question of whether human rights can be surmised as
The State Of Student Ministries Essay
The State of Student Ministries I spend a good deal of my time in research. It s
something I feel is important for a person in my position. Some of this research
involves an in depth of scripture for an upcoming lesson. However, a lot of my
research goes into understanding contexts. In Bible College, the first thing they
drilled into our minds was context determines meaning. In the Bible, this means
historical background, the context of the author, the context of the audience, how the
passage relates to other passages around it, how it related to the book it was in, how
it related to scripture as a whole, among other significant trends to analyze. In student
ministry, this means understanding contexts such as, age, developmental stages,
trends in culture, trends in our church, history of our church, trends in the broader
Church, history or the broader Church, language barriers (slang), friendships, family
and parents, technology, the list could really go on and on. Therefore, I study these
things to have a thriving ministry at First Presbyterian Church. I read books,
countless articles, and every two years I go to a National Youth Workers Convention
to be with thousands of other leaders who are going through similar situations within
their ministry. I think we have a tendency to look outward and play a compare game
when analyzing ourselves. This isn t just in church, but in our personal lives as well.
It s why we want the latest and greatest clothing style, vehicle,
Essay on Cruel and Unusual Punishment
The death penalty also known as capital punishment is an execution in which the
person who committed the offence is put to death by the state. It was first practiced
in Jamestown colony, 1608. The person was hanged for spying for the Spanish
government and was the 1st person sentenced to death in America. Since then, it has
been a form to punish the criminals for committing such heinous crimes and putting
end to violence and crime rates. Despite how people agree that the death penalty is
justifiable, however; it still violates the international human rights laws. These laws
were created to protect the lives of all human beings including the criminals, who
some might agree they do not deserve to live. Even though some might say that the...
Show more content on Helpwriting.net ...
Justice can be interpreted in many ways such as being able fair or wanting someone
to suffer for what they did. However, death is not always the solution to every
problem which involves a murder. In the United States alone there are thirty five
states that still have the death penalty while only fifteen states have repealed it. In
the United States, about 13,000 people have been legally executed since colonial
times . How does America respond to this?
The United States is supposed to represent freedom, liberty, and peace. However,
the death penalty contradicts everything the founding fathers built America on.
Everyone is entailed to life even though they commit terrible crimes. Technology
advancements are rapidly growing which is supposed to allow less pain in time of
execution. So far in 2011 there have been eight executions and three more
executions are going to be taken place on March 10, 29 and 31. Many people are
killed by lethal injections, electrocutions, gas chamber, hanging, or a firing squad.
These killing methods are both immoral and unconstitutional because they are
killing the people like animals. This is an endless vicious cycle of murder and
revenge that continues because the people have a desire to get revenge on the
people who killed their loved one. Even thought that loved one will never return and
enjoy life before it was quickly taken away. In the United States there are about 3,230
Death Row inmates
Mudule 11 Case Study Essay examples
Content Page # Executive Summary 2
Analysis3 7
Annexure8
Bibliography8
Executive Summary
The report includes the summary of Lanka Fashion Leather Products Company
(company) which was successfully operating for several years having about 150
employees without any trade Union (TU) activities. The Issue arose when 75% of
the work force formed a branch Trade Union of a registered TU sponsored by a
political party. After two formal requests sent by the TU to the management,
demanding a discussion related to employment issues with the senior management
and since there was no response from the management the TU had to resort a strike
action even after extending the 14 days provided.
The ... Show more content on Helpwriting.net ...
But concerning the smooth relationship (ER) between the employee and the
employer and moral/ethical values in the work place it is important to keep the
management informed on such activities. It s believed and proven that a Employer
with High morals/ Values have less Employee related issues and such employer who
operates under legal framework would not discourage a TU activities yet more would
be more concern of the Employee relation and transparency, therefore it s necessary to
inform the employer on the grounds moral/values.
Question 2
Should the employer have given an opportunity to the union to discuss these matters
with management? Is it a legal requirement?
Yes, the employer is legally bound to discuss matters with a TU that has 40% of
employees as its members. According to the Industrial Disputes (Amendment) Act,
No. 56 of 1999 stipulates under the title Unfair Labor Practices that no employer
shall: refuse to bargain with a trade union which has in its membership not less than
forty percent of the workers on whose behalf the trade union seeks to bargain.
Question 3
Was the employer under a legal obligation to deduct the union membership fees from
the salaries of member employees?
No, the employer is not legally obliged to deduct the Union membership from the
salaries of the member employee, but the member has to pay a membership fee to the
Trade Union which
Media Day At The Cleveland Cavaliers
The Cleveland Cavaliers had an entire summer to dwell on their crushing loss to the
Golden State Warriors in the 2015 NBA Finals.
I think last year is last year, and this year is this year, Cavs head coach David Blatt
said at the team s media day on Monday. We do have high expectations. Our goals are
clear and are stated, but not guaranteed.
It s important for all of us to not overstate, but to overachieve.
Blatt admitted he borrowed that last quote from Cavs general manager David Griffin,
who never fails to reiterate the organization s ultimate goal Bring a championship to
the title starved city of Cleveland.
The elephant in the room can t go unnoticed. The Cavs haven t won an NBA title
since the franchise came into existence, and the last time any professional team
from Cleveland captured a championship was more than 50 years ago. Media day
2015 was simply the first event of what should be an undeniably eventful 2015 16
Cavs season. ... Show more content on Helpwriting.net ...
To be fair, the Cavs may never have another media day as wild as the 2014 version.
LeBron James had recently announced his return to Cleveland and Kevin Love was
traded to Cleveland a little more than a month later, forming the NBA s most recent
Big 3 with dynamic point guard Kyrie Irving. Although Irving and Love continue to
recover from injuries that forced their exits in the 2015 playoffs, the Cavs should be
one of the favorites to win it all when both players reach optimal
Hidden Values Of Fairy Tales
Not all fairy tales are created equal, and not all of them are chockablock with pretty
princesses, brave knights, evil witches and mean goblins. Read them with an open
mind, and you ll see that fairy tales are fascinating tools to teach values and critical
thinking to your children.
Have you ever wondered why fairy tales are always in vogue, even with their gory
violence, shallow characters and unbelievable storylines? When you look closely
at them, you can find some sort of wisdom hidden underneath all that magic and
drama. Don t fret when your child goes gaga over a fancy princess or takes after a
naughty troll, just help your child decipher the hidden values from such tales. These
tales do not have any grey areas the demarcation between right and wrong is crystal
clear, and the good always wins over evil. So, it is ... Show more content on
Helpwriting.net ...
Elizabeth, a brave princess dupes a fire breathing dragon to rescue her loving beau.
When her ungrateful prince is bothered by her dishevelled hair and paper bag dress,
she knows that there will be no happily ever after in her story. Your little one will
admire the story of this novel princess who is anything but a damsel in distress.
4. Strega Nona by Tomie dePaola
Publisher: Simon Schuster Books
Age 4 to 8 Years
Tomie dePaola retells the story of the Magic Porridge Pot in his Caldecott winning
book, Strega Nona. Strega Nona or Grandma Witch has a magic pasta pot that cooks
a generous amount of pasta when she sings a special song. Her assistant, big
Anthony learns of this secret and uses the pasta pot when Strega Nona is away. But
big Anthony doesn t know how to stop the pot from cooking. Soon, the entire village
is buried underneath the mounds of pasta. All ends well when Strega Nona stops the
pot with three kisses, and big Anthony receives a punishment that is fitting for his
crime.
5. The Steadfast Tin Soldier by Hans Christian Andersen
Publisher: Random House UK
Age 6 to 9
The Unbalanced Scale Between Men And Women
The Unbalanced Scale between Men and Women
Over an extensive period of time, the issue concerning gender has consistently
occupy the media and the public mind. (Correll 20). It has established beliefs about
the roles of men and women as a whole. A man is expected always to be strong,
impervious to pain, and especially to emotional stress, dominant in the role of lord
and master; a woman is expected to be docile, submissive, passive, fulfilled in the
role of subordinate. (Fremon 129). It has been concluded for the longest time that
women are the inferior gender, biologically, psychologically and socially. For many
people, it is normal for women to be gender typed and never realize the prejudices
underlying into it. They are judged with ... Show more content on Helpwriting.net ...
Instead of supporting what her wife loves, he wished her to work out in the
orchard and raise some apples. (Steinbeck). Women are expected to help their
husbands before they aid to themselves. In addition, Elisa and her husband, Henry,
don t have a child, which makes her feel less of a woman. People always think that
women should be able to bear a child in order to fulfill the wifely duties. Because of
that, Elisa s married life was like a closed pot, she felt trapped, underappreciated
and frustrated because she felt like she couldn t do her part as a wife. (Steinbeck).
Not only sexual satisfaction denied her but she felt herself branded a failure.
(Fremon 129). Another contextual point that is being highlighted in the story is
the encounter of Elisa and the pot mender. Elisa wished that women could do such
thing, pertaining to the kind of life the pot mender has. The mender disagreed and
told her that It ain t the right kind of a life of a woman and added that, It would be
a lonely life for a woman... and a scarey life. (Steinbeck). The words coming from
the pot mender indicates stereotypes about women. His ideals of women are the
same as the society itself. He expected Elisa to be feminine and conjectured that
women, like her, are weak to live a life that is dangerous and perilous.
Despite the fact that both Henry and the pot mender showed indifference in Elisa s
role as a
Compare And Differences Of Thomas Muclair And Stephen
Harper
The two Federal political parties that I chose to compare and contrast is Thomas
Muclair and Stephen Harper. Thomas Muclair is the NDP. Thomas Muclair is
French and tom is English. (Joanna Smith, 2015).I prefer to call Thomas because
it sounds better than tom. NDP stands for New Democratic Party. Stephen Harper
is the Conservative party. The political party that I agree with is NDP and the
political party that I disagree with is Conservative. The reason why I agree with
Thomas Muclair is that he s the right prime minister for Canada because he as PM
(Prime Minister) worked for the greatest man in history of NDP Jack Layton in 2007
(Mark Kennedy,2015),Barack Obama and Hillary Clinton supporting the NDP
(Jennifer Ditchburn, 2015)... Show more content on Helpwriting.net ...
65 years old is time that you should retire, not 67.If Stephen Harper win life will be
miserable for forever because he s going to mess up Canada and make it worse. We
need a proper Prime Minister for Canada . Stephen Harper is evil when he acts like
he care, but he doesn t at all. Do we need this prime minister make our life
miserable for rest of the life?. People don t realize what they re doing because they
don t understand who s right prime minster. Thomas Muclair trying to restore the
right retiring age and Stephen trying raise the retiring age. It s really interesting
though the NDP makes life happy, but the Conservatives are trying make life worse.
Stephen Harper needs to get out of chair and just quit because he has nothing to
really say much. Canada needs to improve more . To conclude my research report, I
would like to say that Thomas Muclair is the future prime Minister of Canada
because he has worked with Jack Layton, getting supported by Barack Obama and
Hillary Clinton and protecting the environment. Just imagine Thomas
Erikson Stages
Erickson s stages of psycho social development Daleice Johnson Estrella Mountain
Community College Over time psychologist have found more ways to further the
study if humans behavior and metal processes. Erikson, a psychologist of the
twentieth century came up with a theory of how humans developmental stages
throughout a life span. His theory consisted of eight stages. The first stage is trust
vs. mistrust and this occurs from birth to 1 year of age. The next stage is autonomy
vs. shame and doubt and occurs from the age 1 to 3. Then there is initiative vs. guilt
this will last from age 3 to 6. The fourth stage is industry vs. inferiority and this
occurs from age 6 to puberty. Next is the stage of identity vs. role confusion this...
Show more content on Helpwriting.net ...
The act of drinking milk with the lip is not only a physiological meaning of food
intake but also a psychological meaning which becomes the prototype of the
character development afterwards. Infants learn the world around them through their
mouths. At this time, the foundation for children to build up their intimate
relationships with the world is to cultivate themselves, rely on them, and whether
they can feel that they deserve to be trusted. 2 Early childhood (autonomy versus
shame, suspicion) At this time of the year, the infant has developed the muscle of
the whole body including the anus sphincter, it comes to be able to walk standing
by oneself, and it becomes possible to control the excretion. Whether it is possible
to acquire the sense of autonomy through the experience of excretion and holding
becomes important as a developmental problem. It is praised by parents if it is
possible to excrete well, and the infant experiences an embarrassed feeling when
failing. Moreover, it is time when the self insistence is started gradually, and it is
sometimes observed to treat my excrement as a weapon as a means of the attack.
Positive Liberty
Should the Government Promote Positive Liberty?
The idea of liberty, or freedom, varies between different theorists. One theorist, Isaiah
Berlin, focused on the difference between two different ways of thinking about
political liberty (Cherniss amp; Hardy, 2010). Berlin called these two different
concepts negative and positive liberty. According to Berlin, negative freedom can be
defined as freedom from , that is, freedom from constraint or interference of others.
In contrast, positive freedom can be defined in two ways: freedom to , that is the
ability to pursue and achieve willed goals; and also as autonomy or self rule, as
opposed to the dependence on others (Cherniss amp; Hardy, 2010). Keeping the idea
of positive liberty at ... Show more content on Helpwriting.net ...
And are we to presume that if the law doesn t explicitly say we can do something, we
are not allowed to do it? (Keong, 2007).
Another concern expressed by Keong (2007) is the idea that positive liberty means
we expect the state to hand us certain things on a silver platter. Positive liberty has
been used as a platform to push through ideas such as the principle that everyone is
entitled to a minimum income or standard of living, though not everyone is
comfortable with the moral hazard this might evoke (Keong, 2007). Key questions
asked with this in mind include; if you are guaranteed something, will you be willing
to contribute back to society for it? Or, will you sit around and collect your
entitlements? (Keong, 2007; Haworth, 1991).
After going through what positive liberty is, examples of positive liberty and the
debates surrounding positive liberty, the main question running through my head is
whether the government should promote positive liberty? While I do acknowledge
what Keong says about people expecting the state to hand entitlements over, I think
that the government should promote positive liberty to maintain order within society.
An image that runs through my head at the thought of the government not promoting
positive liberty is one of anarchy. People can do whatever they like with no
consequence which to me, breeds chaos all around. At least with positive liberty,
people can do what
The Media s Influence On Body Image
America is obsessed with body image. In today s world, you can t go through the day
without seeing the television, advertisements, magazines, or really any type of media
portraying women s bodies. Due to the immense societal pressure that women should
have the perfect body to be accepted, the nonstop reminders to change what they look
like, struggling with bodyimage has now become a major social phenomenon and it s
time for women to challenge that narrative. Women of all ages are facing face
increasing scrutinization over their body image through media influence leading to
invasive surgeries, increased depression, and eating disorders. Media plays a large
role in influencing body shame through the advertisements they put out and who is
casted for the lead roles. From weight loss commercials promoting the newest
supplement to help lose those first thirty pounds to movies filled with beautiful,
skinny, white actresses diversity in body type is not a narrative promoted by the...
Show more content on Helpwriting.net ...
America s poor body image can lead to an unhealthy lifestyle. The standards of
how society views women as beautiful have changed throughout the years. Seeing
constantly that only women who are a size two are considered beautiful doesn t
make loving yourself easier. These issues cause depression and eating disorders
among women and some extreme cases the criticism and self hatred lead to suicide.
The reason often evolves from people picking on them and constantly being put
down by the media. The media is mostly to blame for these false perceptions of
beauty, through their advertisements and the type of women they cast for lead roles.
Recently, there s been small movements of progress. More diverse women, ethnically
diverse and bodily diverse, have been making waves. America must step up to the
plate to challenge the media on the narrative they ve set forth for women s bodies.
Ultimately, women must take back this
Compare And Contrast How The Grinch Stole Christmas
Comparing How the Grinch stole Christmas The Grinch Who stole Christmas has
been a hit movie for decades. It started off as a book and was made into a cartoon
and a movie. While the book and the movie have some differences the fact that the
grinch is known to hate Christmas, he steals the presents from everyone and the
setting is the same in both the book and the movie make them somewhat similar. The
first similarity between the book and the movie is that the Grinch has been known to
hate Christmas. The book states, The Grinch hated Christmas! The whole Christmas
season! This is similar to the movie because in the movie the Grinch hates Christmas.
When he was in school he was bullied around Christmas and he now hates all the
Christmas activities.
Explain The Four Kingdoms In The Book Of Daniel
Discussion Board 1 In the Book of Daniel the 7th chapter it is record that Daniel
mentioned four great kingdoms. The four great kingdoms that Daniel mentioned
are Babylon, Medo Persia, Greece, and Rome. Daniel stated in detail that these
four kingdoms would come out the earth. The Babylonian, Persian, Greek, and
Roman empires were all different in size, power, and in many other ways. It is
noted that Daniel use animal symbols to describe these four kingdoms. First, the
Babylonia kingdom is represented by a lion that had wings like an eagle in which
stood like a man on its two feet. It is imperative to state, The lion s wings being
torn off speaks of the king s insanity and loss of power; standing on two feet like a
man and receiving a human heart (mind) denotes Nebuchadnezzar s humanitarian
rule after his insanity; and the lion being lifted up from the ground indicates that it
was God who raised the king to his place of honor. Secondly, the Medo Persia
kingdom is represented by a bear that had three ribs in its mouth, and it was
commanded to devour all flesh. This command that was given means that this
empire will conqueror other empires. Thirdly, the Greek Empire was represented by
a leopard with four wings and four heads. The Greek... Show more content on
Helpwriting.net ...
Greece is aptly represented by this flying leopard, for its conquests were carried out
with lightning speed, and it had an insatiable lust for territory. Fourth, the Roman
Empire was exceeding different
The Oedipal Complex Literary Analysis
Many stories include a child who vies for their parent(s) attention. One being,
Oedipus, by Sophocles, where Oedipus rivals his father, who he believes is a
stranger, to gain the attention of his wife/mother. The idea of a child, mostly boys,
trying to gain their parent(s) (who tend to be a mother more often than a father)
attention is known as The Oedipal Complex , created by Sigmund Freud. The
Oedipal Complex , is a theory of a developing of feelings a boy develops towards
his mother. He then is against his father, or another male figure with his mother, and
has jealousy or anger towards the man. Eventually the boy tries to rival the man for
attention from his mother. The Oedipal Complex is very prominent in the short story,
The Rocking HorseWinner , written by DH Lawerence. One of the protagonists,
Paul, develops the idea in which he should raise money for his mother, since she
considers herself unlucky . The mother, Hester, believes she is unlucky because
herself and her husband work low income jobs which are unable to support their
lavish tastes. Therefore, Paul is introduced to horse racing by his gardener, Basset,
who bids on who he believes will win the races. Paul tells Basset who he wants to
bid on, and Basset would go and put the bid down for Paul. One day Paul was
discussing his connection with his gardener with his Uncle Oscar. His Uncle Oscar
took Paul to his first race, they both bidded on Daffodil, who won the race,
afterwards Uncle Oscar is included
The History Of Art In Nebraska And The Great Plains
Art in Nebraska and the Great Plains has been shaped by its diverse groups of
inhabitants. Czechs are one of many groups who added and enhanced artistic
endeavors inside Nebraska and the Great Plains. Czechs have a rich history of artistic
pursuits. Famous musicians such as Dvorak and Smetana, and the country s long
theatrical history have shaped Czech individuals. The arts are in many ways at the
heart of Czech culture. Czechs brought this mindset with them into Nebraskaand the
Great Plains. Czech immigration, during the 19th and 20th century, contributed to the
culture and arts of Nebraska and the Great Plains as a whole; especially through
music, theater, furniture making, and the Wilber Czech festival. A significant number
of Czech... Show more content on Helpwriting.net ...
Kucera states, Song and music at all times used to accompany man from the cradle to
the grave and were a necessary accompaniment of all important family events.
Instruments of note include bagpipes, violin, clarinet, brass instruments, and
accordions. According to Barkan, Between 1899 1910... Musicians and actors made
up an unusually high percentage (37 percent) of Czech professionals. Local bands,
individuals, and outside traveling artists contributed to the popularity of Czech music
within Nebraska and the Great Plains as a whole.
Czech bands played a significant role in the Great Plains and Nebraska. The Baca
Band of Fayetteville, Texas and the Pekar Band of Damon, Texas found success in
the Great Plains. Similarly, Czech bands are intertwined in the history of Nebraska.
For example, The Crete Orchestra used to drive to Lincoln back in Governor Butler
s day and play at the dances in the capital. In addition, the Wilber band played for the
second inauguration of Governor Butler.
There were several notable individuals who contributed the spread of Czech music
in Nebraska, one of which is Frank Nedela Sr. Nedela Sr. was a well known and
respected musician who lived in Saline County Nedela s first band, the Nedela
Pioneer Band, consisted of himself, his father, Thomas Aron, Joseph Chyba, and
John Svoboda. It was this band that played for the second inauguration of Governor
Butler. The band also played for weddings, dances, operas,
Effects Of Depression On High Income Countries
Depression, in general, affects more than 340 million people around the world and
is reported to be the highest cause of disability in high income countries (Demissie).
15% to 85% of mothers can experience postpartum blues with postpartum
depression rates between 11.7% and 20.4% in the United States alone (Ersek). This
depression can occur at anytime from post delivery up to one year (Ersek). Giving
birth comes with a wide variety of changes including physical, emotion and social.
There are very high levels of sex hormones in circulation which cause increased
ligament, joint and muscle laxity (Norman). Many women lose their social contacts
due to upcoming life changes, must take time off work, and must stop previous
hobbies (Norman). Relationship factors, hormone changes, sleep deprivation and
support deeply effect a woman s self esteem and confidence during and after
pregnancy (Norman). [Daley et al.] states that symptoms of postpartum depression
include decreased mood, fatigue, anxiety, thoughts of self harm and poor mother
infant interactions(change wording). Women with post partum depression have been
reported to be at an increased risk for substance abuse, are more likely to miss
gynecological and child health appointments, are more non compliant with medical
recommendations and are less likely to use preventative safety items like car seats
and outlet covers (Ersek). Researchers state that women with postpartum depression
are less likely to breastfeed and more
School Counselors
I believe the next important ingredient for multicultural competence is cultural skills.
A skilled counselor utilizes the interventions that are client based and which serve
clients needs. A positive reaction would be to be connected to those different cultures
communication is the key. In multicultural counseling the counselor needs to be more
aware his or her limitations in counseling skills. I feel it s vital to have cultural skills
in order to serve multicultural populations in the most productive way to facilitate.
By being culturally aware and recognizing how culturewill affect the counseling
process, this cultural awareness will support the counselor in developing an empathic
understanding towards clients. In... Show more content on Helpwriting.net ...
School Counselors job isn t to teach students moral rules and values or to prevent
students from making their own choices based on their values. Admittedly, it can be
a fine line to walk between not imposing our values yet helping students develop
social skills and self understanding that will enhance their efforts to become
successful adults. In the leadership role it s not up to the counselor to fix all
problems. All through the years the role the school counselors play in using
information uniquely available to them to examine and change current policy and
practice. Whether it be course taking patterns, student placements, or student success
and failure rates, school counselors are poised to be key change agents within the
school. That is a big job that I feel school counselors don t get credit for enough.
Many times, school counselors are told what to do by administrators who fail to
understand the contribution the school counselor can make to the school. If anything
that I feel I disagree is that credit that the counselors don t get. Some of the duties that
have historically been assigned to the school counselor are data entry; clerical record
keeping; registration and scheduling of all new students; coordinating or
administering cognitive, aptitude and achievement tests; responsibility for signing
excuses for students who are tardy or absent; performing disciplinary actions; sending
students home who are not appropriately
Essay on Aircraft Icing
Abstract
Aircraft icing is a common and major hazard to the aviation industry. Depending on
conditions, icing may have very little or major impact to aircraft performance. The
types of icing that form on and affect aircraft, the variables in how each type of
icing is formed and the categories of severity will be discussed. Numerous methods
of prevention and treatment exist and all pilots should be well versed in flight rules
and regulations concerning avoidance and response to icing situations. Aircraft Icing
Aircraft icing is nothing but trouble and a significant hazard to the aviation
community. With the right upper level conditions, our winter season allows icing to
occur when least expected and most pilots know very little ... Show more content on
Helpwriting.net ...
They are known as rime and clear ice, and a mixture of the two is not uncommon.
For rime ice to form, an aircraft needs to fly through an area of tiny super cooled
liquid drops. This super cooled liquid is actually suspended in the cloud cover at
temperatures already below freezing. Once the aircraft surface plows through this
moisture, the drops are disrupted immediately adhere to and freeze before
spreading out over the entire surface. This forms a rough and cloudy white layer of
ice known as rime. Even though the rime surface is rough and creates an airflow
disturbance, it is lighter and easier to remove by deicing equipment than clear ice. For
clear ice to form, larger sized super cooled drops would need to be encountered.
These larger droplets spread out over the surface and airfoils before freezing. This
allows for the build up of a clear, hard and slick layer of ice on the surface (Ahrens,
2009).
There are four basic condition levels of icing. A slight trace may be unnoticeable,
where a light accumulation might only be an issue during a very long flight through
conditions and periodic use of anti icing equipment may be needed to rid any
accumulation. A moderate build up could be hazardous to only short exposure and
anti icing equipment and route deviation would be absolutely required. Severe
conditions could not be controlled by icing removing systems and would be the most
hazardous and would probably require immediate emergency
Genetic Dna And Bioinformatics ( Accession No. Xp Essay
RESULTS
Isolation of BbovM17LAP gene
The BbM17LAP gene available in GenBank (accession no.
XP_001609968) was accessed through the National Center for
Biotechnology Information (NCBI), and its sequence was retrieved for further
analysis. The genomic DNA of BbM17LAP was found in chromosome 2, extending
between 1,045,409 bp and
1,047,164 bp of the genome. The ORF of the corresponding mRNA encoding
BbM17LAP consists of 1,578 bp. Alignment of the mRNA sequence with genomic
DNA using Genetyx revealed that the gene has 4 introns within its ORF. The first one
was a 33 bp intron (50 ggtatgtttgtttgaatactgctgaatctgtgta 30) situated near the 50 end of
the gene. The other nucleotide sequences included a
35 bp (50 agatacttacagtaacgatacaagttcatgtaggt 30) intron, a 34 bp
(50 tgggttacactctttatgctatatttgttatagg 30) intron, and a 40 bp (50
gtaagttaattgggctacaagaagcgtaatatacatacag 30) intron all located close to each other
near the 30 end.
Isolation of BbovM17LAP cDNA and bioinformatics analysis
A pair of primers targeting the ORF of BbM17LAP was used to amplify and
sequence the gene from a B. bovis cDNA expression library. This BbM17LAP cDNA
encoded a predicted
55 kDa protein without a signal peptide. The translated
BbM17LAP polypeptide shared significant homology with B. gibsoni M17LAP,
having 71% amino acid identity and similarity
(E valueВј0). The other significant homologues included Theileria parva and
Theileria annulata M17 LAPs, both having 61% amino acid identities. The
polypeptide
Cohabitation- Wiki
Cohabitation is an arrangement where two people who are not married live together
in an intimate relationship, particularly an emotionally and/or sexually intimate one,
on a long term or permanent basis
Reasons for cohabitation
When people have more personal freedoms, they seem to forget traditional morals
one of which is not living together until they get married. Through press, we know
that more and more young people cohabit nowadays, especially among students and
industrial workers. Why do they do that?
The first reason is free relationship. Usually, cohabitants are those who come to city
from provinces, so they are free to make their own choices. When asked, they say
thay they are not bound by their parents ... Show more content on Helpwriting.net ...
When a couple is in love, love is wonderful. However, when they live together, they
will interact each other more and more and discover many bad habits of their partner
such as smoking, snoring, laziness, or speaking impolitely. It is easy to make them
feel disappointed with their love heart. In addition, when a couple live together
without marriage, they are usually dishonest. Both men and woman in cohabiting
relationships are more likely to be unfaithful to their partner than married people.
(Civitas)2. They will be unfaithful about their inner feelings or their finance.
Therefore, they usually argue and then find a new lover easily.
Another serious consequence is that cohabitation causes a lot of social evil. The most
social evil is abortion. Rate of abortion in Vietnam is very high in the world.
According to Family Planning Association, our country has about 1.2 to 1.6 million
abortions each year, of which 20 percent of adolescent ages. There are many young
girls who are in cohabiting relationship must abort because they do not have good
methods of birth control (TT GD) 3. Abortion affects the women s health seriously.
Many women who abort with unsafe conditions are usually infertility, even death.
Broken cohabiting relationship and abortion not only affect women heath but also
hurt women hearts. In naturally, they can not keep balance and focus on their work
in their lives. As a result, many young
Does Writing Down Notes On Paper More Effective Than...
Does writing down notes on paper more effective than typing it?
Cerebrum: The cerebrum is the main part of the brain, which has two halves, or
hemispheres. The right hemisphere controls the left side of the body and deals with
things such as creativity, music, and art. While the left hemisphere of the cerebrum
controls the right side of the body and is in charge of language, problem solving,
and math. The cerebrum s many tasks are carried out by its outer layer, or its cortex.
This has distinct areas that have different roles. Motor areas trigger movement;
sensory areas deal with the senses, while association areas clarify information.
Cerebellum: The cerebellum is responsible for producing smooth, coordinated
movements of the body. It analyzes incoming information about the body s current
movement and position then interacts with the primary motor cortex to precisely
time muscle contractions.
Why does writing something down help us remember it better?
Our brain is separated into several regions that undergo different kind of information.
Then there are regions that process information such as visual, verbal communication,
auditory, emotions, etc. These different regions communicate with each other and
each one of them has its own processes it has to complete first. For example one
looks at a piece of art and express their emotions with language, thus working the
verbal function part of the brain.
When we hear a lecture, the section of our brain that handles listening and
Railroad Expansion In California
California shifted greatly in its early years. From being predominantly inhabited by
Native Americans, to being conquered by the Spanish, being declared a part of
Mexico and finally being claimed by the United Stated in 1846. Shortly after, gold
was discovered in the Sacramento Valley region and the population of Californiagrew
by nearly 1,000% percent, with nearly 100,000 Anglos flocking to the area(History).
The United Stateswould then acquire official statehood in 1850. In the pre war era,
there were nearly 10,000 people of Spanish decent inhabiting California. However, in
1850 the percentage of people that spoke Spanish in California was at 15%. Yet it
would soon drop yet again to a dismal 4% by 1870 (Pitti).
Claremont s own development would be somewhat of a subset of the Gold Rush,
receiving the after affects. Railroad expansions would bustle through California
mainly in the North, but also the South (Wright 20). Claremont s genesis can be
attribute to the Pacific Land and Improvement Company, which bought the land on ...
Show more content on Helpwriting.net ...
With the city of Claremont growing, there was a need to educate the youth that
inhabited the newly developed city. In 1890 Sycamore was the first school to open
its doors, though at the time it was referred to as Claremont Grammar School
(Wright 90). The next school to open in Claremont would be Claremont High
School, officially opening in 1911 in a student body of around 120 people. Its first
publication of the school Yearbook, El Espirirtu (then called Annual ) would be in
1912, sparking a near one hundred year tradition of recording history. With weak
bindings, black and white pages and only about 40 pages worth of content, the first
yearbooks were dismal at best. A look inside of the early books would reveal a lot
about how Claremont operated and why it was like it
Herberger And Hale
Hale s production of You Can t Take It With You was breathtaking with its core
concepts, portrayal of emotion, and plot. When comparing this with Herberger s
production of You Can t Take It With You, you can begin to see the ideas mixing
together as they bounce of one another so well. However, not all things were exactly
alike in the two seemingly identical versions of the same play. The first concept in
which ideas were ever changing was the interpretation of characters in both plays. In
Hale s production, Grandpa as seen as an slow, semi serious man; but when looking
at Grandpa in Herberger s production, you can see him as a more of a lively,
humorous character. This change in portrayal can also be seen in Rheba. In
Herberger s play,... Show more content on Helpwriting.net ...
Some props that I felt were used differently in both productions mostly pertain to
the aspect of music. In the Herberger s production of You Can t Take It With You,
music is incorporated a lot in ways such as commercials, cello, and guitar. Hale s
show lacked all of these elements that I felt really helped contribute to the sense of
family and fellowship in You Can t Take It With You. By incorporating the
commercials, the audience could effectively be transported to a place in which it is
1938. This really helped change the mindset of the audience into allowing them to
connect with the characters in the production on a deeper level. The guitar was also
very important, because it also introduce a new member into this family. By adding
the guitar, Herberger s production was able to give the Vanderhoff s a range of
kindness/generosity. This showed the audience that the Vanderhoff s would take in
anyone no matter background, personality, or timing of arrival. This really secured
the bond in this wonderfully bizarre group of people, allowing a connection to be
formed between the audience and
An Essay About Environment.pdf
An Essay About Environment.pdf
An Essay About Environment.pdf
An Essay About Environment.pdf

More Related Content

Similar to An Essay About Environment.pdf

Essays On Conflict. Conflict essay writing
Essays On Conflict. Conflict essay writingEssays On Conflict. Conflict essay writing
Essays On Conflict. Conflict essay writingNicole Heinen
 
What Makes A Good Citizen Essay. ️ Citizenship essay sample. A Good citizen e...
What Makes A Good Citizen Essay. ️ Citizenship essay sample. A Good citizen e...What Makes A Good Citizen Essay. ️ Citizenship essay sample. A Good citizen e...
What Makes A Good Citizen Essay. ️ Citizenship essay sample. A Good citizen e...Melissa Chastain
 
Religious Tolerance In India Essays.pdf
Religious Tolerance In India Essays.pdfReligious Tolerance In India Essays.pdf
Religious Tolerance In India Essays.pdfJacqueline Ramirez
 
Obesity Cause And Effect Essay. Cause and effect essay on obesity by no41siat...
Obesity Cause And Effect Essay. Cause and effect essay on obesity by no41siat...Obesity Cause And Effect Essay. Cause and effect essay on obesity by no41siat...
Obesity Cause And Effect Essay. Cause and effect essay on obesity by no41siat...bdg8266a
 
Nursing Reflective Essays.pdf
Nursing Reflective Essays.pdfNursing Reflective Essays.pdf
Nursing Reflective Essays.pdfAndrea Santiago
 
11Nature versus Nurture Student NameUniversityCourseProfessors NameDat.docx
11Nature versus Nurture Student NameUniversityCourseProfessors NameDat.docx11Nature versus Nurture Student NameUniversityCourseProfessors NameDat.docx
11Nature versus Nurture Student NameUniversityCourseProfessors NameDat.docxestefana2345678
 
How To Write An Expository Essay Step By Step.pdf
How To Write An Expository Essay Step By Step.pdfHow To Write An Expository Essay Step By Step.pdf
How To Write An Expository Essay Step By Step.pdfAlexis Turner
 
Argumentative Essay On Death Penalty
Argumentative Essay On Death PenaltyArgumentative Essay On Death Penalty
Argumentative Essay On Death PenaltyKimberly Powell
 
Essays On Homelessness
Essays On HomelessnessEssays On Homelessness
Essays On Homelessnessrhvslabdf
 
Finding Nemo Essay
Finding Nemo EssayFinding Nemo Essay
Finding Nemo EssayWanda Buck
 
Argumentative Essays On Death Penalty. Death penalty thesis introduction. Es...
Argumentative Essays On Death Penalty.  Death penalty thesis introduction. Es...Argumentative Essays On Death Penalty.  Death penalty thesis introduction. Es...
Argumentative Essays On Death Penalty. Death penalty thesis introduction. Es...Tamara Jackson
 
Effects Of Junk Food Essay.pdf
Effects Of Junk Food Essay.pdfEffects Of Junk Food Essay.pdf
Effects Of Junk Food Essay.pdfElizabeth Garcia
 
Essay On Use Of Internet. Internet Essay Essay on Internet Internet Essay fo...
Essay On Use Of Internet. Internet Essay  Essay on Internet Internet Essay fo...Essay On Use Of Internet. Internet Essay  Essay on Internet Internet Essay fo...
Essay On Use Of Internet. Internet Essay Essay on Internet Internet Essay fo...Kimberly Jabbour
 
Essay Nursing School. Online assignment writing service.
Essay Nursing School. Online assignment writing service.Essay Nursing School. Online assignment writing service.
Essay Nursing School. Online assignment writing service.Lisa Young
 
Essay Proposal Examples
Essay Proposal ExamplesEssay Proposal Examples
Essay Proposal ExamplesRobin King
 
Capital Punishment Essay Conclusion.pdf
Capital Punishment Essay Conclusion.pdfCapital Punishment Essay Conclusion.pdf
Capital Punishment Essay Conclusion.pdfAmy Bryant
 
1727 Best Tips Resources For College Students Image
1727 Best Tips  Resources For College Students Image1727 Best Tips  Resources For College Students Image
1727 Best Tips Resources For College Students ImageAngel Ashford
 
Essay On High School.pdf
Essay On High School.pdfEssay On High School.pdf
Essay On High School.pdfRosa Williams
 

Similar to An Essay About Environment.pdf (20)

Essays On Conflict. Conflict essay writing
Essays On Conflict. Conflict essay writingEssays On Conflict. Conflict essay writing
Essays On Conflict. Conflict essay writing
 
What Makes A Good Citizen Essay. ️ Citizenship essay sample. A Good citizen e...
What Makes A Good Citizen Essay. ️ Citizenship essay sample. A Good citizen e...What Makes A Good Citizen Essay. ️ Citizenship essay sample. A Good citizen e...
What Makes A Good Citizen Essay. ️ Citizenship essay sample. A Good citizen e...
 
Religious Tolerance In India Essays.pdf
Religious Tolerance In India Essays.pdfReligious Tolerance In India Essays.pdf
Religious Tolerance In India Essays.pdf
 
Obesity Cause And Effect Essay. Cause and effect essay on obesity by no41siat...
Obesity Cause And Effect Essay. Cause and effect essay on obesity by no41siat...Obesity Cause And Effect Essay. Cause and effect essay on obesity by no41siat...
Obesity Cause And Effect Essay. Cause and effect essay on obesity by no41siat...
 
Nursing Reflective Essays.pdf
Nursing Reflective Essays.pdfNursing Reflective Essays.pdf
Nursing Reflective Essays.pdf
 
11Nature versus Nurture Student NameUniversityCourseProfessors NameDat.docx
11Nature versus Nurture Student NameUniversityCourseProfessors NameDat.docx11Nature versus Nurture Student NameUniversityCourseProfessors NameDat.docx
11Nature versus Nurture Student NameUniversityCourseProfessors NameDat.docx
 
How To Write An Expository Essay Step By Step.pdf
How To Write An Expository Essay Step By Step.pdfHow To Write An Expository Essay Step By Step.pdf
How To Write An Expository Essay Step By Step.pdf
 
Argumentative Essay On Death Penalty
Argumentative Essay On Death PenaltyArgumentative Essay On Death Penalty
Argumentative Essay On Death Penalty
 
Essays On Homelessness
Essays On HomelessnessEssays On Homelessness
Essays On Homelessness
 
Bad Habits Essay
Bad Habits EssayBad Habits Essay
Bad Habits Essay
 
Finding Nemo Essay
Finding Nemo EssayFinding Nemo Essay
Finding Nemo Essay
 
Argumentative Essays On Death Penalty. Death penalty thesis introduction. Es...
Argumentative Essays On Death Penalty.  Death penalty thesis introduction. Es...Argumentative Essays On Death Penalty.  Death penalty thesis introduction. Es...
Argumentative Essays On Death Penalty. Death penalty thesis introduction. Es...
 
Effects Of Junk Food Essay.pdf
Effects Of Junk Food Essay.pdfEffects Of Junk Food Essay.pdf
Effects Of Junk Food Essay.pdf
 
Essay On Use Of Internet. Internet Essay Essay on Internet Internet Essay fo...
Essay On Use Of Internet. Internet Essay  Essay on Internet Internet Essay fo...Essay On Use Of Internet. Internet Essay  Essay on Internet Internet Essay fo...
Essay On Use Of Internet. Internet Essay Essay on Internet Internet Essay fo...
 
Essay Nursing School. Online assignment writing service.
Essay Nursing School. Online assignment writing service.Essay Nursing School. Online assignment writing service.
Essay Nursing School. Online assignment writing service.
 
Essay Proposal Examples
Essay Proposal ExamplesEssay Proposal Examples
Essay Proposal Examples
 
Capital Punishment Essay Conclusion.pdf
Capital Punishment Essay Conclusion.pdfCapital Punishment Essay Conclusion.pdf
Capital Punishment Essay Conclusion.pdf
 
1727 Best Tips Resources For College Students Image
1727 Best Tips  Resources For College Students Image1727 Best Tips  Resources For College Students Image
1727 Best Tips Resources For College Students Image
 
Taoism Essay
Taoism EssayTaoism Essay
Taoism Essay
 
Essay On High School.pdf
Essay On High School.pdfEssay On High School.pdf
Essay On High School.pdf
 

More from Vanessa Henderson

More from Vanessa Henderson (20)

I Believe In Myself Essay.pdf
I Believe In Myself Essay.pdfI Believe In Myself Essay.pdf
I Believe In Myself Essay.pdf
 
Do My Essay.pdf
Do My Essay.pdfDo My Essay.pdf
Do My Essay.pdf
 
Essay Revision Online.pdf
Essay Revision Online.pdfEssay Revision Online.pdf
Essay Revision Online.pdf
 
Sample Expository Essay.pdf
Sample Expository Essay.pdfSample Expository Essay.pdf
Sample Expository Essay.pdf
 
College Goals Essay.pdf
College Goals Essay.pdfCollege Goals Essay.pdf
College Goals Essay.pdf
 
Essays About Bullying.pdf
Essays About Bullying.pdfEssays About Bullying.pdf
Essays About Bullying.pdf
 
Dr Strangelove Essay.pdf
Dr Strangelove Essay.pdfDr Strangelove Essay.pdf
Dr Strangelove Essay.pdf
 
Essay Cheating.pdf
Essay Cheating.pdfEssay Cheating.pdf
Essay Cheating.pdf
 
Pursasive Essay.pdf
Pursasive Essay.pdfPursasive Essay.pdf
Pursasive Essay.pdf
 
Chicago Format Essay.pdf
Chicago Format Essay.pdfChicago Format Essay.pdf
Chicago Format Essay.pdf
 
Essay About Literacy.pdf
Essay About Literacy.pdfEssay About Literacy.pdf
Essay About Literacy.pdf
 
Jurisprudence Essay.pdf
Jurisprudence Essay.pdfJurisprudence Essay.pdf
Jurisprudence Essay.pdf
 
How To Write A High School Application Essay.pdf
How To Write A High School Application Essay.pdfHow To Write A High School Application Essay.pdf
How To Write A High School Application Essay.pdf
 
Definition Essay Sample.pdf
Definition Essay Sample.pdfDefinition Essay Sample.pdf
Definition Essay Sample.pdf
 
Examples Of English Essays.pdf
Examples Of English Essays.pdfExamples Of English Essays.pdf
Examples Of English Essays.pdf
 
Essay On Corporal Punishment.pdf
Essay On Corporal Punishment.pdfEssay On Corporal Punishment.pdf
Essay On Corporal Punishment.pdf
 
My English Essay.pdf
My English Essay.pdfMy English Essay.pdf
My English Essay.pdf
 
Learning From Your Mistakes Essay.pdf
Learning From Your Mistakes Essay.pdfLearning From Your Mistakes Essay.pdf
Learning From Your Mistakes Essay.pdf
 
Problems To Write An Essay About.pdf
Problems To Write An Essay About.pdfProblems To Write An Essay About.pdf
Problems To Write An Essay About.pdf
 
Essay Writing Jobs.pdf
Essay Writing Jobs.pdfEssay Writing Jobs.pdf
Essay Writing Jobs.pdf
 

Recently uploaded

Interdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxInterdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxPooja Bhuva
 
How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17Celine George
 
Towards a code of practice for AI in AT.pptx
Towards a code of practice for AI in AT.pptxTowards a code of practice for AI in AT.pptx
Towards a code of practice for AI in AT.pptxJisc
 
Food safety_Challenges food safety laboratories_.pdf
Food safety_Challenges food safety laboratories_.pdfFood safety_Challenges food safety laboratories_.pdf
Food safety_Challenges food safety laboratories_.pdfSherif Taha
 
SOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning PresentationSOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning Presentationcamerronhm
 
Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...
Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...
Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...Pooja Bhuva
 
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptxHMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptxEsquimalt MFRC
 
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxBasic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxDenish Jangid
 
Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfPoh-Sun Goh
 
The basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptxThe basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptxheathfieldcps1
 
Single or Multiple melodic lines structure
Single or Multiple melodic lines structureSingle or Multiple melodic lines structure
Single or Multiple melodic lines structuredhanjurrannsibayan2
 
80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...
80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...
80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...Nguyen Thanh Tu Collection
 
Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf
Unit 3 Emotional Intelligence and Spiritual Intelligence.pdfUnit 3 Emotional Intelligence and Spiritual Intelligence.pdf
Unit 3 Emotional Intelligence and Spiritual Intelligence.pdfDr Vijay Vishwakarma
 
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...Nguyen Thanh Tu Collection
 
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...Pooja Bhuva
 
Graduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - EnglishGraduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - Englishneillewis46
 
Wellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxWellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxJisc
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.pptRamjanShidvankar
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxVishalSingh1417
 

Recently uploaded (20)

Interdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxInterdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptx
 
How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17
 
Towards a code of practice for AI in AT.pptx
Towards a code of practice for AI in AT.pptxTowards a code of practice for AI in AT.pptx
Towards a code of practice for AI in AT.pptx
 
Food safety_Challenges food safety laboratories_.pdf
Food safety_Challenges food safety laboratories_.pdfFood safety_Challenges food safety laboratories_.pdf
Food safety_Challenges food safety laboratories_.pdf
 
SOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning PresentationSOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning Presentation
 
Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...
Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...
Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...
 
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptxHMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
 
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxBasic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
 
Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdf
 
The basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptxThe basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptx
 
Single or Multiple melodic lines structure
Single or Multiple melodic lines structureSingle or Multiple melodic lines structure
Single or Multiple melodic lines structure
 
Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024
 
80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...
80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...
80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...
 
Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf
Unit 3 Emotional Intelligence and Spiritual Intelligence.pdfUnit 3 Emotional Intelligence and Spiritual Intelligence.pdf
Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf
 
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
 
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
 
Graduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - EnglishGraduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - English
 
Wellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxWellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptx
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.ppt
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptx
 

An Essay About Environment.pdf

  • 1. An Essay About Environment Writing an essay on the topic of the environment is no easy task. It requires a deep understanding of various ecological issues, scientific concepts, and a grasp of the complexities surrounding environmental challenges. The difficulty lies not only in presenting factual information but also in conveying a sense of urgency and importance to the reader. To begin with, researching the latest data and statistics on environmental issues can be time- consuming. The field is vast, ranging from climate change and biodiversity loss to pollution and deforestation. Gathering accurate and relevant information is crucial to constructing a well- informed and persuasive essay. Organizing the vast amount of information in a coherent and logical manner poses another challenge. A successful environmental essay should have a clear structure, with each section flowing seamlessly into the next. Balancing the scientific aspects with the human impact and societal responsibility requires careful consideration. Moreover, addressing the complexity of the environmental crisis involves delving into the political, economic, and ethical dimensions. Understanding the interconnectedness of these factors and presenting a nuanced perspective adds another layer of difficulty to the writing process. Crafting a compelling introduction that captures the reader's attention while introducing the significance of the topic is a skill in itself. Similarly, concluding the essay with a powerful call to action or a thought-provoking statement requires finesse. The language used in an environmental essay should strike a balance between being accessible to a broad audience and conveying the gravity of the issues discussed. Finding the right tone that instills a sense of responsibility without overwhelming the reader is a delicate task. In summary, writing an essay about the environment demands not only comprehensive research and organization skills but also a deep understanding of the subject matter and the ability to communicate complex ideas effectively. It is a challenging endeavor that requires dedication and a genuine passion for environmental issues. If you find yourself struggling with such assignments, you might consider seeking assistance. Websites like HelpWriting.net offer a range of writing services, including essays on environmental topics and much more. Professionals can provide support, ensuring that your essay meets the required standards and effectively communicates your ideas. An Essay About Environment An Essay About Environment
  • 2. The 80s Research Paper The 1980s are pretty interesting to look back upon in terms of what happened to the music industry. The decade cradled the beginnings of electronic music and produced the first commercial compact discs (CDs). At the very least all rock bands were expected to house a vocalist who could sing notes into the stratosphere or a virtuosic guitar player who could play at inhuman speeds. Michael Jackson was reborn as the King of Pop, and Madonna would follow him in her own right. There was a lot of dancing, a lot of leather, and a lot of Aquanet. This was pop culture, but the most interesting thing about the 80s didn t happen until 1991, because as far as I m concerned that s when everything 80s met the guillotine. In 1991 Nirvana released their breakthrough album Nevermind closely preceded by the album s defining hit single Smells Like Teen Spirit. The mainstream music audience wouldn t have heard anything like Nevermind up to the point in time when it was released on September 24, 1991. It created a schism in pop culture between decades. Frontman Kurt Cobain was the main creative engine for Nevermind and the majority of Nirvana s catalog until the band met its end in 1994 due Cobain s death. Understanding Cobain s tendencies as a writer of music, and where they may have come from, is crucial to understanding why Nevermind is so different from what came before it. On more than one occasion Cobain cited The Beatles, and bands in, or stemming from, the punk rock genre as major
  • 3. Eating Habits And Culinary Practices Food ways can be defined as: the eating habits and culinary practices of a people, region, or historical period. My daily food ways consist of having three main course meals throughout the day; Breakfast, Lunch, and Dinner. My current food ways are based off what is available at the Lawrence dining hall and Sykes dining hall. For breakfast I tend to always have the same foods every day, either being an omelet, cereal, yogurt with granola, and the occasional banana. Considering being a college student it s hard to come by a variety of foods you can have for breakfast especially when you re in a rush to your next class. Lunch has become quite the difficulty to keep on a regular schedule with my classes all being back to back during lunch time. But, on the days I do have time for lunch I always have a big bowl of salad consisting of some leafy greens, onions, celery, carrots, croutons, and all topped with my favorite dressing balsamic vinaigrette. Dinnertime is my favorite time of the day to eat because it s right after practice and everyone from the team is all siting together scarfing down dishes after dishes of foodto replenish our staving stomachs after a long practice. At dinner time, I always make sure to eat a protein source and heavy carbohydrate to refuel my body so depending on what is available I ll always have a wheat Italian sandwich wrap with some pasta. I also make sure to have some fruit along with a small side salad. At the end of dinner, depending on the
  • 4. Relational-Emotive Behavior Therapy Case Study In the Carl Rogers interview the interactions with the client reflected a person centered approach which allowed the client to realize that she was responsible for themselves and was able to make her own decisions. When Gloria began speaking of her past relationship with her father, I feel the interactions were not dead on with the client centered approach because this approach normally does not focus on the causes of the conflict but on the current feelings being experienced. It was interesting to observe how Gloria expressed her conflict of feeling promiscuous as being outside of herself, not taking full responsibility for her actions. Okun Kantrowitz (2014) describes this as individual experiences that remain part of the environment,... Show more content on Helpwriting.net ... . . and denying responsibility for their own choices (Moreira, et all, 2011, p. 177). Perls points out how Gloria projects as being phony, and analyzes her non verbal communication, making her extremely uncomfortable and defensive with him. Okun and Kantrowitz (2014) explain her thoughts of being afraid but yet smiling as an inconsistency between the organism and its environment that create conflict that is, avoidance of contact and denying negating covering up a present experience rather than accepting it, and emphasizing what is not present rather than what is present (134). This orgasmic balance that Gestalt therapy aims to achieve is obtained by promoting strong feelings which produce the energy to experience the I and thou of the here and now (Perls, 1965). My observation was that this balance was achieved when Gloria realized that she was not experiencing fear of Perls, but was angry with him for now fulfilling her need to be respected and comforted by him. Her defense levels appear to drop when she realized that he really isn t superior to her, and he is no different than her in the fact that she could accept him as a child like herself that could be comforted like a baby. Thus her
  • 5. Impact Of Technology On Law Enforcement Law Enforcement and Technology Introduction Revolutionary progress in the field of information technology has ushered in numerous changes in the ways police officers and law enforcement agencies use to identify, trail and make cases against suspects. Throughout the last century, most of the technological advances in surveillance by law enforcement revolved around establishing and enhancing methods of communication: telephones, radio calls and other emergency communications. In this century, surveillance has become technological and is real time. The following are some of the latest surveillance technologies available to law enforcers. Surveillance Technologies in Law Enforcement Drones Unmanned drones have become arguably the most widely ... Show more content on Helpwriting.net ... Stingray is a sophisticated, portable device that is able to trail cell phone signals inside homes, vehicles and even insulated buildings. In this system, Stingray trackers operate as fake cell towers. This allows law enforcers to pin down the location of a targeted mobile device by sucking up data such as emails, text messages and cell site information. Consequently, when a suspect makes a phone call, the system will trick the cell into sending its signal back to law enforcers, thereby preventing the signal from travelling back to the individual s wireless carrier. Stingray is also capable of extracting data off other cell phone users in that location. Facial Recognition Software In this surveillance system, law enforcers take a photograph of a person s face and then compare the biometrics to other pictures stored in a database. If the person s photograph was in the database, there will be a match. This will enable the officers to identify the person behind the face. This software has since been incorporated into CCTV surveillance systems in order to track down suspects in real time. On an individual case, the system can easily be placed on the back of a smartphone since it weighs only 12.5
  • 6. Essay Bulimia Nervosa BULIMIA NERVOSA 307.51 (F50.2) Introduction Individuals diagnosed with bulimia nervosa undertake frequent binge eating, followed by expelling the food, typically by inducing vomiting, but also through exercising and the use of laxative agents, diuretics, and enemas (American Psychiatric Association, 2013). The binge eating occurrences are often prompted by a negative perception of one s body image, temporarily alleviated by the binge eating episode. Since the individual with bulimia nervosa is overanxious about body weight, purging of the food is viewed as a necessity. This is in contrast to binge eating disorder, which does not involve the purging of food after an excess of food consumption (Bulik et al., 2012). Furthermore, although ... Show more content on Helpwriting.net ... There is an additional feature that must be present alongside these symptoms in order for a patient to be diagnosed with bulimia nervosa: any binge eating events followed by compensation needs to be relatively frequent. Specifically, if these events take place at a minimum of one time per week over a 3 month timespan then a diagnosis of bulimia nervosa may be made. Although these are the symptoms that must be present in order for a diagnosis of bulimia nervosa to be made, there are often other symptoms that accompany bulimia nervosa. Signs of psychosis have been found in patients with eating disorders like bulimia nervosa (Miotto et al., 2010). Moreover, those with bulimia nervosa frequently have the feeling that there is something flawed with their mind, and that others are at fault for their problems (Miotto et al., 2010). In addition, there is evidence that a feeling of loneliness is correlated with the occurrence of bulimia nervosa (Levine, 2012), highlighting the psychological dynamics that are at play behind this disorder. Causes of Bulimia Nervosa: from genetics to environment The environmental and biological mechanisms that underlie bulimia nervosa have been researched in some depth. The principle mechanisms that give rise to bulimia nervosa may be classified into two groups: genetic variables at play and environmental factors that impact the patient. There is a considerable body of evidence
  • 7. Ooiujigvy Ytu Ftyoyugo Y Critical Writing Packet Harris, REA 095 This purpose of this packet is to aid you in your Critical Writing Assignments for REA 095. TOPIC: Extra Large, Please Go to page 636 of your reading textbook and read #3 beneath the topic Extra Large, Please. This question and essay assignment corresponds to your textbook s Chapter 3 Implied Main Ideas Review Test #2 on pages 113 117. Reread the article Extra Large, Please by Alice M. Davies. Then, use the following packet to help guide you through the brainstorming and organizational parts of your essay s prewriting. BRAINSTORMING: In the space below, write out three notes from the reading that you found interesting:1. 2. 3. Now consider, What can parents do to encourage their... Show more content on Helpwriting.net ... Expresses ideas fluently and gracefully.| Displays clear thinking. Expresses ideas clearly.| Conveys basically intelligible ideas. Style is bland, pedantic or formulaic| Conveys simplistic ideas. Lack of vocabulary hinders clarity of expression.| Reveals confusion or takes an extremely simplistic approach to the prompt.| Demonstrates confusion or inability to comprehend the prompt.| Thesis Voice Audience| Demonstrates effective sense of voice, audience and purpose, one that is evident in such elements as thesis, topic selection and/approach to topic. Discussion is fully developed and convincing.| Demonstrates adequate and clear sense of voice, audience and purpose through thesis, topic selection and/or approach. Lacks sophisticated approach.| Lacks mastery of voice, sense of audience, and/or purpose. Thesis weak or unclear. Support is weak.| Fails to convey a clear sense of voice or
  • 8. Chick Fila Essay CASE 7 CHICK FIL A: BIRD OF A DIFFERENT FEATHER STRATEGY MANAGEMENT COMPETIVENESS AND GLOBALIZATION, CONCEPT AND CASES BY 02/23/2016 Executive Summary. This case analysis evaluates Chick fil A. It is designed to show the Strength, weakness, opportunities and threat. It delineates how the founding principles have guided the company over the years, and how it has responded slowly to change over the years. CFA has grown to be a force to reckon with in the industry with strength in customer experience and sandwich trademark. However, the emerging markets, social changes, economic issues and intense rivalry will continue to pose threat to this strong cultured company. At the end of the case analysis, we would have been able to ... Show more content on Helpwriting.net ... He demanded enduring loyalty among customers and customers. CFA s customers spans through the entire population spectrum, however, it focuses on family. The high expectations by CFA are obviously because of the need to preserve the founding heritage and culture. As CFA strives to be the best quick service restaurant , key external factors affect CFA. Demographics is a major threat, this includes race, age and gender. CFA is family oriented and believes in marriage, but a comment he made on this issue earned him a bad publicity. However, that created an opportunity in the Christian community. Despite the harm of this factor, revenue went up same year. His adherence to his principles proved to people that CFA would not downplay its core values. Another threat are rivalry and intense competitors. The industry is a 120 million dollar industry with about 50 percent offering the hamburger entrees. (hoovers.com 2008). Some of these competitors are KFC, Subway, Burger King, McDonalds and Taco Bell. New entrants is a threat to CFA, example is Oporto who just made its way into the United States. There is also the threat from substitutes. Since Sundays are off days for CFA, customers will like to look for substitutes, and if rivals provided them, this might affect CFA. Example of substitute from rival is McDonalds southern chicken sandwich which in fact can come with biscuit and pickles in the morning. The crave for
  • 9. Sydney Olympic Park Proposal Essay This project aims to analyze The GPT Group s masterplan proposal for the Central Precinct of Sydney Olympic Park. An initial compliance study indicated how the proposal responded to the broader objectives of the Sydney Olympic Park Authority and the specific objectives of the Master Plan 2030 for the Central Precinct. A gap analysis was then undertaken for the proposal s compliance with the Living Community Challenge. From the results of the gap analysis, design and programming recommendations were made. Overall, this project outlines recommended changes for how GPT can achieve a masterplan that maximizes sustainability, is prepared to achieve Living Community Challenge certification, and ultimately positions itself as a world s best practice... Show more content on Helpwriting.net ... FSC Certification for Timber Insulating Panels Made From Recycled Glass Reduces thermal loads losses Less Energy consumption On Site Water Treatment To reduce strain on storm water system Micro Collectors Reduce need for community supply Greywater Separation For agricultural and sanitary use Microgeneration of Solar Energy Panels also provide shading Off Setting peaks Production and Demand CREATE SHARING COMMUNITIES + FAIR ACCESS TO NATURAL RESOURCES Communal use of energy inside the precinct and adjacent communities NET POSITIVE ENERGY Programs. Communal use of water resources inside the precinct and adjacent communities NET POSITIVE WATER Programs. Key features of development and their impact, include sustainability summary (is it truly sustainable, why/why not?) Recommendations for Certification level *Must decide if we are doing Living Community Certification or Petal Community Certification How can it become a blueprint for future projects? RESILIENCE REDENSIFICATION OF BUILDING HEIGHTS: Bring natural light to the central public areas in Ground floor Less height and more floor area Grow horizontally Less overshadow for neighboring
  • 10. 1800s Factory System During the 1800s, industrialization was the sole purpose everywhere in Europe. Industrialization was the reason for pushing forwards. Industrialization has led to what we live in today in the twenty first century it also had many downsides. The one major fault was the introduction to the factory system. The factorysystem was created in order to speed up the production of goods. It made productivity skyrocket and the output of goods increased as well. The factory system that was implanted decades ago is still in place to this very day. Production finally was able to become large scale everywhere in the nation. The use and implementation of the factory system was inevitable. The public quickly realized the effects of the factory system and... Show more content on Helpwriting.net ... It created this culture of treating workers unfairly and unjustly. A culture that is okay to treat workers the way John Wright displayed how kids were treated. It created a culture of sending kids to work at a young age where it is unsafe and not healthy. A culture of long work days and weeks in which it puts people in pain. This really shows how great the serration each class faced. The factory workers were made up of the lower class. That was the only job people could find. The rich were the factory owner in which they only had to receive the benefits of the labour. This shows how the social structure in the 1800s was but that same aspect of the difference between the lower and upper class never truly changed. This culture that was created has seeped through the nineteenth century up until now. There is still to this day a gap between the lower and upper class. Now it is easier to get out of but there is still a gap. Lower class people like teacher are treated more fairly now and have unions but are still not treated as well as other higher paying jobs. Teachers are paid little to none compared to others but they are pessary for educating people. This is exactly the same for factory workers. They were paid little to nothing but without them, industrialization would not have been able to happen or it would not have been able to reach the scale it
  • 11. Police Relations with Minority Ethnic Communities Essay Police Relations with Minority Ethnic Communities The Macpherson report was published in 1999 amidst problems of racial inequality and a lack of faith in the police amongst minority ethnic communities. There is an ongoing debate on whether Macpherson s report was a help or a hindrance with regards to minority ethnic relations and the police; it is this dispute that the essay shall examine. To begin with the paper will look at the problems, which existed prior to Sir William Macpherson s publication and which led to the publication of his report. It will then proceed to examine the failures of the Scarman report, in order to look at both the prior problems and failures regarding the 1981 Scarman ... Show more content on Helpwriting.net ... The Bradford riots in 1995, and other public outcries showed the growing animosity that was being felt toward the police by minority ethnic communities. Another factor, which led the opinions of minority ethnic citizens of the police to become additionally hostile, is the ever advancing statistical and research evidence of racism within the police force. In 1978 Stuart Hall et al showed most clearly how, largely on the basis of pre existing stereotypes minority ethnic people (in particular black people) were being criminalized and subjected to extraordinary policing and punishment. Both these factors increased the feelings of hatred for the police amongst minority ethnic communities. This was then furthered by the subsequent failings of the Scarman report. These included his failure to explain properly in his report the main reason why black people were so angry with the police this was to do with the oppressive policing that they were being subjected to. He was unsuccessful in looking at police powers (particularly stop and search) (Bridges 1982, Howe 1988 cited in Bowling et al 2002) and most importantly he failed to take a proper account of institutional racism . Consequently because of the growing
  • 12. Unit 2 TASK 1 Decoding the Jargon TASK 1: Decoding the Jargon a. Create a booklet which explain the function of hardware components and identify communication between components. The pages should include photographs and diagrams to illustrate the information you include. (P1) Components communication The following diagram shows how components communicate each other s. CPU Also known as the processor, the CPU is the heart of the computer and has two part: Control Unit The control unit controls the flow of data through the processor. Arithmetic/Logic unit (ALU) The ALU performs mathematical, logical, and decision operations in a computer and is the final processing performed by the processor. RAM A computer can only run a program when it is in memory ... Show more content on Helpwriting.net ... DOS is the basic system that people have to using Command line prompt to communicate with computer via simple interface which is not friendly user interface. The DOS can t run multitask on computer which can only load one program until it finished. But some of the features still quite useful that people still use it. Such as: 5. CHKDSK 6. GBUPDATE 7. IPCONFIG 8. PING 9. FDISK Comparison of two operating systems We can see there are many different between those two computer operating system which the Windows 8 operating system have a lots of advance features and higher performance that suit to nowadays. The DOS system usually used to be run a specific program which prevents any virus or hacker attack in the solo computer such as sale program, data base in the hospital or council data base. Features Windows 8 DOS Network Yes N/A GUI Yes N/A Multiuser
  • 13. Yes N/A Server Administration Yes N/A Command line interface Yes Yes Entertain Yes N/A Sound Yes Yes Multitask Yes N/A c. In your document explain the purpose of different software utilities which is available. Explain how software utilities can improve the performance of computer systems (P3, D1) Windows 8 Utility Virus Protection The specific program used to prevent viruses, worms and Trojans which attached in the email or website. Every computer need to install an anti virus software and
  • 14. Hans Albert Einstein And The Life Of Albert Einstein Albert Einstein was born to secular Jewish family in Ulm, Germany on March 14, 1879. Einstein is best known for the development of the theory of relativity, a major structure of physics. However, before he became this revered figure in science, Einstein worked at a patent office in Bern, Switzerland where he developed his first scientific theories. Much of his work at the patent office presented questions about transmission of electric signals and electrical mechanical synchronization of time, two technical problems that eventually led Einstein to his revolutionary conclusions about the nature of light and the fundamental connection between space and time. While attending college at the Swiss Federal Polytechnic, Einstein met Mileva Maric, with whom he developed a close relationship with. In January 1903, Einstein married Maric, and they later had two children. The first son, Hans Albert Einstein, born in Bern, Switzerland, and the second, Eduard Einstein, born in Zurich July 1910. Einstein and Mileva are believed to have had their first child in 1902, a daughter they named Lieserl, who is believed to have either been given up for adoption or died of scarlet fever. Hans later went on to become a professor of Hydraulic Engineering at the University of California, Berkeley, and received honorable recognition for his research regarding sediment transport. Eduard studied medicine in hopes of becoming a psychiatrist, but unfortunately suffered a breakdown, which led to the
  • 15. A Look at Myelin and Myelin-Related Disorders Essay A Look at Myelin and Myelin Related Disorders Myelin is the protective sheath around axons in the nervous system, and is often referred to as white matter. It acts as an insulator to the electrical signal that is conducted down the axon as a neuron fires, and can well be compared to the insulation around an electrical wire. The myelin sheath contains a variety of fatty substances (lipids), and contains at least ten distinct chemicals (2). . From what is known, axons are not fully myelinated at birth, but myelin is formed from birth on into the second decade of life (3). The way myelination takes place is through glial cells wrapping around the axons in a spiral fashion. The axons are originally embedded in these glial cells, and the ... Show more content on Helpwriting.net ... After patches of myelin are taken off the axon, oligodendrocytes repair the damage, but in the process cause scar tissue (gliotic plaques). These hard plaques then begin to interfere with the flow of electrical impulses that move through the axon (6).. In most cases, the disease is characterized by alternating phases of relapsing and remission, where the remission phases get increasingly shorter. The symptoms include spasticity, double sightedness (diplopia), and an unsteady gait (5).. This may suggest that it is not the case that myelin in the CNS in general is targeted, but that rather myelin in specific regions is affected. In case of the symptoms above, we might suspect demyelination of some motor neurons, or neurons related to the function of the visual cortex. The second group of demyelinating diseases,hereditary metabolic disorders, are degenerative diseases and include, among others, the eight identified leukodystrophies (5). Here, leuko means white , and refers to the white matter (myelin sheaths) of the central nervous system, and dystrophy means imperfect growth or development (2).. The majority of the leukodystrophies are storage disorders, where the absence or malfunctioning of an enzyme results in the toxic accumulation of chemical substances (5) In each of the so far identified leukodystrophies only one of the
  • 16. Physical Description Of The Piazza Del Campo In Siena, Italy Introduction During the Late Middle Ages town squares and piazzas were starting to become more common around the world for the purpose of getting people together and entertainment. It can be argued that Piazza del Campo in Siena, Italy is the most influential example of these types of structures. The Piazza del Campohelped the advancement of the Medieval piazzas, by incorporating different materials and design elements while still reflecting their original style of design. The typology of this site is a civic space and a space for entertainment. This paper will describe the Piazza del Campo and provide a historical view of the piazza in the way of its cultural form. This paper will first talk about its physical description, it will explore topics such as the structure, decorative aspects and materials used. After talking about the physical description, the historical context of the Piazza will be discussed, as well as the principles of deign which will include the form, function, environmental context and social context. The Piazza del Campo acted as a precedent for art, architecture and town planning. Physical Description Figure 1: Plan of Piazza del Campo, showing the open space and its conventional shape. The structure of the Piazza del Campo demonstrates the Gothic, Romanesque and renaissance architectural styles of the Late Middle Ages. The piazza is located at the center or the Heart of Siena, Italy (Centre, U.W, n.d.). It is situated between Siena Town Hall
  • 17. I M the King of the Castle I am the King of the Castle The novel begins on a deathly note. Three months before the main events of the story, the grandmother of the Hooper household dies. Her son Joseph then refuses to live at Warings, the family home, until he owns it, i.e. until his father dies and he inherits it. This tells the reader knows immediately that the relationship between Joseph and his father is poor. Soon afterwards it b ecomes clear that the relationship he has with his own son is no better. Communication between Joseph and Edmund Hooper is limited and a cause of some concern to Joseph. Edmund s mother died six years previously. This has not made him sensitive to death, and on seeing his dying grandfather he remarks coldly, All he looks like is one... Show more content on Helpwriting.net ... The crow is gone when he comes back from the bathroom in the morning. Nothing is ever said about the incident. Hooper actually feels impressed that Kingshaw kept his cool, but becomes even more determined to find ways to get to him. His next move is to take him to the Red Room. Kingshaw finds the moths and smell of preservatives oppressive and is reluctant to enter. When he finally does go in, Hooper runs out and locks the door. Kingshaw tries to escape via the windows but they are locked so he can t get out; he is on the edge of panic. He finally escapes when the adults find him. He makes excuses and runs away quickly without telling on Hooper. He is violently sick in the bathroom. Despite the signs, the adults don t notice that anything is wrong and think the boys are becoming friends. At this stage Kingshaw is finding life at Warings intolerable. He longs for his school, where he is happy and comfortable. Chapter Four Hooper goes on a daytrip to London with his father. Joseph attempts to deliver a stern speech, and is insistent that Hooper should make more effort to befriend Kingshaw. His son listens silently but continues to plan ways to inflict further terrors. Meanwhile back at Warings, Kingshaw finds a room on the top floor to hide away in. He likes the room because it doesn t seem to belong to anyone. Amazingly, he manages to keep his
  • 18. The Oil Major Of Mexico Houston is one of the most active energy exporters in the United States and home to over 300 petroleum refineries, and over 200 private oil companies. Technological innovation has led to major developments in the upstream energy exploration and production and, as a result, has evolved into rapid business growth locally. Although this has seemingly boosted market capital and broadened energy output in domestic markets that didn t exist a century ago, nationalized foreign oil dependency still represents one of the top aggregate forces influencing current domestic energy. This can be examined in recently the approved Mexican constitutional changes that are opening up the energy sector to private and foreign investment. PEMEX, the premier oil major of Mexico, has been troubled recently by its declining oil supply and reserves. Plagued by illegal activity near its plants, and internal corruption, PEMEX turned to the Mexican government for legislative reform in energy trade with the hopes that it will help bolster its position in North American markets. The opening of Mexico s oil industry is expected to increase energy trade and open new opportunities for U.S. companies and those who are already invested in the upstream infrastructure and oil field services. If this legislation reform influences growth and investment in Mexico, it will help Mexico compete in the North American energy market, and ultimately affect the Houston economy.
  • 19. Chemical Kinetcs – the Hydrolysis of Pna Ester Chemical Kinetcs The hydrolysis of PNA Ester Introduction: Reaction of a compound with water can result in a splitting, or lysis, of the compound into two parts. Organic molecules containing a group of atoms called an ester can be hydrolyzed by water to form a COOH group (carboxylic acid) and an HO group (alcohol) as follows: RCOOR + H2O ( RCOOH + HOR This reaction is spontaneous for almost all esters but can be very slow under typical conditions of temperature and pressure. The reaction occurs at a much faster rate if there is a significant amount of base (OH ) in the solution. In this lab experiment, the rate of this reaction will be studied using an ester called para nitrophenyl acetate (PNA), which produces an alcohol, ... Show more content on Helpwriting.net ... |Table 1 | |Varying Exp |Test Tube|PNA [45mg/0.5L] |(PO4)3 Buffer| |H2O |Catalyst | | | | |1.5x[PNA] |2 |3 |7 |2 |0 | | | | | |1/2 [PNA] |3 |1 |7 |2 |2 | | | | | |Imidazole |4 |2 |7 |2 |0 |Imidazole |0.025 |1 |0.005 | |Super (10x) Imidazole|5 |2 |7 |2 |0 |Super (10x) Imidazole|0.25 |1 |0.05 | |2 Me. Imid. |6 |2 |7 |2 |0 |2 Me. Imid. |0.025 |1 |0.005 | |4 Me. Imid. |7 |2 |7 |2 |0 |4 Me. Imid. |0.025 |1 |0.005 | |Acidic pH 6.5 |8 |2 |6.5 |2 |1 | | | | | |Basic pH 7.5 |9 |2 |7.5 |2 |1 | | | | | |Basic pH 8.0 |10
  • 20. An Investigation Based On The Arrhenius Law INTRODUCTION This investigation is based on the Arrhenius law, A formula created by Professor Svante Arrhenius that combines the Boltzmann distribution law with the concept of activation energy (Stephen Lower 2011a) to depict one of the most important relationships between temperature and rate of reaction in chemistry to date. In the formula, K = e ≈ 2.71828 A = Arrhenius constant = Activation Energy RT = Average kinetic energy (Universal gas constant Г — Temperature in Kelvins) In this experiment, the main focus is placed on the Arrhenius plot, which is derived through the manipulation of the Arrhenius equation to remove its exponential form by taking the natural log of both sides of the equation which forms lnk=lnA E_A/RT A ... Show more content on Helpwriting.net ... This topic appealed to me, as it seemed like a sound concept in theory, but could not find any discussion based on using the Arrhenius plot for physical processes. BACKGROUND INFORMATION 2.1 Sublimation; an endothermic process Sublimation is the term describing the transition of a substance from the solid phase to the gas phase without passing through an intermediary liquid phase. (Anne Marie Helmenstine 2014a) It is a physical change of state, which occurs at temperatures and pressures below the triple point of the substance, the point where the temperature and pressure causes the 3 phases: solid, liquid and vapour, of a single component system to be in equilibrium. (Blackwell Scientific Publications Oxford 1997) This definition shows that sublimation is a purely physical process; so a substance does not undergo a chemical reaction during sublimation. This diagram represents a typical endothermic reaction: Fig. 2: Endothermic reaction enthalpy change (hferrier n.d.) As displayed in figure 2, a substance requires kinetic energy greater or equal to its activation energy in order for it to change from its initial form to its product. The activation energy shown is one of the pathways that a reaction takes with respect to the pressure that it is subjected to. Consider that for a substance to change from its solid phase to its gas phase the bonds are all fixed in a position and when the particles have enough energy, they are able to
  • 21. Wound Infection 2.1.1.Most common pathogenic strains that cause wound infection The most common pathogenic strains that cause wound infection is Staphylococcus aureus (35%), Escherichia coli (15%), Pseudomonas aeruginosa (13%) and other bacteria (37%) (Amit Kumar Gupta et al., 2015). In another study, Staphylococcus aureus has been reported as the major cause of wound infection with (24.2%), followed by Pseudomonas aeruginosa (21.4 %), Escherichia coli (14.8 %) and another different organism (39.6 %) (Jyoti Sangwan et al., 2016). Staphylococcus aureus (Methicillin Resistant Staphylococcus aureus) is gram positive bacteria and can be a lethally opportunistic pathogen or human commensal, it is one of the leading organisms causing a variety of hospital acquired infection and community acquired infection (Brown et al., 2014). S. aureus has ... Show more content on Helpwriting.net ... S. aureus responsible for 70% skin infection in children, moreover, the incidence of skin infection caused by MRSA is in a continuous increasing (Nataraj et al., 2014). Pseudomonas aeruginosa is gram negative bacteria, it is classic opportunistic bacteria and are often severe, life threatening and difficult to treat due to it has an innate resistance to many of antibiotic and disinfection (Bangera D et al., 2015; Wendell Lou B. Ladion et al., 2015). P. aeruginosa recently acquired significant as one of the most important organisms that cause nosocomial infection due to having an ability to survive in hospital environments, in addition, it has the ability to develop resistance against many antimicrobial agents (Nagoba et al., 2013). Wound infection caused by P. aeruginosa rapidly deteriorating and lead to systemic spread and therefore death within days or weeks (Turner et al., 2014). Escherichia coli is gram negative bacteria and considered as a member of the Enterobacteriaceae, it is innocuous resident in a gastrointestinal tract, but at the same time has the ability to cause
  • 22. Effective Performance Management With The Balanced... Effective Performance Management with the Balanced Scorecard Technical Report Writers: Liz Murby Stathis Gould CIMA CIMA CIMA gratefully acknowledges the contributions of Gary Ashworth, Philip Barden, Peter Brewer, Gavin Lawrie, Bernard Marr, Professor Bob Scapens, Dr Mostafa Jazayeri Dezfuli, and Francesco Zingales. Contact: liz.murby@cimaglobal.com Copyright CIMA 2005 First published in 2005 by: The Chartered Institute of Management Accountants 26 Chapter Street London SW1P 4NP Printed in Great Britain The publishers of this document consider that it is a worthwhile contribution to discussion, without necessarily sharing the views expressed. No responsibility for loss occasioned to any person acting or refraining from action ... Show more content on Helpwriting.net ... 27 7.2 Public sector: Health Action Zone . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30 Appendices 1. The value dynamics framework at Dell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35 2. The Business Modelling Approach s if then matrices . . . . . . . . . . . . . . . . . 36 3. The Business Modelling Approach s implementation questionnaire . . . . . 37 References and further information sources . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38 2 Effective Performance Management Introduction To manage and deploy organisational resources in such a way as to deliver and fulfil organisational objectives is a vital role of senior finance and management professionals. Many tools, techniques and frameworks have evolved to assist managers in this: value based management, total quality management, the performance prism, and more. This report focuses on one such framework: the balanced scorecard. Of the tools designed to improve corporate performance, the balanced scorecard has probably been the most popular. Originally developed as a performance measurement tool, the scorecard is now associated increasingly with strategy implementation. It acts as a management framework with the potential to identify and exploit organisations key value drivers to their best strategic advantage. This report considers the more recent developments in scorecard thinking, in particular the key role of strategy mapping. It outlines
  • 23. General Review of Algorithms Presented for Image Segmentation Image segmentation commonly known as partitioning of an image is one of the intrinsic parts of any image processing technique. In this image pre processing step, the digital image of choice is segregated into sets of pixels on the basis of some predefined and preselected measures or standards. There have been presented many algorithms for segmenting a digital image. This paper presents a general review of algorithms that have been presented for the purpose of image segmentation. Segmenting or dividing a digital image into region of interests or meaningful structures in general plays a momentous role in quite a few image processing tasks. Image analysis, image visualization, object representation are some of them. The prime objective of segmenting a digital image is to change its representation so that it looks more expressive for image analysis. During the course of action in image segmentation, each and every pixel of the image segmentation is assigned a label or value. The pixels that share the same value also share homogeneous traits. The examples can include color, texture, intensity or some other features. Image segmentation can be defined as the technique to divide the an image f (x, y) into a non empty subset f1, f2, ...., fn which is continuous and disconnected. This step contributes in feature extraction. There are quite a few applications where image segmentation plays a pivotal role. These applications vary from image filtering, face recognition, medical imaging
  • 24. Washington, The Man Of The Revolutionary Era Allison McNamara D Abbene, p.4 American History 8 18 December 2015 Washington, the Man of the Revolutionary Era On February 22nd, 1732, George Washington was born in Virginia, but little did his parents know that he would change America forever. George Washington worked hard to raise soldiers spirits and help them to survive the winter at Valley Forge. He did anything in his power to get the necessary supplies and best living conditions for his soldiers. George Washington lead the Culper Spy Ring which was vital in winning the war. In the spy ring, anonymous spies worked around the clock to find any information that could give hints to plans of the British. He lead the Continental Army successfully at Yorktown. He faced many... Show more content on Helpwriting.net ... From morning until night he taught his army the art of war. He worked as hard as he could to make sure his soldiers were ready for anything and everything that could happen on the battle field. But, training his soldiers was not the only thing that needed to be done. Although the soldiers were making due at the camp, conditions were far from perfection. He ordered that camp to be laid out in a way that best fit the soldiers. His instructions were to build a log hut 14 by 16 ft for every 12 men. He also ordered his men to build a bridge over the Schuylkill River to resupply his army more efficiently. Washington wanted the best for his troops, and in order have that he needed help from sources outside of Valley Forge. As early as September, 1777, Washington contacted Alexander Hamilton to ask for supplies such as clothes and blankets, which the soldiers were in need of. He desperately wrote a letter to congress to inform them of the harsh conditions, and asking them for any supplies that they would give to his troops. He wrote, From my soul... I pity these miseries, which it is neither in my power to relieve or prevent (Bruns, 63 64). Washington also sent men on large expeditions to get food for his soldiers. These men were successful and most likely saved the army. With all of these efforts combined, his troops supply dilemma eased and they got back on track for the war. Although the winter was harsh, conditions gradually improved under the leadership of
  • 25. The Importance Of Understanding The English Language In... An article published by the New York Times, History for dollars by David Brooks, emphasizes the importance of understanding the English language. He suggests that you major in English and liberal arts majors instead of accounting or other majors that might pay twice as well. You will have enormous power if you are the person in office who can write a clear and concise memo (Brooks). He also states that you will use the english language in whatever job you find. He thinks that any business must have people who understand English very well to succeed. You can have a great product, but someone has to be very good with the language to get people to buy the product. Studying the humanities will give you a wealth of analogies (Brooks). Everyone thinks in analogies every day according to Brooks. Whether it s going to the store and comparing two products or comparing two colleges everyone makes comparisons. Then Brooks starts to explain The Big Shaggy, which is a concept he came up with. It consists of ideas that deep down people have passions that don t lend themselves to systemic modeling. Brooks suggests people choose systemic modeling because it pays better. Most of america is very economic based when choosing jobs. That is the reason computer scienceis the fastest growing major right now. But going into those fields won t get you very far in the big shaggy. Many people end up not doing well in the idea of the Big Shaggy. I disagree with a lot of points in this article. I believe the goal of college is to best prepare you for a future job. If you get a degree in liberal arts, you already start behind. There is a low demand for jobs that require an English major. They don t pay well because the amount of jobs is slim, and there is a surplus of people in that field. The fastest growing majors right now are in the computer field. Technology is growing exponentially and now everybody is connected to the internet daily. You don t need to know english that well to make a lot of money. Most companies now and days aren t even American based. So knowing english isn t the key to be successful. If you major in a STEM field you will be ahead of most college students. Every company now has a website and
  • 26. The Rise Of Honey Bees Where did all the honey bees go? Honey Bees pollinate crops, and fruits and vegetables. Crops feed livestock, Humans eat both fruits and vegetables and livestock. Therefore humans along with all other living things need honey bees. But where have they all gone? Nationally honeybees are disappearing all over the United Statesfor many reasons such as pesticides, Colony Collapse Disorder (CCD), and other issues still being investigated but here in the Chicagoland area the colonies are dying off due to the freezing weather. Head beekeeper for the Morton Arboretum and the rooftop hives at the Chicago Marriott, he doesn t want a repeat of last winter s massacre, when 80 percent of his colonies perished (Lauren Williamson). Bee keepers here in
  • 27. Classic Rummy Research Paper Explore playing, learning and earning with Classic Rummy If you are free and want to relax in the comfort of your room cuddled up in a blanket and also want the thrill and experience of winning real money by just playing a game, then try free online rummy just once. Anyone can bet that you will be glued to it for the life time; such is the charm of this traditional amazing game that has now gone online and can be played with anyone at any time of the day in the world. The mobile version is easily downloadable free on your smart phone so even if you are travelling or has some time to spare in between work, you would never want to lose a chance to play and win cash. There are many online rummy game sites and all of them boast of safe cash transactions,
  • 28. Essay On The Colony Of Virginia The colony of Virginia was founded by a stock company: the Virginia Company. To attract people Virginia made a wonderful charter. Emigrants who paid their own way to Virginia got fifty acres of land. There would not be mere tenants. Civil authority would control the military. A council of burgesses, representatives chosen by the inhabitants of the colony for their government, would be convened as the House of Burgesses. The governor could veto their actions and the company still had overall control of the venture, but the settlers would have a say in their own government, including the right of the House of Burgesses to introduce money bills. The King s court appointed a royal governor, someone who had never set foot on the land of... Show more content on Helpwriting.net ... The governor chose six people in the colony to be in his council. The other fifteen people were chosen by the king because of their family and wealth. In all, there were twenty two members that attended. All the representatives were English. Each of the Virginian counties had sent a representative to the house. The first meeting was on July 30, 1619. It was held in the choir of the church on Jamestown Island. It lasted for six days, but was cut short by the disease, Malaria. Problems began to strike, like a massacre from the Native Americans where they killed 400 colonists. As hard as the government tried to conceal the problems, the king heard about them. He made virginia a crown colony. The king divided the colony into eight shires. By 1643, there were 15 shires! Most jobs were simply commanded to people. Only the representatives got votes to represent. Each shire would send a vote for a representative to go and work in the House, rather than have it be just rich people. White men that were seventeen years old or older and owned land were able to vote for these representatives. In 1652, Oliver Cromwell forced Jamestown to admit that they had been taken over. However, that did not mean that their
  • 29. A Research Study On The Stress Hormone And Cortisol Levels Well conducted research is essential to the advancement of knowledge. Through poor research design, incorrect statistical analysis or inappropriate conclusions, experimenters can conduct virtually useless studies, or worse, call into question the integrity of researchers. However, analysis of poorly conducted research is essential to the improvement of the scientific method. Presented shall firstly be a literature review regarding a growing contemporary body of literature, premised on the association between stressors, management strategies and cortisollevels. Additionally, a replication study examining powerful poses and cortisol levels shall be analysed and critically and constructively evaluated. Cortisol commonly known as the stress hormone is a steroid hormone regulated by the hypothalamic pituitary adrenal axis, an interaction of endocrine glands thought to be crucial in adapting to behavioural and environmental changes. Cortisol effects many functions within the body, including control of blood sugar levels, regulating the metabolism, reducing inflammation and assisting in immune responses (Randall, 2010; Shu Fen et al. 2015). The main function of cortisol is to restore homeostasis to the body following stress, and it is the primary hormone responsible for the stress response. Fluctuation of cortisol levels throughout the day is normal for humans, however, sustained high levels of cortisol can have adverse effects. These can include serious health implications
  • 30. Direct Marketing Communication Plan for Market Solutions Direct Marketing Communication Plan for Marketing Solutions 14. INFORMATION NEEDS Target Markets At the center of any effective marketing strategy is the ability to define what makes a service unique and highly valuable to a given target market. When selling services, which are inherently intangible, the need exists for creating value quickly and with many forms of tangible proof of expertise sold. When selling information services the need to generate trust and a strong sense of value has to preclude any long term purchasing relationship (Laurence, 2001). Market Solutions needs to create a foundation of trust with the following target markets if their information services business is going to establish itself and thrive over time. Trust must be the foundation of the company for it to succeed in the segments it has chosen. These include automotive, banking, FMCG, food and beverages, hospitality services and telecommunication services industries. Each of these industries has unique information challenges or problems, yet all share a common interest in customer satisfaction analysis. The customer satisfaction analysis service will be offered to all of these industries, in addition to Ad Tracking. These two services are foundational for the successful operation of any business and will also serve over time to create a system of record, or master data management (MDM) platform that will illustrate each of these industries well. One of the most critical factors of success
  • 31. The Origins Of Christianity By Najr пїЅпїЅ N 5.2 Origins of Christianity in NajrДЃn The story of arriving Christianity to NajrДЃn is shrouded by controversy Muslim and Christian sources. This controversy can be seen in arguing particular issues such as the approximate date of arrival, the country where Christianity came from and the first person who evangelised to Christian faith. For Eastern Christian sources, the oldest date was claimed by Д«bn MattaМЃ (1896), tells that the Saint Mar Marry, one of the 70th evangelists who spread after the time Jesus Christ, preached to Christianity in Arab lands, residents of tents, Yemen and NajrДЃn. Differently, the history of Church introduces other versions of that arrival, one of them offered by Eusebius (1998), who lived in the first half of the ... Show more content on Helpwriting.net ... The Nestorian works, especially the Chronicle of Seert (anonymous, 1907) and AkhbaМ„r fatМЈaМ„rikat kursiМ„ al Mashriq min KitaМ„b al Majda (Д«bn SulaymaМ„n, 1899) provide another version for the introduction of Christianity to NajrДЃn. Both tell that the NajrДЃnite trader called HМЈayyДЃn traveled to the capital of Byzantium, Constantinople for trade and then he went to al HД«ra (HД«rat al Nu man), an ancient city in south of Mesopotamia (Iraq), in the reign of the Sasanian emperor, Yazdegerd I 399 420 AD (ibid). The story states that HМЈayyДЃn saw how Christians prayed and worshiped and subsequently he converted to Christianity and had baptized in its church (ibid). After returning to NajrДЃn, HМЈayyДЃn invited his family and other NajrДЃnites to his religion and Christianity became spread among many people of NajrДЃn and near HМЈimyarite regions (ibid: 3). In addition, there is Abyssinian version for reaching the Christianity to Najran, states that the priest Azkir could establish new church and baptised 38 Christians in Najran by the second half of fifth century (Budge, 1928). For Muslim sources, there are two similar versions of arriving Christianity to NajrДЃn. In the first, historians such as Ibn IshМЈДЃq (1955), al Mas udi (1981) and Ibn HishМЊaМ„m (1994) relate that Christianity brought by a Christian ascetic called FaymiyЕ«n (Phemion), coming from Syria (ShaМ„m) to Arabia for working as a
  • 32. Sin, Consequences And Redemption In Le Morte DArthur The Sin, Consequences, and Redemption of Sir Lancelot Sir Lancelot is the dominant figure in Le Morte D Arthur who presents us with the theme of sin and redemption. Sir Agravaine and Sir Mordred expose the courtly romance or otherwise adulterous affair between Sir Lancelot and Queen Guenever. This sets in motion the conflicts and other events leading up to the death of Sir Lancelotand many other noteworthy characters. Sir Lancelot betrays both King Arthurand Queen Guenever. If he is truly a noble character as Sir Gawaine, Sir Gareth, and Sir Gaheris describe, would he have involved himself in such a treacherous act? Sir Agravaine says, I marvel that we all be not ashamed both to see and to know how Sir Launcelot lieth daily and nightly by the queen, and all we know it so; and it is shamefully suffered of us all, that we all should suffer so noble a king as King Arthur is so to be shamed (Location 12810). Sir Lancelot s betrayal raises opposition between the knights and breaks up that which should remain united. His betrayal reaches beyond the king and queen. Thus, it is not a surprise that the consequences of his sin affect the lives of so many. Now, Sir Agravaine and Sir Mordredplot to find Sir Lancelot and Queen Guenever alone together, while the king is away. The king warns Sir Agravaine and Sir Mordred, ...he will fight with him that bringeth up the noise, and I know no knight that is able to match him (Location 12836). With King Arthur s consent, they gather a
  • 33. The Fundamental International Charter For Human Rights The topic of universal human rights is a complex and largely contested area of international relations. Though often highly regarded in Western states, the notion of individual rights is highly debatable in other parts of the world. In a struggle to reconcile regional traditions and world cultures, efforts to create implement a universally accepted charter of human rightshave met many obstacles. Key issues including minority groups, gender, and the concept of individuality versus collectivism make up the many complicated shades of grey within this debate. To better understand the challenges that the concept of universal human rights faces, it is necessary to analyse the cultural, religious, and developmental dilemmas that jeopardise its legitimacy on a global scale. The foundational international charter for human rights is the United Nation s Universal Declaration of Human Rights. This declaration adopted in 1948, contains thirty articles, listing the UN s defined entitlements and rights of human beings. During the 1993 World Human Rights Conference, the Vienna Declaration and Programme of Action, stressed that the universal nature of these rights and freedoms is beyond question. [1] Though it is lauded by many in the UN as universal, opposition is also widespread. The consensus of Western nations that human rights are universal has been heavily scrutinised by critics around the world. Such critics often pose the question of whether human rights can be surmised as
  • 34. The State Of Student Ministries Essay The State of Student Ministries I spend a good deal of my time in research. It s something I feel is important for a person in my position. Some of this research involves an in depth of scripture for an upcoming lesson. However, a lot of my research goes into understanding contexts. In Bible College, the first thing they drilled into our minds was context determines meaning. In the Bible, this means historical background, the context of the author, the context of the audience, how the passage relates to other passages around it, how it related to the book it was in, how it related to scripture as a whole, among other significant trends to analyze. In student ministry, this means understanding contexts such as, age, developmental stages, trends in culture, trends in our church, history of our church, trends in the broader Church, history or the broader Church, language barriers (slang), friendships, family and parents, technology, the list could really go on and on. Therefore, I study these things to have a thriving ministry at First Presbyterian Church. I read books, countless articles, and every two years I go to a National Youth Workers Convention to be with thousands of other leaders who are going through similar situations within their ministry. I think we have a tendency to look outward and play a compare game when analyzing ourselves. This isn t just in church, but in our personal lives as well. It s why we want the latest and greatest clothing style, vehicle,
  • 35. Essay on Cruel and Unusual Punishment The death penalty also known as capital punishment is an execution in which the person who committed the offence is put to death by the state. It was first practiced in Jamestown colony, 1608. The person was hanged for spying for the Spanish government and was the 1st person sentenced to death in America. Since then, it has been a form to punish the criminals for committing such heinous crimes and putting end to violence and crime rates. Despite how people agree that the death penalty is justifiable, however; it still violates the international human rights laws. These laws were created to protect the lives of all human beings including the criminals, who some might agree they do not deserve to live. Even though some might say that the... Show more content on Helpwriting.net ... Justice can be interpreted in many ways such as being able fair or wanting someone to suffer for what they did. However, death is not always the solution to every problem which involves a murder. In the United States alone there are thirty five states that still have the death penalty while only fifteen states have repealed it. In the United States, about 13,000 people have been legally executed since colonial times . How does America respond to this? The United States is supposed to represent freedom, liberty, and peace. However, the death penalty contradicts everything the founding fathers built America on. Everyone is entailed to life even though they commit terrible crimes. Technology advancements are rapidly growing which is supposed to allow less pain in time of execution. So far in 2011 there have been eight executions and three more executions are going to be taken place on March 10, 29 and 31. Many people are killed by lethal injections, electrocutions, gas chamber, hanging, or a firing squad. These killing methods are both immoral and unconstitutional because they are killing the people like animals. This is an endless vicious cycle of murder and revenge that continues because the people have a desire to get revenge on the people who killed their loved one. Even thought that loved one will never return and enjoy life before it was quickly taken away. In the United States there are about 3,230 Death Row inmates
  • 36. Mudule 11 Case Study Essay examples Content Page # Executive Summary 2 Analysis3 7 Annexure8 Bibliography8 Executive Summary The report includes the summary of Lanka Fashion Leather Products Company (company) which was successfully operating for several years having about 150 employees without any trade Union (TU) activities. The Issue arose when 75% of the work force formed a branch Trade Union of a registered TU sponsored by a political party. After two formal requests sent by the TU to the management, demanding a discussion related to employment issues with the senior management and since there was no response from the management the TU had to resort a strike action even after extending the 14 days provided. The ... Show more content on Helpwriting.net ... But concerning the smooth relationship (ER) between the employee and the employer and moral/ethical values in the work place it is important to keep the management informed on such activities. It s believed and proven that a Employer with High morals/ Values have less Employee related issues and such employer who operates under legal framework would not discourage a TU activities yet more would be more concern of the Employee relation and transparency, therefore it s necessary to inform the employer on the grounds moral/values. Question 2 Should the employer have given an opportunity to the union to discuss these matters with management? Is it a legal requirement? Yes, the employer is legally bound to discuss matters with a TU that has 40% of employees as its members. According to the Industrial Disputes (Amendment) Act, No. 56 of 1999 stipulates under the title Unfair Labor Practices that no employer shall: refuse to bargain with a trade union which has in its membership not less than forty percent of the workers on whose behalf the trade union seeks to bargain. Question 3 Was the employer under a legal obligation to deduct the union membership fees from the salaries of member employees? No, the employer is not legally obliged to deduct the Union membership from the salaries of the member employee, but the member has to pay a membership fee to the Trade Union which
  • 37. Media Day At The Cleveland Cavaliers The Cleveland Cavaliers had an entire summer to dwell on their crushing loss to the Golden State Warriors in the 2015 NBA Finals. I think last year is last year, and this year is this year, Cavs head coach David Blatt said at the team s media day on Monday. We do have high expectations. Our goals are clear and are stated, but not guaranteed. It s important for all of us to not overstate, but to overachieve. Blatt admitted he borrowed that last quote from Cavs general manager David Griffin, who never fails to reiterate the organization s ultimate goal Bring a championship to the title starved city of Cleveland. The elephant in the room can t go unnoticed. The Cavs haven t won an NBA title since the franchise came into existence, and the last time any professional team from Cleveland captured a championship was more than 50 years ago. Media day 2015 was simply the first event of what should be an undeniably eventful 2015 16 Cavs season. ... Show more content on Helpwriting.net ... To be fair, the Cavs may never have another media day as wild as the 2014 version. LeBron James had recently announced his return to Cleveland and Kevin Love was traded to Cleveland a little more than a month later, forming the NBA s most recent Big 3 with dynamic point guard Kyrie Irving. Although Irving and Love continue to recover from injuries that forced their exits in the 2015 playoffs, the Cavs should be one of the favorites to win it all when both players reach optimal
  • 38. Hidden Values Of Fairy Tales Not all fairy tales are created equal, and not all of them are chockablock with pretty princesses, brave knights, evil witches and mean goblins. Read them with an open mind, and you ll see that fairy tales are fascinating tools to teach values and critical thinking to your children. Have you ever wondered why fairy tales are always in vogue, even with their gory violence, shallow characters and unbelievable storylines? When you look closely at them, you can find some sort of wisdom hidden underneath all that magic and drama. Don t fret when your child goes gaga over a fancy princess or takes after a naughty troll, just help your child decipher the hidden values from such tales. These tales do not have any grey areas the demarcation between right and wrong is crystal clear, and the good always wins over evil. So, it is ... Show more content on Helpwriting.net ... Elizabeth, a brave princess dupes a fire breathing dragon to rescue her loving beau. When her ungrateful prince is bothered by her dishevelled hair and paper bag dress, she knows that there will be no happily ever after in her story. Your little one will admire the story of this novel princess who is anything but a damsel in distress. 4. Strega Nona by Tomie dePaola Publisher: Simon Schuster Books Age 4 to 8 Years Tomie dePaola retells the story of the Magic Porridge Pot in his Caldecott winning book, Strega Nona. Strega Nona or Grandma Witch has a magic pasta pot that cooks a generous amount of pasta when she sings a special song. Her assistant, big Anthony learns of this secret and uses the pasta pot when Strega Nona is away. But big Anthony doesn t know how to stop the pot from cooking. Soon, the entire village is buried underneath the mounds of pasta. All ends well when Strega Nona stops the pot with three kisses, and big Anthony receives a punishment that is fitting for his crime. 5. The Steadfast Tin Soldier by Hans Christian Andersen Publisher: Random House UK Age 6 to 9
  • 39. The Unbalanced Scale Between Men And Women The Unbalanced Scale between Men and Women Over an extensive period of time, the issue concerning gender has consistently occupy the media and the public mind. (Correll 20). It has established beliefs about the roles of men and women as a whole. A man is expected always to be strong, impervious to pain, and especially to emotional stress, dominant in the role of lord and master; a woman is expected to be docile, submissive, passive, fulfilled in the role of subordinate. (Fremon 129). It has been concluded for the longest time that women are the inferior gender, biologically, psychologically and socially. For many people, it is normal for women to be gender typed and never realize the prejudices underlying into it. They are judged with ... Show more content on Helpwriting.net ... Instead of supporting what her wife loves, he wished her to work out in the orchard and raise some apples. (Steinbeck). Women are expected to help their husbands before they aid to themselves. In addition, Elisa and her husband, Henry, don t have a child, which makes her feel less of a woman. People always think that women should be able to bear a child in order to fulfill the wifely duties. Because of that, Elisa s married life was like a closed pot, she felt trapped, underappreciated and frustrated because she felt like she couldn t do her part as a wife. (Steinbeck). Not only sexual satisfaction denied her but she felt herself branded a failure. (Fremon 129). Another contextual point that is being highlighted in the story is the encounter of Elisa and the pot mender. Elisa wished that women could do such thing, pertaining to the kind of life the pot mender has. The mender disagreed and told her that It ain t the right kind of a life of a woman and added that, It would be a lonely life for a woman... and a scarey life. (Steinbeck). The words coming from the pot mender indicates stereotypes about women. His ideals of women are the same as the society itself. He expected Elisa to be feminine and conjectured that women, like her, are weak to live a life that is dangerous and perilous. Despite the fact that both Henry and the pot mender showed indifference in Elisa s role as a
  • 40. Compare And Differences Of Thomas Muclair And Stephen Harper The two Federal political parties that I chose to compare and contrast is Thomas Muclair and Stephen Harper. Thomas Muclair is the NDP. Thomas Muclair is French and tom is English. (Joanna Smith, 2015).I prefer to call Thomas because it sounds better than tom. NDP stands for New Democratic Party. Stephen Harper is the Conservative party. The political party that I agree with is NDP and the political party that I disagree with is Conservative. The reason why I agree with Thomas Muclair is that he s the right prime minister for Canada because he as PM (Prime Minister) worked for the greatest man in history of NDP Jack Layton in 2007 (Mark Kennedy,2015),Barack Obama and Hillary Clinton supporting the NDP (Jennifer Ditchburn, 2015)... Show more content on Helpwriting.net ... 65 years old is time that you should retire, not 67.If Stephen Harper win life will be miserable for forever because he s going to mess up Canada and make it worse. We need a proper Prime Minister for Canada . Stephen Harper is evil when he acts like he care, but he doesn t at all. Do we need this prime minister make our life miserable for rest of the life?. People don t realize what they re doing because they don t understand who s right prime minster. Thomas Muclair trying to restore the right retiring age and Stephen trying raise the retiring age. It s really interesting though the NDP makes life happy, but the Conservatives are trying make life worse. Stephen Harper needs to get out of chair and just quit because he has nothing to really say much. Canada needs to improve more . To conclude my research report, I would like to say that Thomas Muclair is the future prime Minister of Canada because he has worked with Jack Layton, getting supported by Barack Obama and Hillary Clinton and protecting the environment. Just imagine Thomas
  • 41. Erikson Stages Erickson s stages of psycho social development Daleice Johnson Estrella Mountain Community College Over time psychologist have found more ways to further the study if humans behavior and metal processes. Erikson, a psychologist of the twentieth century came up with a theory of how humans developmental stages throughout a life span. His theory consisted of eight stages. The first stage is trust vs. mistrust and this occurs from birth to 1 year of age. The next stage is autonomy vs. shame and doubt and occurs from the age 1 to 3. Then there is initiative vs. guilt this will last from age 3 to 6. The fourth stage is industry vs. inferiority and this occurs from age 6 to puberty. Next is the stage of identity vs. role confusion this... Show more content on Helpwriting.net ... The act of drinking milk with the lip is not only a physiological meaning of food intake but also a psychological meaning which becomes the prototype of the character development afterwards. Infants learn the world around them through their mouths. At this time, the foundation for children to build up their intimate relationships with the world is to cultivate themselves, rely on them, and whether they can feel that they deserve to be trusted. 2 Early childhood (autonomy versus shame, suspicion) At this time of the year, the infant has developed the muscle of the whole body including the anus sphincter, it comes to be able to walk standing by oneself, and it becomes possible to control the excretion. Whether it is possible to acquire the sense of autonomy through the experience of excretion and holding becomes important as a developmental problem. It is praised by parents if it is possible to excrete well, and the infant experiences an embarrassed feeling when failing. Moreover, it is time when the self insistence is started gradually, and it is sometimes observed to treat my excrement as a weapon as a means of the attack.
  • 42. Positive Liberty Should the Government Promote Positive Liberty? The idea of liberty, or freedom, varies between different theorists. One theorist, Isaiah Berlin, focused on the difference between two different ways of thinking about political liberty (Cherniss amp; Hardy, 2010). Berlin called these two different concepts negative and positive liberty. According to Berlin, negative freedom can be defined as freedom from , that is, freedom from constraint or interference of others. In contrast, positive freedom can be defined in two ways: freedom to , that is the ability to pursue and achieve willed goals; and also as autonomy or self rule, as opposed to the dependence on others (Cherniss amp; Hardy, 2010). Keeping the idea of positive liberty at ... Show more content on Helpwriting.net ... And are we to presume that if the law doesn t explicitly say we can do something, we are not allowed to do it? (Keong, 2007). Another concern expressed by Keong (2007) is the idea that positive liberty means we expect the state to hand us certain things on a silver platter. Positive liberty has been used as a platform to push through ideas such as the principle that everyone is entitled to a minimum income or standard of living, though not everyone is comfortable with the moral hazard this might evoke (Keong, 2007). Key questions asked with this in mind include; if you are guaranteed something, will you be willing to contribute back to society for it? Or, will you sit around and collect your entitlements? (Keong, 2007; Haworth, 1991). After going through what positive liberty is, examples of positive liberty and the debates surrounding positive liberty, the main question running through my head is whether the government should promote positive liberty? While I do acknowledge what Keong says about people expecting the state to hand entitlements over, I think that the government should promote positive liberty to maintain order within society. An image that runs through my head at the thought of the government not promoting positive liberty is one of anarchy. People can do whatever they like with no consequence which to me, breeds chaos all around. At least with positive liberty, people can do what
  • 43. The Media s Influence On Body Image America is obsessed with body image. In today s world, you can t go through the day without seeing the television, advertisements, magazines, or really any type of media portraying women s bodies. Due to the immense societal pressure that women should have the perfect body to be accepted, the nonstop reminders to change what they look like, struggling with bodyimage has now become a major social phenomenon and it s time for women to challenge that narrative. Women of all ages are facing face increasing scrutinization over their body image through media influence leading to invasive surgeries, increased depression, and eating disorders. Media plays a large role in influencing body shame through the advertisements they put out and who is casted for the lead roles. From weight loss commercials promoting the newest supplement to help lose those first thirty pounds to movies filled with beautiful, skinny, white actresses diversity in body type is not a narrative promoted by the... Show more content on Helpwriting.net ... America s poor body image can lead to an unhealthy lifestyle. The standards of how society views women as beautiful have changed throughout the years. Seeing constantly that only women who are a size two are considered beautiful doesn t make loving yourself easier. These issues cause depression and eating disorders among women and some extreme cases the criticism and self hatred lead to suicide. The reason often evolves from people picking on them and constantly being put down by the media. The media is mostly to blame for these false perceptions of beauty, through their advertisements and the type of women they cast for lead roles. Recently, there s been small movements of progress. More diverse women, ethnically diverse and bodily diverse, have been making waves. America must step up to the plate to challenge the media on the narrative they ve set forth for women s bodies. Ultimately, women must take back this
  • 44. Compare And Contrast How The Grinch Stole Christmas Comparing How the Grinch stole Christmas The Grinch Who stole Christmas has been a hit movie for decades. It started off as a book and was made into a cartoon and a movie. While the book and the movie have some differences the fact that the grinch is known to hate Christmas, he steals the presents from everyone and the setting is the same in both the book and the movie make them somewhat similar. The first similarity between the book and the movie is that the Grinch has been known to hate Christmas. The book states, The Grinch hated Christmas! The whole Christmas season! This is similar to the movie because in the movie the Grinch hates Christmas. When he was in school he was bullied around Christmas and he now hates all the Christmas activities.
  • 45. Explain The Four Kingdoms In The Book Of Daniel Discussion Board 1 In the Book of Daniel the 7th chapter it is record that Daniel mentioned four great kingdoms. The four great kingdoms that Daniel mentioned are Babylon, Medo Persia, Greece, and Rome. Daniel stated in detail that these four kingdoms would come out the earth. The Babylonian, Persian, Greek, and Roman empires were all different in size, power, and in many other ways. It is noted that Daniel use animal symbols to describe these four kingdoms. First, the Babylonia kingdom is represented by a lion that had wings like an eagle in which stood like a man on its two feet. It is imperative to state, The lion s wings being torn off speaks of the king s insanity and loss of power; standing on two feet like a man and receiving a human heart (mind) denotes Nebuchadnezzar s humanitarian rule after his insanity; and the lion being lifted up from the ground indicates that it was God who raised the king to his place of honor. Secondly, the Medo Persia kingdom is represented by a bear that had three ribs in its mouth, and it was commanded to devour all flesh. This command that was given means that this empire will conqueror other empires. Thirdly, the Greek Empire was represented by a leopard with four wings and four heads. The Greek... Show more content on Helpwriting.net ... Greece is aptly represented by this flying leopard, for its conquests were carried out with lightning speed, and it had an insatiable lust for territory. Fourth, the Roman Empire was exceeding different
  • 46. The Oedipal Complex Literary Analysis Many stories include a child who vies for their parent(s) attention. One being, Oedipus, by Sophocles, where Oedipus rivals his father, who he believes is a stranger, to gain the attention of his wife/mother. The idea of a child, mostly boys, trying to gain their parent(s) (who tend to be a mother more often than a father) attention is known as The Oedipal Complex , created by Sigmund Freud. The Oedipal Complex , is a theory of a developing of feelings a boy develops towards his mother. He then is against his father, or another male figure with his mother, and has jealousy or anger towards the man. Eventually the boy tries to rival the man for attention from his mother. The Oedipal Complex is very prominent in the short story, The Rocking HorseWinner , written by DH Lawerence. One of the protagonists, Paul, develops the idea in which he should raise money for his mother, since she considers herself unlucky . The mother, Hester, believes she is unlucky because herself and her husband work low income jobs which are unable to support their lavish tastes. Therefore, Paul is introduced to horse racing by his gardener, Basset, who bids on who he believes will win the races. Paul tells Basset who he wants to bid on, and Basset would go and put the bid down for Paul. One day Paul was discussing his connection with his gardener with his Uncle Oscar. His Uncle Oscar took Paul to his first race, they both bidded on Daffodil, who won the race, afterwards Uncle Oscar is included
  • 47. The History Of Art In Nebraska And The Great Plains Art in Nebraska and the Great Plains has been shaped by its diverse groups of inhabitants. Czechs are one of many groups who added and enhanced artistic endeavors inside Nebraska and the Great Plains. Czechs have a rich history of artistic pursuits. Famous musicians such as Dvorak and Smetana, and the country s long theatrical history have shaped Czech individuals. The arts are in many ways at the heart of Czech culture. Czechs brought this mindset with them into Nebraskaand the Great Plains. Czech immigration, during the 19th and 20th century, contributed to the culture and arts of Nebraska and the Great Plains as a whole; especially through music, theater, furniture making, and the Wilber Czech festival. A significant number of Czech... Show more content on Helpwriting.net ... Kucera states, Song and music at all times used to accompany man from the cradle to the grave and were a necessary accompaniment of all important family events. Instruments of note include bagpipes, violin, clarinet, brass instruments, and accordions. According to Barkan, Between 1899 1910... Musicians and actors made up an unusually high percentage (37 percent) of Czech professionals. Local bands, individuals, and outside traveling artists contributed to the popularity of Czech music within Nebraska and the Great Plains as a whole. Czech bands played a significant role in the Great Plains and Nebraska. The Baca Band of Fayetteville, Texas and the Pekar Band of Damon, Texas found success in the Great Plains. Similarly, Czech bands are intertwined in the history of Nebraska. For example, The Crete Orchestra used to drive to Lincoln back in Governor Butler s day and play at the dances in the capital. In addition, the Wilber band played for the second inauguration of Governor Butler. There were several notable individuals who contributed the spread of Czech music in Nebraska, one of which is Frank Nedela Sr. Nedela Sr. was a well known and respected musician who lived in Saline County Nedela s first band, the Nedela Pioneer Band, consisted of himself, his father, Thomas Aron, Joseph Chyba, and John Svoboda. It was this band that played for the second inauguration of Governor Butler. The band also played for weddings, dances, operas,
  • 48. Effects Of Depression On High Income Countries Depression, in general, affects more than 340 million people around the world and is reported to be the highest cause of disability in high income countries (Demissie). 15% to 85% of mothers can experience postpartum blues with postpartum depression rates between 11.7% and 20.4% in the United States alone (Ersek). This depression can occur at anytime from post delivery up to one year (Ersek). Giving birth comes with a wide variety of changes including physical, emotion and social. There are very high levels of sex hormones in circulation which cause increased ligament, joint and muscle laxity (Norman). Many women lose their social contacts due to upcoming life changes, must take time off work, and must stop previous hobbies (Norman). Relationship factors, hormone changes, sleep deprivation and support deeply effect a woman s self esteem and confidence during and after pregnancy (Norman). [Daley et al.] states that symptoms of postpartum depression include decreased mood, fatigue, anxiety, thoughts of self harm and poor mother infant interactions(change wording). Women with post partum depression have been reported to be at an increased risk for substance abuse, are more likely to miss gynecological and child health appointments, are more non compliant with medical recommendations and are less likely to use preventative safety items like car seats and outlet covers (Ersek). Researchers state that women with postpartum depression are less likely to breastfeed and more
  • 49. School Counselors I believe the next important ingredient for multicultural competence is cultural skills. A skilled counselor utilizes the interventions that are client based and which serve clients needs. A positive reaction would be to be connected to those different cultures communication is the key. In multicultural counseling the counselor needs to be more aware his or her limitations in counseling skills. I feel it s vital to have cultural skills in order to serve multicultural populations in the most productive way to facilitate. By being culturally aware and recognizing how culturewill affect the counseling process, this cultural awareness will support the counselor in developing an empathic understanding towards clients. In... Show more content on Helpwriting.net ... School Counselors job isn t to teach students moral rules and values or to prevent students from making their own choices based on their values. Admittedly, it can be a fine line to walk between not imposing our values yet helping students develop social skills and self understanding that will enhance their efforts to become successful adults. In the leadership role it s not up to the counselor to fix all problems. All through the years the role the school counselors play in using information uniquely available to them to examine and change current policy and practice. Whether it be course taking patterns, student placements, or student success and failure rates, school counselors are poised to be key change agents within the school. That is a big job that I feel school counselors don t get credit for enough. Many times, school counselors are told what to do by administrators who fail to understand the contribution the school counselor can make to the school. If anything that I feel I disagree is that credit that the counselors don t get. Some of the duties that have historically been assigned to the school counselor are data entry; clerical record keeping; registration and scheduling of all new students; coordinating or administering cognitive, aptitude and achievement tests; responsibility for signing excuses for students who are tardy or absent; performing disciplinary actions; sending students home who are not appropriately
  • 50. Essay on Aircraft Icing Abstract Aircraft icing is a common and major hazard to the aviation industry. Depending on conditions, icing may have very little or major impact to aircraft performance. The types of icing that form on and affect aircraft, the variables in how each type of icing is formed and the categories of severity will be discussed. Numerous methods of prevention and treatment exist and all pilots should be well versed in flight rules and regulations concerning avoidance and response to icing situations. Aircraft Icing Aircraft icing is nothing but trouble and a significant hazard to the aviation community. With the right upper level conditions, our winter season allows icing to occur when least expected and most pilots know very little ... Show more content on Helpwriting.net ... They are known as rime and clear ice, and a mixture of the two is not uncommon. For rime ice to form, an aircraft needs to fly through an area of tiny super cooled liquid drops. This super cooled liquid is actually suspended in the cloud cover at temperatures already below freezing. Once the aircraft surface plows through this moisture, the drops are disrupted immediately adhere to and freeze before spreading out over the entire surface. This forms a rough and cloudy white layer of ice known as rime. Even though the rime surface is rough and creates an airflow disturbance, it is lighter and easier to remove by deicing equipment than clear ice. For clear ice to form, larger sized super cooled drops would need to be encountered. These larger droplets spread out over the surface and airfoils before freezing. This allows for the build up of a clear, hard and slick layer of ice on the surface (Ahrens, 2009). There are four basic condition levels of icing. A slight trace may be unnoticeable, where a light accumulation might only be an issue during a very long flight through conditions and periodic use of anti icing equipment may be needed to rid any accumulation. A moderate build up could be hazardous to only short exposure and anti icing equipment and route deviation would be absolutely required. Severe conditions could not be controlled by icing removing systems and would be the most hazardous and would probably require immediate emergency
  • 51. Genetic Dna And Bioinformatics ( Accession No. Xp Essay RESULTS Isolation of BbovM17LAP gene The BbM17LAP gene available in GenBank (accession no. XP_001609968) was accessed through the National Center for Biotechnology Information (NCBI), and its sequence was retrieved for further analysis. The genomic DNA of BbM17LAP was found in chromosome 2, extending between 1,045,409 bp and 1,047,164 bp of the genome. The ORF of the corresponding mRNA encoding BbM17LAP consists of 1,578 bp. Alignment of the mRNA sequence with genomic DNA using Genetyx revealed that the gene has 4 introns within its ORF. The first one was a 33 bp intron (50 ggtatgtttgtttgaatactgctgaatctgtgta 30) situated near the 50 end of the gene. The other nucleotide sequences included a 35 bp (50 agatacttacagtaacgatacaagttcatgtaggt 30) intron, a 34 bp (50 tgggttacactctttatgctatatttgttatagg 30) intron, and a 40 bp (50 gtaagttaattgggctacaagaagcgtaatatacatacag 30) intron all located close to each other near the 30 end. Isolation of BbovM17LAP cDNA and bioinformatics analysis A pair of primers targeting the ORF of BbM17LAP was used to amplify and sequence the gene from a B. bovis cDNA expression library. This BbM17LAP cDNA encoded a predicted 55 kDa protein without a signal peptide. The translated BbM17LAP polypeptide shared significant homology with B. gibsoni M17LAP, having 71% amino acid identity and similarity (E valueВј0). The other significant homologues included Theileria parva and Theileria annulata M17 LAPs, both having 61% amino acid identities. The polypeptide
  • 52. Cohabitation- Wiki Cohabitation is an arrangement where two people who are not married live together in an intimate relationship, particularly an emotionally and/or sexually intimate one, on a long term or permanent basis Reasons for cohabitation When people have more personal freedoms, they seem to forget traditional morals one of which is not living together until they get married. Through press, we know that more and more young people cohabit nowadays, especially among students and industrial workers. Why do they do that? The first reason is free relationship. Usually, cohabitants are those who come to city from provinces, so they are free to make their own choices. When asked, they say thay they are not bound by their parents ... Show more content on Helpwriting.net ... When a couple is in love, love is wonderful. However, when they live together, they will interact each other more and more and discover many bad habits of their partner such as smoking, snoring, laziness, or speaking impolitely. It is easy to make them feel disappointed with their love heart. In addition, when a couple live together without marriage, they are usually dishonest. Both men and woman in cohabiting relationships are more likely to be unfaithful to their partner than married people. (Civitas)2. They will be unfaithful about their inner feelings or their finance. Therefore, they usually argue and then find a new lover easily. Another serious consequence is that cohabitation causes a lot of social evil. The most social evil is abortion. Rate of abortion in Vietnam is very high in the world. According to Family Planning Association, our country has about 1.2 to 1.6 million abortions each year, of which 20 percent of adolescent ages. There are many young girls who are in cohabiting relationship must abort because they do not have good methods of birth control (TT GD) 3. Abortion affects the women s health seriously. Many women who abort with unsafe conditions are usually infertility, even death. Broken cohabiting relationship and abortion not only affect women heath but also hurt women hearts. In naturally, they can not keep balance and focus on their work in their lives. As a result, many young
  • 53. Does Writing Down Notes On Paper More Effective Than... Does writing down notes on paper more effective than typing it? Cerebrum: The cerebrum is the main part of the brain, which has two halves, or hemispheres. The right hemisphere controls the left side of the body and deals with things such as creativity, music, and art. While the left hemisphere of the cerebrum controls the right side of the body and is in charge of language, problem solving, and math. The cerebrum s many tasks are carried out by its outer layer, or its cortex. This has distinct areas that have different roles. Motor areas trigger movement; sensory areas deal with the senses, while association areas clarify information. Cerebellum: The cerebellum is responsible for producing smooth, coordinated movements of the body. It analyzes incoming information about the body s current movement and position then interacts with the primary motor cortex to precisely time muscle contractions. Why does writing something down help us remember it better? Our brain is separated into several regions that undergo different kind of information. Then there are regions that process information such as visual, verbal communication, auditory, emotions, etc. These different regions communicate with each other and each one of them has its own processes it has to complete first. For example one looks at a piece of art and express their emotions with language, thus working the verbal function part of the brain. When we hear a lecture, the section of our brain that handles listening and
  • 54. Railroad Expansion In California California shifted greatly in its early years. From being predominantly inhabited by Native Americans, to being conquered by the Spanish, being declared a part of Mexico and finally being claimed by the United Stated in 1846. Shortly after, gold was discovered in the Sacramento Valley region and the population of Californiagrew by nearly 1,000% percent, with nearly 100,000 Anglos flocking to the area(History). The United Stateswould then acquire official statehood in 1850. In the pre war era, there were nearly 10,000 people of Spanish decent inhabiting California. However, in 1850 the percentage of people that spoke Spanish in California was at 15%. Yet it would soon drop yet again to a dismal 4% by 1870 (Pitti). Claremont s own development would be somewhat of a subset of the Gold Rush, receiving the after affects. Railroad expansions would bustle through California mainly in the North, but also the South (Wright 20). Claremont s genesis can be attribute to the Pacific Land and Improvement Company, which bought the land on ... Show more content on Helpwriting.net ... With the city of Claremont growing, there was a need to educate the youth that inhabited the newly developed city. In 1890 Sycamore was the first school to open its doors, though at the time it was referred to as Claremont Grammar School (Wright 90). The next school to open in Claremont would be Claremont High School, officially opening in 1911 in a student body of around 120 people. Its first publication of the school Yearbook, El Espirirtu (then called Annual ) would be in 1912, sparking a near one hundred year tradition of recording history. With weak bindings, black and white pages and only about 40 pages worth of content, the first yearbooks were dismal at best. A look inside of the early books would reveal a lot about how Claremont operated and why it was like it
  • 55. Herberger And Hale Hale s production of You Can t Take It With You was breathtaking with its core concepts, portrayal of emotion, and plot. When comparing this with Herberger s production of You Can t Take It With You, you can begin to see the ideas mixing together as they bounce of one another so well. However, not all things were exactly alike in the two seemingly identical versions of the same play. The first concept in which ideas were ever changing was the interpretation of characters in both plays. In Hale s production, Grandpa as seen as an slow, semi serious man; but when looking at Grandpa in Herberger s production, you can see him as a more of a lively, humorous character. This change in portrayal can also be seen in Rheba. In Herberger s play,... Show more content on Helpwriting.net ... Some props that I felt were used differently in both productions mostly pertain to the aspect of music. In the Herberger s production of You Can t Take It With You, music is incorporated a lot in ways such as commercials, cello, and guitar. Hale s show lacked all of these elements that I felt really helped contribute to the sense of family and fellowship in You Can t Take It With You. By incorporating the commercials, the audience could effectively be transported to a place in which it is 1938. This really helped change the mindset of the audience into allowing them to connect with the characters in the production on a deeper level. The guitar was also very important, because it also introduce a new member into this family. By adding the guitar, Herberger s production was able to give the Vanderhoff s a range of kindness/generosity. This showed the audience that the Vanderhoff s would take in anyone no matter background, personality, or timing of arrival. This really secured the bond in this wonderfully bizarre group of people, allowing a connection to be formed between the audience and