The TRP53 gene contains 11 exons and 10 introns. Exon 1 is 128 base pairs and exon 11 is 523 base pairs, which is the longest exon. The introns range in size from 5 base pairs to 793 base pairs. The gene is located on chromosome 11 in humans and encodes a tumor protein involved in regulating the cell cycle and suppressing tumor formation.
This document contains a list of networking device identifiers, IP addresses, and other technical information. It includes identifiers for routers, switches, firewalls, and other networking gear from various vendors like Cisco, Juniper, Fujitsu, and more. Locations and organizations are also referenced, such as NEC, Life Sciences, and NOC control rooms. Prefixes, subnets, and VLANs are defined throughout.
The document appears to be a list of networking equipment, locations, and configurations. It includes abbreviations and codes for different devices, ports, and network segments. Specific devices, ports, and addresses are listed along with location codes like "podx" and network prefixes like "45/8". Cost values and priority numbers are also included for certain network segments.
Mathematics is an important subject in school. Studying mathematics helps develop logical thinking and problem-solving skills. There are four main topics covered in mathematics - numbers, geometry, algebra, and statistics. Learning mathematics involves understanding basic concepts and then building upon them through practice of various questions and problems over time.
This document discusses simple connections and bolted shear connections. It introduces different types of simple connections using plates and various steel shapes. It then focuses on bolted shear connections, explaining the failure modes of bearing on the bolt or shear of the bolt. Equations for determining the shear capacity of a bolted connection based on bolt diameter and shear area are provided. Examples of single shear and double shear lap joints are shown and how to calculate their shear capacities. Overall, the document provides an overview of simple connections and bolted shear connections, emphasizing proper design to avoid failure.
These three sentences summarize the key ideas from the Khmer proverbs document:
The proverbs provide advice and wisdom on various topics such as relationships, morality, politics, and daily life. Common themes include working hard, respecting others, and accepting both good and bad fortunes with patience and resilience. The proverbs offer insights into traditional Khmer culture and values.
On chromosome 2 of one organism, there is a gene with 1,567 nucleotides that codes for a growth protein and results in a short, stout body size. However, in another organism, a mutation was found where a series of nucleotides was duplicated, altering the gene such that it now produces a short, thin body instead of the typical short, stout body.
1. The sampling distribution for the sample means describes the distribution of sample means that would be obtained by taking all possible samples of a given size from a population.
2. It shows that as more samples are taken, the sample means will cluster more closely around the population mean.
3. The central limit theorem states that the sampling distribution for the sample means will be approximately normally distributed for large sample sizes, regardless of the distribution of the population.
1. Shear and diagonal tension are two failure modes of reinforced concrete beams. Shear failure occurs when the shear stresses exceed the shear capacity of the beam. Diagonal tension failure occurs due to cracking along a diagonal plane.
2. Shear stresses can be calculated using equilibrium equations that relate applied shear, shear capacity, and section properties. The shear capacity is generally limited to less than 1.5 times the square root of the concrete compressive strength.
3. Shear reinforcement such as stirrups or bent bars is used to improve the ductility and increase the shear capacity of beams subjected to high shear stresses. Codes specify minimum shear reinforcement ratios to prevent brittle shear failures.
This document contains a list of networking device identifiers, IP addresses, and other technical information. It includes identifiers for routers, switches, firewalls, and other networking gear from various vendors like Cisco, Juniper, Fujitsu, and more. Locations and organizations are also referenced, such as NEC, Life Sciences, and NOC control rooms. Prefixes, subnets, and VLANs are defined throughout.
The document appears to be a list of networking equipment, locations, and configurations. It includes abbreviations and codes for different devices, ports, and network segments. Specific devices, ports, and addresses are listed along with location codes like "podx" and network prefixes like "45/8". Cost values and priority numbers are also included for certain network segments.
Mathematics is an important subject in school. Studying mathematics helps develop logical thinking and problem-solving skills. There are four main topics covered in mathematics - numbers, geometry, algebra, and statistics. Learning mathematics involves understanding basic concepts and then building upon them through practice of various questions and problems over time.
This document discusses simple connections and bolted shear connections. It introduces different types of simple connections using plates and various steel shapes. It then focuses on bolted shear connections, explaining the failure modes of bearing on the bolt or shear of the bolt. Equations for determining the shear capacity of a bolted connection based on bolt diameter and shear area are provided. Examples of single shear and double shear lap joints are shown and how to calculate their shear capacities. Overall, the document provides an overview of simple connections and bolted shear connections, emphasizing proper design to avoid failure.
These three sentences summarize the key ideas from the Khmer proverbs document:
The proverbs provide advice and wisdom on various topics such as relationships, morality, politics, and daily life. Common themes include working hard, respecting others, and accepting both good and bad fortunes with patience and resilience. The proverbs offer insights into traditional Khmer culture and values.
On chromosome 2 of one organism, there is a gene with 1,567 nucleotides that codes for a growth protein and results in a short, stout body size. However, in another organism, a mutation was found where a series of nucleotides was duplicated, altering the gene such that it now produces a short, thin body instead of the typical short, stout body.
1. The sampling distribution for the sample means describes the distribution of sample means that would be obtained by taking all possible samples of a given size from a population.
2. It shows that as more samples are taken, the sample means will cluster more closely around the population mean.
3. The central limit theorem states that the sampling distribution for the sample means will be approximately normally distributed for large sample sizes, regardless of the distribution of the population.
1. Shear and diagonal tension are two failure modes of reinforced concrete beams. Shear failure occurs when the shear stresses exceed the shear capacity of the beam. Diagonal tension failure occurs due to cracking along a diagonal plane.
2. Shear stresses can be calculated using equilibrium equations that relate applied shear, shear capacity, and section properties. The shear capacity is generally limited to less than 1.5 times the square root of the concrete compressive strength.
3. Shear reinforcement such as stirrups or bent bars is used to improve the ductility and increase the shear capacity of beams subjected to high shear stresses. Codes specify minimum shear reinforcement ratios to prevent brittle shear failures.
This document provides details on types of stairs and their components. It discusses:
1) Six common types of stairs including single-flight, double-flight, three or more flight, cantilever, precast flights, and free standing stairs.
2) Stair components like risers, treads, and landings and design considerations for each.
3) Additional stair types like run-riser stairs that have proportional risers and treads.
This document provides information on deflection and the elastic curve. It discusses the moment-area method and conjugate beam method for calculating deflection. It also describes using a deflection diagram to represent the elastic curve. The document contains diagrams showing examples of beams with loads and supports, along with the corresponding bending moment and deflection diagrams. Equations for calculating deflection due to bending are also presented.
1. There are several types of retaining walls, including gravity walls, semi-gravity walls, cantilever retaining walls, counterfort retaining walls, and buttressed retaining walls.
2. Forces acting on retaining walls include active and passive soil pressures. Active pressure is exerted by soil pushing on the front face of the retaining wall, while passive pressure acts on the back side of the wall from soil resistance.
3. The magnitude of active and passive soil pressures depends on factors like the soil type, depth of soil, and angle of internal friction of the soil. Formulas developed by Rankine and Coulomb are commonly used to calculate active and passive pressures.
This document provides instructions on using various commands and tools in Autodesk 3ds Max for geometry creation, modification, and rendering. It covers topics such as viewports, basic geometric shapes like boxes and spheres, splines, mesh editing, modifiers, and lighting/camera settings. Step-by-step explanations are provided for commands to create, manipulate, and render 3D models. The document is intended as a tutorial for learning essential 3ds Max functions.
1. The document discusses torsional moments in beams. It introduces torsion and provides equations to calculate the torsional moment (T) in beams.
2. Formulas are given to calculate T based on the shear force (V) distribution in different beam sections like rectangular and circular. The maximum shear stress (vmax) is calculated from T.
3. For rectangular sections, a modification factor (α) is used to calculate vmax based on the ratio of y/x dimensions. For typical beam sections, α ranges from 0.2 to 0.3.
1. The document discusses the design of reinforced concrete columns under axial load.
2. It provides guidelines on column dimension, reinforcement ratio, and confining reinforcement according to ACI code.
3. Formulas for calculating the nominal axial load capacity of a column based on its cross-sectional area and steel reinforcement are presented.
This document discusses leadership and leadership styles. It provides three examples of leadership styles:
1) Traditional leadership focuses on hierarchy, rules, and maintaining the status quo.
2) Transactional leadership focuses on supervision and contingent rewards or punishment.
3) Transformational leadership inspires followers and focuses on innovation, adaptation, and change.
Transformational leadership allows an organization to evolve and adapt to new challenges. It seems to be the most effective long-term approach to leadership.
PlayStation 4 で考えるゲームとクラウドの関係 - JAWS-UG Aomori #3Eikichi Gotoh
The document discusses Eikichi Gotoh, the director of JAWS Aomori #3. It provides details about Gotoh such as him being from Miyagi Prefecture and his involvement with the JAWS user group. It then covers a topic about the relationship between games and cloud computing using the PlayStation 4 and Battlefield 4 as examples. DNS lookups are performed on related domains to analyze where the servers are hosted. The domains are found to use AWS, Akamai, and other cloud providers.
The document contains a series of hyperlinks and embedded videos and images. It appears to be sharing content from a YouTube channel called "Word 2 Tha Mutha! Movie: Pt.37" that includes videos, images, and links to slideshow presentations on various topics. The hyperlinks and embedded media are the main focus, with little surrounding text content.
La auditoría en Windows Server 2008 R2 permite registrar eventos de seguridad como modificaciones de archivos o políticas a través de un registro de auditoría. Esto muestra la acción, usuario, fecha y hora. Se requiere un plan de auditoría que incluye diseñar, implementar y monitorear tipos de eventos, así como ver el éxito o fracaso de inicios de sesión y otros eventos a través del visor de eventos y registro de seguridad. Solo los administradores pueden configurar la auditoría.
Este documento describe los diferentes tipos de movimiento rectilíneo, incluyendo el movimiento rectilíneo uniforme, el movimiento rectilíneo uniformemente acelerado, y el movimiento armónico simple unidimensional, señalando que en el movimiento rectilíneo uniformemente acelerado la aceleración es constante.
Este documento resume la anatomía y posibles patologías de las vías biliares. Describe los métodos de imagen utilizados para evaluar las vías biliares y define la dilatación de éstas como diámetros superiores al 40% de la vena porta adyacente o cuando el coledoco mide más de 6-7 mm. También menciona enfermedades benignas y malignas que pueden afectar las vías biliares como coledocolitiasis, colangitis esclerosante primaria, asociada al SIDA y colangiocarcinoma
La familia en la determinación de salud y bienestar del paciente.franco barraza
a continuación se expondremos como la familia en la determinación de salud influye en el bienestar del paciente. Con una experiencia vivida en la practica hospitalaria.
A/B testing involves comparing two versions of a web page (Version A and Version B) to determine which performs better. It directly tests changes to a website or app by showing each version to similar visitors and measuring which has a higher conversion rate. Testing removes guesswork from optimization by providing data on how changes impact metrics. The process involves studying data, observing user behavior, constructing a hypothesis, testing the hypothesis through an A/B test, and analyzing results to determine if a variation improved conversions.
Este documento describe las capacidades físicas básicas necesarias para realizar cualquier actividad física o deportiva, incluyendo la resistencia, fuerza, flexibilidad y velocidad. Se enfoca específicamente en la resistencia y flexibilidad, definiéndolas, explicando sus tipos y cómo se pueden entrenar y mejorar a través del ejercicio regular.
Masters’ reincarnation handbook journey of the soulThelma Belmonte
Este documento é um resumo de três frases do livro "O Manual da Reencarnação dos Mestres", que discute a jornada da alma da sua dimensão espiritual de origem ("Lar") para a Terra e de volta. Os principais pontos são: 1) As almas são fragmentos da Fonte, uma presença divina, que experimentam a dualidade na Terra para ganhar sabedoria. 2) O Lar é o reino espiritual de onde as almas vêm e para onde retornam. 3) A razão para a encarnação é para as al
Los estudiantes realizaron una práctica para determinar el grado de toxicidad y el tiempo de acción de una solución saturada de cloruro de estaño en una rata cuando se administra por vía peritoneal. Observaron síntomas de somnolencia en la rata que murió 27 minutos después de la inyección, y sus órganos internos se volvieron blancos, indicando coagulación de la sangre. Llevaron a cabo pruebas químicas que confirmaron la presencia de estaño en los tejidos.
La historia de la radio comienza con varias contribuciones tecnológicas a lo largo del tiempo que llevaron al desarrollo de la telegrafía sin hilos y las ondas electromagnéticas. Originalmente controlada por los estados para usos militares y políticos, la radio eventualmente se utilizó para fines comerciales. Más recientemente, la radio analógica ha dado paso a la radio digital, que ofrece una calidad de sonido comparable a los CDs.
O AquaDom no Radisson Hotel em Berlim é o maior aquário cilíndrico do mundo, construído com acrílico ultra resistente fundido localmente. Dentro do cilindro há um elevador panorâmico que dá aos visitantes a impressão de estarem submersos ou a bordo de um submarino, enquanto bombas poderosas e controle computadorizado mantêm mais de 8 milhões de litros de água salgada para os peixes.
This document provides details on types of stairs and their components. It discusses:
1) Six common types of stairs including single-flight, double-flight, three or more flight, cantilever, precast flights, and free standing stairs.
2) Stair components like risers, treads, and landings and design considerations for each.
3) Additional stair types like run-riser stairs that have proportional risers and treads.
This document provides information on deflection and the elastic curve. It discusses the moment-area method and conjugate beam method for calculating deflection. It also describes using a deflection diagram to represent the elastic curve. The document contains diagrams showing examples of beams with loads and supports, along with the corresponding bending moment and deflection diagrams. Equations for calculating deflection due to bending are also presented.
1. There are several types of retaining walls, including gravity walls, semi-gravity walls, cantilever retaining walls, counterfort retaining walls, and buttressed retaining walls.
2. Forces acting on retaining walls include active and passive soil pressures. Active pressure is exerted by soil pushing on the front face of the retaining wall, while passive pressure acts on the back side of the wall from soil resistance.
3. The magnitude of active and passive soil pressures depends on factors like the soil type, depth of soil, and angle of internal friction of the soil. Formulas developed by Rankine and Coulomb are commonly used to calculate active and passive pressures.
This document provides instructions on using various commands and tools in Autodesk 3ds Max for geometry creation, modification, and rendering. It covers topics such as viewports, basic geometric shapes like boxes and spheres, splines, mesh editing, modifiers, and lighting/camera settings. Step-by-step explanations are provided for commands to create, manipulate, and render 3D models. The document is intended as a tutorial for learning essential 3ds Max functions.
1. The document discusses torsional moments in beams. It introduces torsion and provides equations to calculate the torsional moment (T) in beams.
2. Formulas are given to calculate T based on the shear force (V) distribution in different beam sections like rectangular and circular. The maximum shear stress (vmax) is calculated from T.
3. For rectangular sections, a modification factor (α) is used to calculate vmax based on the ratio of y/x dimensions. For typical beam sections, α ranges from 0.2 to 0.3.
1. The document discusses the design of reinforced concrete columns under axial load.
2. It provides guidelines on column dimension, reinforcement ratio, and confining reinforcement according to ACI code.
3. Formulas for calculating the nominal axial load capacity of a column based on its cross-sectional area and steel reinforcement are presented.
This document discusses leadership and leadership styles. It provides three examples of leadership styles:
1) Traditional leadership focuses on hierarchy, rules, and maintaining the status quo.
2) Transactional leadership focuses on supervision and contingent rewards or punishment.
3) Transformational leadership inspires followers and focuses on innovation, adaptation, and change.
Transformational leadership allows an organization to evolve and adapt to new challenges. It seems to be the most effective long-term approach to leadership.
PlayStation 4 で考えるゲームとクラウドの関係 - JAWS-UG Aomori #3Eikichi Gotoh
The document discusses Eikichi Gotoh, the director of JAWS Aomori #3. It provides details about Gotoh such as him being from Miyagi Prefecture and his involvement with the JAWS user group. It then covers a topic about the relationship between games and cloud computing using the PlayStation 4 and Battlefield 4 as examples. DNS lookups are performed on related domains to analyze where the servers are hosted. The domains are found to use AWS, Akamai, and other cloud providers.
The document contains a series of hyperlinks and embedded videos and images. It appears to be sharing content from a YouTube channel called "Word 2 Tha Mutha! Movie: Pt.37" that includes videos, images, and links to slideshow presentations on various topics. The hyperlinks and embedded media are the main focus, with little surrounding text content.
La auditoría en Windows Server 2008 R2 permite registrar eventos de seguridad como modificaciones de archivos o políticas a través de un registro de auditoría. Esto muestra la acción, usuario, fecha y hora. Se requiere un plan de auditoría que incluye diseñar, implementar y monitorear tipos de eventos, así como ver el éxito o fracaso de inicios de sesión y otros eventos a través del visor de eventos y registro de seguridad. Solo los administradores pueden configurar la auditoría.
Este documento describe los diferentes tipos de movimiento rectilíneo, incluyendo el movimiento rectilíneo uniforme, el movimiento rectilíneo uniformemente acelerado, y el movimiento armónico simple unidimensional, señalando que en el movimiento rectilíneo uniformemente acelerado la aceleración es constante.
Este documento resume la anatomía y posibles patologías de las vías biliares. Describe los métodos de imagen utilizados para evaluar las vías biliares y define la dilatación de éstas como diámetros superiores al 40% de la vena porta adyacente o cuando el coledoco mide más de 6-7 mm. También menciona enfermedades benignas y malignas que pueden afectar las vías biliares como coledocolitiasis, colangitis esclerosante primaria, asociada al SIDA y colangiocarcinoma
La familia en la determinación de salud y bienestar del paciente.franco barraza
a continuación se expondremos como la familia en la determinación de salud influye en el bienestar del paciente. Con una experiencia vivida en la practica hospitalaria.
A/B testing involves comparing two versions of a web page (Version A and Version B) to determine which performs better. It directly tests changes to a website or app by showing each version to similar visitors and measuring which has a higher conversion rate. Testing removes guesswork from optimization by providing data on how changes impact metrics. The process involves studying data, observing user behavior, constructing a hypothesis, testing the hypothesis through an A/B test, and analyzing results to determine if a variation improved conversions.
Este documento describe las capacidades físicas básicas necesarias para realizar cualquier actividad física o deportiva, incluyendo la resistencia, fuerza, flexibilidad y velocidad. Se enfoca específicamente en la resistencia y flexibilidad, definiéndolas, explicando sus tipos y cómo se pueden entrenar y mejorar a través del ejercicio regular.
Masters’ reincarnation handbook journey of the soulThelma Belmonte
Este documento é um resumo de três frases do livro "O Manual da Reencarnação dos Mestres", que discute a jornada da alma da sua dimensão espiritual de origem ("Lar") para a Terra e de volta. Os principais pontos são: 1) As almas são fragmentos da Fonte, uma presença divina, que experimentam a dualidade na Terra para ganhar sabedoria. 2) O Lar é o reino espiritual de onde as almas vêm e para onde retornam. 3) A razão para a encarnação é para as al
Los estudiantes realizaron una práctica para determinar el grado de toxicidad y el tiempo de acción de una solución saturada de cloruro de estaño en una rata cuando se administra por vía peritoneal. Observaron síntomas de somnolencia en la rata que murió 27 minutos después de la inyección, y sus órganos internos se volvieron blancos, indicando coagulación de la sangre. Llevaron a cabo pruebas químicas que confirmaron la presencia de estaño en los tejidos.
La historia de la radio comienza con varias contribuciones tecnológicas a lo largo del tiempo que llevaron al desarrollo de la telegrafía sin hilos y las ondas electromagnéticas. Originalmente controlada por los estados para usos militares y políticos, la radio eventualmente se utilizó para fines comerciales. Más recientemente, la radio analógica ha dado paso a la radio digital, que ofrece una calidad de sonido comparable a los CDs.
O AquaDom no Radisson Hotel em Berlim é o maior aquário cilíndrico do mundo, construído com acrílico ultra resistente fundido localmente. Dentro do cilindro há um elevador panorâmico que dá aos visitantes a impressão de estarem submersos ou a bordo de um submarino, enquanto bombas poderosas e controle computadorizado mantêm mais de 8 milhões de litros de água salgada para os peixes.
A Manobra de Heimlich é uma técnica que salva vidas ao desobstruir as vias respiratórias de uma pessoa que esteja engasgada. A manobra envolve abraçar a pessoa por trás, fechar os punhos sobre o abdômen e realizar compressões rápidas para expelir o objeto preso.
El documento describe la educación medieval en Europa, incluyendo el nacimiento de las primeras universidades en París y Bolonia, las asociaciones estudiantiles como los colegios residenciales y las naciones, y los debates escolásticos promovidos por figuras como Tomás de Aquino. La educación se centraba en las artes, la teología y el derecho y estaba dominada por la Iglesia católica.
Este documento apresenta um roteiro sobre buffer overflow, descrevendo seu contexto histórico, funcionamento, ferramentas como Metasploit e Nessus, e tipos de ataques como stack e heap-based. Inclui um estudo de caso explorando vulnerabilidades com Nessus e invadindo um sistema usando um exploit.
Este documento describe los objetivos, valores y fortalezas de una persona para lograr sus metas. La persona desea fortalecerse, modificar su carácter y conducta para madurar y alcanzar su objetivo principal de convertirse en un gran ingeniero mecatrónico. Enumera sus fortalezas como ser positivo, perseverante y detectar errores, así como sus debilidades, oportunidades y amenazas. El documento concluye que este proyecto de autorreflexión ayudó a la persona a conocerse mejor para determinar si sus objetivos realmente le convienen
O documento apresenta imagens de crianças, paisagens e animais que provocam emoções. As imagens da natureza são serenas e amizades e amor estão presentes.
El documento describe las políticas del estado venezolano para fomentar la ciencia y tecnología, incluyendo la Ley Orgánica de Ciencia, Tecnología e Innovación y el Cuarto Plan Nacional de Ciencia, Tecnología e Innovación. Se detalla que la Corporación para el Desarrollo Científico y Tecnológico y el Observatorio Nacional en Ciencia, Tecnología e Innovación serán las instituciones encargadas de realizar convocatorias y seleccionar proyectos de innovación tecnológica
La PAES evalúa los objetivos alcanzados por los estudiantes en el nivel medio y sus conocimientos y destrezas en cuatro asignaturas básicas. La prueba mide el logro del sistema educativo salvadoreño e informa sobre los aprendizajes y deficiencias para mejorar la educación. La PAES 2012 evalúa competencias como razonamiento matemático, análisis de problemática social, comprensión lectora y razonamiento científico.
A literatura de cordel é uma poesia popular brasileira originalmente oral e depois impressa em folhetos baratos. Os cordelistas recitam os poemas rimados de 6 a 10 versos acompanhados de viola para vender os folhetos. O filme O Auto da Compadecida utilizou a literatura de cordel e novelas de cavalaria em sua narrativa e diálogos.
This document provides instructions for transforming Lactobacillus bacteria using electroporation. Key steps include inoculating a bacterial culture, harvesting cells at stationary phase, washing the cells, subjecting them to thermal shock and electroporation with plasmid DNA, incubating to allow for expression, then plating and selecting for transformed colonies using antibiotic resistance. The overall process is estimated to take 3-4 days.
https://drive.google.com/file/d/1KZv5-7DIEMfV-94oNqoLBBEWfW5mz0HJ/view?usp=sharing
Tecnica delle Costruzioni II A.A. 2010/11
Prof. Ing. Franco Bontempi - 12 maggio 2011
This document provides instructions for locating a gene sequence from an online database and modifying it for a student project. It describes searching for the TERT gene on chromosome 5, which is 4,020 nucleotides long and codes for an enzyme involved in telomere maintenance. It then discusses how the student could modify the gene details to describe a fictional gene for "skin spot color" in their organism. The document ends by showing the original 720 nucleotide sequence of this gene and noting that an identical sequence was found in another species, implying a mutation occurred.
how to analyze the data which is available with the wet lab results and we can analyze more by using bioinformatics tools. here we can learn how to analyze the unknown data.
https://drive.google.com/file/d/1y12VZWGuOhfJpnFVSN_OfDCrCupgIt6i/view?usp=sharing
Tecnica delle Costruzioni II A.A. 2010/11
Prof. Ing. Franco Bontempi - 13 maggio 2011
1. Sequence analysis was performed on DNA from Glycine max (soybean) cultured cells using T3 and T7 primers, and the resulting sequences were edited and aligned.
2. The edited sequences showed high similarity, with some discrepancies, and contained restriction enzyme cut sites for EcoRI and XhoI as well as a polyA tail.
3. Multiple sequence alignments identified differences between the T3 and T7 sequences, with the greatest similarity from positions 51-900.
This long document discusses technical destruction and reconstruction in France following World War II. It describes the extensive damage to infrastructure across the country and the monumental efforts by Professor Ing and others to rebuild and restore structures. Reconstruction involved repairing damaged buildings, roads, bridges and other facilities over many years through large-scale projects.
The Smith-Waterman algorithm performs local sequence alignment to determine similar regions between two strings of nucleic acid or protein sequences. It works by calculating a similarity score between the elements of the two sequences while penalizing gaps. The algorithm fills a matrix by iteratively calculating the maximum similarity score between subsets of the sequences. It has a time complexity of O(nm) where n and m are the lengths of the two sequences.
https://drive.google.com/file/d/1CUoj9xqClLAF4KcriFUMQ-U67GNZuiFe/view?usp=sharing
Tecnica delle Costruzioni II A.A. 2010/11
Prof. Ing. Franco Bontempi - 29 aprile 2011, 2a parte
Bioinformetics - genetic variation between haemoglobin protein of humans and ...Aniket Bagul
This document contains two DNA sequences that are likely variants of the same gene. The sequences share many similarities, with only a few nucleotide differences. They both encode for a putative protein with a high degree of sequence identity. Overall, this suggests that the two sequences are alleles of the same gene found in different individuals.
Metagenomic projects provide a unique window into the genetic composition of microbial communities. To date, metagenomic analyses have focused primarily on studying the composition of microbial populations and inferring shared metabolic pathways. In this work we analyze how high-quality metagenomic data can be leveraged to infer the composition of transcriptional regulatory networks through a combination of in silico and in vitro methods. Using the SOS response as a case example, we analyze human gut microbiome data to determine the composition of the SOS meta-regulon in a natural context. Our analysis provides proof of concept that the existing knowledgebase on regulatory networks and reference genomes can be effectively leveraged to mine meta-genomic data and reconstruct multi-species regulatory networks. This approach allows us to identify de novo the core elements of the human gut SOS meta-regulon, highlighting the relevance of error-prone polymerases in this stress response, and identifies putative novel SOS protein clusters involved in cell wall biogenesis, chromosome partitioning and restriction modification. The methodology implemented in this work can be applied to other metagenomic datasets and transcriptional systems, potentially providing the means to compare regulatory networks across metagenomes. The use of metagenomic data to analyze transcriptional regulatory networks provides a realistic snapshot of these systems in their natural context and allows probing at their extended composition in non-culturable organisms, yielding insights into their interconnection and into the overall structure of transcriptional systems in microbiomes.
‘Omic’ technologies are primarily aimed at the universal detection of genes (genomics), mRNA (transcriptomics),
proteins (proteomics) and metabolites (metabolomics) in a specific biological sample.
https://drive.google.com/file/d/1nBphICE5wpp013JSnRqE6k-EFkrd2700/view?usp=sharing
Tecnica delle Costruzioni II A.A. 2010/11
Prof. Ing. Franco Bontempi - 27 maggio 2011
Fast qPCR assay optimization and validation techniques for HTS discusses steps for designing a successful qPCR assay, including:
1) Designing primers after running a BLAST search to check for homologous sequences and secondary structures in the target cDNA that could interfere with amplification.
2) Testing primer pairs through a temperature gradient and dilution series to validate the assay's dynamic range before running it hundreds or thousands of times.
3) Choosing an amplicon size between 75-200bp ideally, though larger sizes are possible with new fast reagents. Following these steps at the beginning leads to more effective analysis later.
https://drive.google.com/file/d/1ZktpAQK9x0pAWGiYclbV_yzkNqMl-HZU/view?usp=sharing
Tecnica delle Costruzioni II A.A. 2010/11
Prof. Ing. Franco Bontempi - 6 maggio 2011
https://drive.google.com/file/d/1g6PKU7JBCoW9Q5opi7gC1oGoGGEKa8jA/view?usp=sharing
Tecnica delle Costruzioni II A.A. 2010/11
Prof. Ing. Franco Bontempi - 29 aprile 2011, 1a parte
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationTyler Liang
This document describes site-directed mutagenesis experiments performed on beta-2 microglobulin (β2m) to study its role in amyloidosis. Primers were designed to introduce mutations D39V and I5T into β2m. Polymerase chain reaction and transformation were used to generate mutant plasmids, which were sequenced to confirm the mutations. Future studies are planned to introduce mutations W61F and W96F to further study β2m stability and aggregation.
The document describes the process of transcription and translation in a cell. It shows how DNA is transcribed into mRNA by RNA polymerase in the nucleus. The mRNA is then exported through the nuclear pore into the cytoplasm. In the cytoplasm, ribosomes translate the mRNA into a protein by linking amino acids specified by the mRNA codons.
A mutation occurred in a gene on chromosome 11 that is normally 3,961 nucleotides in length and codes for whether feathers have a waxy waterproof coating. This gene showed up twice in the sequence. The result of this mutation was that waxy, waterproof feathers covered only the wings of the organism, while non-waterproof feathers covered the rest of the body.
https://drive.google.com/file/d/16IL54XqwV7MpNrtQjjwvLwWmN2ubA75v/view?usp=sharing
Tecnica delle Costruzioni II A.A. 2010/11
Prof. Ing. Franco Bontempi - 20 maggio 2011
1. Allegato 2
Schema della struttura del gene TRP53
Legenda:
Regione esonica non tradotta
Regione esonica tradotta
Regione intronica
Struttura del gene Trp53 (Mus Musculus)
5' ..........gggggttgctgggattgggactttcccctcccacgtgctcaccctgg
downstream cta
sequence
Exon Lunghezza(nt)
1 128 AAGTTCTGTAGCTTCAGTTCATTGGGACCATCCTGGCTGTAGGTAGCGACTACAGTTAGG
GGGCACCTAGCATTCAGGCCCTCATCCTCCTCCTTCCCAGCAGGGTGTCACGCTTCTCCG
AAGACTGG
Intron 6,37 gtaagtaattgatgagcgtgacgagacctctcggtcactggctctctccgtttgcatcca
1-2 5 taaaactagagaaaaccgtggggtttgggggtggggcagt....................
....................attctaccctttcctataagccataggggtttgtttgttt
gtatgttttttaattgacaagttatgcatccatacagtacacaatctcttctctctacag
2 83 ATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAGCCAGGAG
ACATTTTCAGGCTTATGGAAACT
Intron 283 gtgagtggatctttttggggcccttaagatacatcccgccatacctgtatcctccccttg
2-3 cctgagagaaacaaaaacagtagtgttcaaacatggtatg....................
....................tgactacatagcaagttggaggccagcctgggataagtga
gattctgtcttcaaaaaatggaaggaaatcaggaactaactctctgctcttgttttccag
3 22 ACTTCCTCCAGAAGATATCCTG
Intron 93 gtaaggcccagagcagaaagggacttgggctttggtgttgggtggtaggctgagaacac
3-4 agtcctgagggttcttctttgtcccatccacag
4 261 CCATCACCTCACTGCATGGACGATCTGTTGCTGCCCCAGGATGTTGAGGAGTTTTTTGAA
GGCCCAAGTGAAGCCCTCCGAGTGTCAGGAGCTCCTGCAGCACAGGACCCTGTCACCGAG
ACCCCTGGGCCAGTGGCCCCTGCCCCAGCCACTCCATGGCCCCTGTCATCTTTTGTCCCT
TCTCAAAAAACTTACCAGGGCAACTATGGCTTCCACCTGGGCTTCCTGCAGTCTGGGACA
GCCAAGTCTGTTATGTGCACG
Intron 731 gtgagtgggccccggggagttgtctttcgtgtgacctttcaatgcctctttttctctgtc
4-5 tagatttgggggttcctcttcagcctgtagactgtgcctc....................
....................tccaatggtgcttggacaatgtgtttcattagttccccac
cttgacacctgatcgttactcggcttgtccccgacctccgttctctctcctctcttccag
5 184 TACTCTCCTCCCCTCAATAAGCTATTCTGCCAGCTGGCGAAGACGTGCCCTGTGCAGTTG
TGGGTCAGCGCCACACCTCCAGCTGGGAGCCGTGTCCGCGCCATGGCCATCTACAAGAAG
TCACAGCACATGACGGAGGTCGTGAGACGCTGCCCCCACCATGAGCGCTGCTCCGATGGT
GATG
Intron 78 gtaagccctcaacaccgcctgtggggttaggactggcagcctcccatctcccggcttctg
5-6 acttattcttgctcttag
6 113 GCCTGGCTCCTCCCCAGCATCTTATCCGGGTGGAAGGAAATTTGTATCCCGAGTATCTGG
USR – IFOM – ANSAS
“LO STUDENTE RICERCATORE - Anno 2010 – Relazione finale scientifica dello studente
2. Allegato 2
AAGACAGGCAGACTTTTCGCCACAGCGTGGTGGTACCTTATGAGCCACCCGAG
Intron 402 gtctgtaattttgttttggtttgtgcgtcttagagacagttgactccagcctagactgat
6-7 gttgactttctagcaacccgtttgcctcaccctcctgagt....................
....................tgaaacttattagaggctatagccagccattcccggctgc
tgcaggtcacctgtagtgaggtagggagcgacttcacctggatcctgtgtcttcccccag
7 110 GCCGGCTCTGAGTATACCACCATCCACTACAAGTACATGTGTAATAGCTCCTGCATGGGG
GGCATGAACCGCCGACCTATCCTTACCATCATCACACTGGAAGACTCCAG
Intron 322 gtaggaaggcgcgtggtaggttaggttagcctgtttcttccccagcttctgcctgtttct
7-8 gttccacgagtcccgccccctaccacatgcccaacgctct....................
....................aagaggggttgggaacaggtgggggcctagtttacacaca
gtcaggatggggcccagctttcttactgccttgtgctggtccttttcttgtcccggatag
8 137 TGGGAACCTTCTGGGACGGGACAGCTTTGAGGTTCGTGTTTGTGCCTGCCCTGGGAGAGA
CCGCCGTACAGAAGAAGAAAATTTCCGCAAAAAGGAAGTCCTTTGCCCTGAACTGCCCCC
AGGGAGCGCAAAGAGAG
Intron 79 gtacgcaggcgggaccaaggaggcggaggagcctgttgagcttcaccccaaagtcacctc
8-9 ttgctctctccttccacag
9 74 CGCTGCCCACCTGCACAAGCGCCTCTCCCCCGCAAAAGAAAAAACCACTTGATGGAGAGT
ATTTCACCCTCAAG
Intron 793 gtaccaaggctggagagtcgcatgccagagacaagctgtacccattattgcctctgtctc
9-10 tcgcatgtataaaatagtgttattagcaggttgccaggtc....................
....................ttaagttgggaaccaactttcagaaagaaagttgttaaaa
tcgtgaaagtggttgtgtgaccttgtccagtgcttccatctcacttcatctctgctgcag
10 107 ATCCGCGGGCGTAAACGCTTCGAGATGTTCCGGGAGCTGAATGAGGCCTTAGAGTTAAAG
GATGCCCATGCTACAGAGGAGTCTGGAGACAGCAGGGCTCACTCCAG
Intron 587 gtaagtggcctggggcagcgcctgcctgtggtgctctacccagacctccctccagctcag
10-11 cctttgtagtgaaagataaaaaccccaccctgctagatgc....................
....................tcagcctccagcctagagccttccaagccttgatcaagga
ggaaagcccaaactgctagctcccatcacttcatccctccccttttctgtcttcctatag
11 523 CTACCTGAAGACCAAGAAGGGCCAGTCTACTTCCCGCCATAAAAAAACAATGGTCAAGAA
AGTGGGGCCTGACTCAGACTGACTGCCTCTGCATCCCGTCCCCATCACCAGCCTCCCCCT
CTCCTTGCTGTCTTATGACTTCAGGGCTGAGACACAATCCTCCCGGTCCCTTCTGCTGCC
TTTTTTACCTTGTAGCTAGGGCTCAGCCCCCTCTCTGAGTAGTGGTTCCTGGCCCAAGTT
GGGGAATAGGTTGATAGTTGTCAGGTCTCTGCTGGCCCAGCGAAATTCTATCCAGCCAGT
TGTTGGACCCTGGCACCTACAATGAAATCTCACCCTACCCCACACCCTGTAAGATTCTAT
CTTGGGCCCTCATAGGGTCCATATCCTCCAGGGCCTACTTTCCTTCCATTCTGCAAAGCC
TGTCTGCATTTATCCACCCCCCACCCTGTCTCCCTCTTTTTTTTTTTTTTACCCCTTTTT
ATATATCAATTTCCTATTTTACAATAAAATTTTGTTATCACTT
3' atatggttttgagaggttgatatcagcataagctgtctgggcccccaggg..........
downstream
sequence
Le sequenze in minuscolo verde corrispondono alle regioni non tradotte alle
estremità del gene (UTRs)
Le sequenze in minuscolo blu corrispondono alle regioni introniche situate tra gli
esoni
Le sequenze in maiuscolo nero corrispondono alle regioni esoniche tradotte
Le sequenze in maiuscolo viola corrispondono alle regioni esoniche non tradotte
La sequenza codificante inizia con lo start codon ATG (Met) e termina con lo stop
codon TGA
USR – IFOM – ANSAS
“LO STUDENTE RICERCATORE - Anno 2010 – Relazione finale scientifica dello studente