1. Read the story first.
2. Bold Face Terms:
Make a separate list of all the definitions of the bold face terms in the story first from your reference sources like a medical dictionary or website etc.
Start by listing all the bold face medical terms and their definitions and cite your sources of reference. Example: appendectomy: the surgical excision of the organ known as the appendix which is a vestigial organ (Webster, 2010)
Then list all your full references at the bottom of your work.
Submit this list as part of your work.
3. Translate definitions into simple terms and insert them into the story:
Next, translate all of the bold faced medical terms into simple language as if you are explaining it to a patient or to someone who may not understand medical terminology and incorporate these simple translations into your story.
This means you should remove the actual medical terms in bold face print but leave the meaning in place with your translated explanations of these terms.
Your finished work should be easily understood. It is OK to alter the sentence structure to accomodate your translations.
Remember to use simple basic language to explain these complicated medical terms to another person.
Highlight your new translation either by bold facing or capitalizing the words.
Do not just insert the definitions. You will not get credit for this and points will be taken off.
The goal here is for you to learn how make the complicated sound simple.
Example:
Initial sentence with medical term in place: The patient is having an appendectomy.
Translation into simple terms in your story: The patient is have his appendix cut out and removed.
In other words, rewrite the story completely in layman's terms or plain English so that someone without a medical or science background would be able to understand.
Your translation must be clear and easy to understand.
Take into account the context of how the terms were used.
You must use all the bold faced terms "translated meanings" in your story.
So when you are complete you will have a list of terms plus definitions (with sources cited) plus a rewritten story in plain English.
4. Submitting Your Completed Work:
Submit your work on a Microsoft Word document using the attachment tool.
Submit all work as one WORD document.. Your file name should end in .doc or .docx or you can use a plain text file format ending in .rtf
If unsure how to do this please contact tech support.
Include your list of definitions and your translated story and your references.
Be sure to run a spell check on your work before submitting.
If you have any difficulty using the attachment tool please call tech support for help.
Exams may be worked on any time during the week but must be submitted on or before the due date.
Submit your exam by clicking on the title of this section "Exam I -Due..." then scroll to the bottom of the page to submit your work.
Exam 2 – part 1
Morticia was particularly interested in entering cosmetolog ...
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
1. This week, we learned about the balanced scorecard and dashboard reporting, performance measurement, sources of revenues for different types of healthcare organizations, and financial and strategic planning initiatives. For your Unit 3 Complete assignment, write a narrative essay (minimum 1,200 words) in which you first discuss the use of the income statement, in general, for decision-making. Then, calculate the net operating income and operating margin for this year and last year using the table information below and discuss what these figures mean for the company (i.e. what ‘story’ do they tell the reader). Use at least three scholarly sources and remember to demonstrate a thorough understanding of the READ and ATTEND sections in your essay. Cite your sources using APA format.
Table 3
HEALTH CAMPAIGNS:
CREATING & EVALUATING
Day 33
Review
Ch. 8 Review
Activity
Homework
AGENDA:
1.
2.
3.
4.
Public Health
Public health: prevention of disease and illness among groups of people.
Creation of public policy regarding health issues and tracks diseases
_________________
Public health services (CDC)
(Lillie; Mattson & Hall, 2011)
Health Campaigns
Health campaign
Seeks to promote public health
Targets beliefs, attitudes, or behaviors
________- acceptance of something as
true or not
______- positive or negative feeling
about something
________-actions
____________
Goes beyond health education to involve
health information and environmental
support/resources for health
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
4 phases of the health campaign process
1. Establish a working group and ____________
2. Strategic planning from____________
3. _________________ and evaluation
4. ______________on process evaluation and outcome
evaluation
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
(Mattson & Hall, 2011, p. 253)
Phase 1: Establish a
Working Group
_________: core team for
strategic planning and advising
Includes stakeholders, health
experts, organizational
officials, community partners
_________: orgs and
businesses who have an interest in
the campaign
Provide resources:
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
Strategic plan: campaign goal and
plan of action
_______ analysis:
S_______ and
w______of campaign team
(internal to team)
O_____ and t______
(external to campaign)
Ex. grassroots support or
resistant audience
__________: research to
form strategies, select target
audiences, and develop marketing
strategies
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Needs assessment: process to
understand and determine a
community’s/population’s
health issues
Pre-campaign gather info from
Key informants
community forum
survey
_________: already
existing statistics
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Messaging process: after determining
baseline attitudes, beliefs, and behavi ...
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
1. The company I chose was Amazon
2.
3.
4.
1) Keep in mind that the data includes Amazon and competitors
2) Example(For reference only)
Table showing FedEx’s stock quote
Item
Value
Interpretation and brief explanation
Current market price
$274.48
This is the price of FedEx stock that it sells for on the free stock market at as of now. Anyone wishing to purchase the company’s stock will have to pay the $274.48. This market value will habitually vary all through the exchange day as investors sell and buy the Fed Ex stock. The price will increase if more traders want to buy it and decrease or drop as traders begin selling more of the company’s stock.
Market capitalization
$72.076 Billion
This the stock price multiplied by the number of equity shares outstanding. So it is the price above multiplied by the number of FedEx’s hares outstanding
Beta
1.39 (5 year Monthly)
Beta is a measure of how a separate asset shifts when the general stock market decreases or increases(Beta, 2011). In simple it is measure of a risk associated with an asset's risk in relation to the whole market (for instance, the S&P500 index). It is a measure of FedEx’s stock relative volatility. FedEx’s beta is more than meaning it is less stable. If S&P 500 Index has a base of let’s say 1 and this index changes by 3% then the stock of FedEx will as well change by 4.17% (1.39 X 3%).
PE Ratio
40.41
In general, a great P/E ratio shows that investors anticipate for greater pays. Though, a security with a great P/E ratio is not certainly a superior investment than one with a lesser P/E ratio (Park, 2020). On the other hand, when a corporation's security has a small P/E ratio, it might have an indication that the stock is underestimated. In light of FedEx’s PE ratio of 40.41 its means that the stock was trading at around 40 times the earnings. This ratio is more than the overall ration in the S&P 500 Index meaning the company share is not overvalued.
EPS
$6.79
This is computed by dividing the net earnings attributable to the shareholders by the number of outstanding equity shares. This point outs the amount a corporation makes from each share. This item is important in determining the stock prices particularly when calculating the P/E ratio. $6.79 shows that each FedEx common stock earns around $6.79.
Earning date
December 16th 2020
This is the date of when a company will release its next financial reports. So, FedEx will have its next financial statements released on 16th December 2020. On this day there are expected large movements of its underlying.
Forward Dividend Yield
2.60 (0.93%)
This forward yield is an approximation of a year's dividend stated as a ratio of the present stock price. The year's expected dividend is determined by taking a security’s most latest actual dividend disbursement and annualizing it. The forward dividend yield is computed by dividing a year's value of future dividend disbursements by a stock's present share price. It is a corporation's pr ...
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
1. This week, we learned about the balanced scorecard and dashboard reporting, performance measurement, sources of revenues for different types of healthcare organizations, and financial and strategic planning initiatives. For your Unit 3 Complete assignment, write a narrative essay (minimum 1,200 words) in which you first discuss the use of the income statement, in general, for decision-making. Then, calculate the net operating income and operating margin for this year and last year using the table information below and discuss what these figures mean for the company (i.e. what ‘story’ do they tell the reader). Use at least three scholarly sources and remember to demonstrate a thorough understanding of the READ and ATTEND sections in your essay. Cite your sources using APA format.
Table 3
HEALTH CAMPAIGNS:
CREATING & EVALUATING
Day 33
Review
Ch. 8 Review
Activity
Homework
AGENDA:
1.
2.
3.
4.
Public Health
Public health: prevention of disease and illness among groups of people.
Creation of public policy regarding health issues and tracks diseases
_________________
Public health services (CDC)
(Lillie; Mattson & Hall, 2011)
Health Campaigns
Health campaign
Seeks to promote public health
Targets beliefs, attitudes, or behaviors
________- acceptance of something as
true or not
______- positive or negative feeling
about something
________-actions
____________
Goes beyond health education to involve
health information and environmental
support/resources for health
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
4 phases of the health campaign process
1. Establish a working group and ____________
2. Strategic planning from____________
3. _________________ and evaluation
4. ______________on process evaluation and outcome
evaluation
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
(Mattson & Hall, 2011, p. 253)
Phase 1: Establish a
Working Group
_________: core team for
strategic planning and advising
Includes stakeholders, health
experts, organizational
officials, community partners
_________: orgs and
businesses who have an interest in
the campaign
Provide resources:
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
Strategic plan: campaign goal and
plan of action
_______ analysis:
S_______ and
w______of campaign team
(internal to team)
O_____ and t______
(external to campaign)
Ex. grassroots support or
resistant audience
__________: research to
form strategies, select target
audiences, and develop marketing
strategies
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Needs assessment: process to
understand and determine a
community’s/population’s
health issues
Pre-campaign gather info from
Key informants
community forum
survey
_________: already
existing statistics
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Messaging process: after determining
baseline attitudes, beliefs, and behavi ...
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
1. The company I chose was Amazon
2.
3.
4.
1) Keep in mind that the data includes Amazon and competitors
2) Example(For reference only)
Table showing FedEx’s stock quote
Item
Value
Interpretation and brief explanation
Current market price
$274.48
This is the price of FedEx stock that it sells for on the free stock market at as of now. Anyone wishing to purchase the company’s stock will have to pay the $274.48. This market value will habitually vary all through the exchange day as investors sell and buy the Fed Ex stock. The price will increase if more traders want to buy it and decrease or drop as traders begin selling more of the company’s stock.
Market capitalization
$72.076 Billion
This the stock price multiplied by the number of equity shares outstanding. So it is the price above multiplied by the number of FedEx’s hares outstanding
Beta
1.39 (5 year Monthly)
Beta is a measure of how a separate asset shifts when the general stock market decreases or increases(Beta, 2011). In simple it is measure of a risk associated with an asset's risk in relation to the whole market (for instance, the S&P500 index). It is a measure of FedEx’s stock relative volatility. FedEx’s beta is more than meaning it is less stable. If S&P 500 Index has a base of let’s say 1 and this index changes by 3% then the stock of FedEx will as well change by 4.17% (1.39 X 3%).
PE Ratio
40.41
In general, a great P/E ratio shows that investors anticipate for greater pays. Though, a security with a great P/E ratio is not certainly a superior investment than one with a lesser P/E ratio (Park, 2020). On the other hand, when a corporation's security has a small P/E ratio, it might have an indication that the stock is underestimated. In light of FedEx’s PE ratio of 40.41 its means that the stock was trading at around 40 times the earnings. This ratio is more than the overall ration in the S&P 500 Index meaning the company share is not overvalued.
EPS
$6.79
This is computed by dividing the net earnings attributable to the shareholders by the number of outstanding equity shares. This point outs the amount a corporation makes from each share. This item is important in determining the stock prices particularly when calculating the P/E ratio. $6.79 shows that each FedEx common stock earns around $6.79.
Earning date
December 16th 2020
This is the date of when a company will release its next financial reports. So, FedEx will have its next financial statements released on 16th December 2020. On this day there are expected large movements of its underlying.
Forward Dividend Yield
2.60 (0.93%)
This forward yield is an approximation of a year's dividend stated as a ratio of the present stock price. The year's expected dividend is determined by taking a security’s most latest actual dividend disbursement and annualizing it. The forward dividend yield is computed by dividing a year's value of future dividend disbursements by a stock's present share price. It is a corporation's pr ...
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
1. PURPOSE To document and evaluate teaching skills necessary toAbbyWhyte974
1. PURPOSE: To document and evaluate teaching skills necessary to provide teaching to an individual client with a demonstrated need.
With the completion of this assignment the student will be able to achieve the following objectives.
a. Demonstrate ability to thoroughly assess the learning styles of an individual or family using given developmental or cultural models.
b. Demonstrate ability to anticipate learning needs based on developmental or cultural assessments.
c. Identify and utilize teaching/learning principles to facilitate achievement of learning goals and outcomes.
d. Select and prioritize learning strategies based on the developmental or cultural assessment to achieve learning goals and outcomes.
e. Support rationales for teaching plan using teaching and learning theories from required readings with references
2. NURSING COMPETENCIES:
a. Assessing and identifying developmental, cultural, and socioeconomic factors affecting a client.
b. Providing evidence-based health information and teaching based on developmental, cultural, and socioeconomic factors affecting a client or family
c. Integrating teaching/learning activities into client interactions based on developmental, cultural, and socioeconomic factors affecting a client or family.
d. Incorporating health promotion and teaching into the plan of care based on developmental, cultural, and socioeconomic factors affecting a family or client.
3. PLAN: submitted to the clinical instructor during the teaching experience. Your clinical instructor must approve the topic.
a. Develop nursing diagnosis (NANDA)
b. Develop two (2) learning objectives
c. State methodology (teaching methods)
d. Provide and utilize teaching aids e)
e. State needed resources
4. This write-up should be 2-3 pages to follow the Teaching Experience Rubric.
5. SUGGESTED TOPICS FOR TEACHING PLAN:
a. Mother’s with infants who have hyperbilirubinemia
b. Maternal and neonatal infection
c. Care of the Mother and Infant with Substance Abuse Problems
d. Immunization schedule for the newborn
e. Newborn care
f. Post op cesarean section care
g. Post vaginal delivery care
h. Breastfeeding
Course Number and Name
Course: NURS 316L
TEACHING EXPERIENCE PROJECT GUIDELINES & RUBRIC
i. Postpartum depression
Revision Date: Month, Year (i.e. February, 2010) Page 1
Page 1 of 3
TEACHING EXPERIENCE RUBRIC
NAME: DATE:
TOPIC:COURSE:
START TIME: END TIME:
Criteria
4
3
2
1-0
Score
Comprehensive
Assessment
· Clear and concise
discussion of patient’s admission diagnosis, demographic data,
and anticipated learning needs
· Clear and comprehensive patient assessment data to support a deficient knowledge nursing diagnosis.
· Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and anticipated learning needs.
· Vague and incomplete patient assessment data to support deficient knowledge nursing diagnosis.
· Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and antici ...
1. Rate yourself according to your confidence level performing theAbbyWhyte974
1. Rate yourself according to your confidence level performing the skills identified in the Clinical Skills Self-Assessment Form.
2. Based on your ratings, summarize your strengths and opportunities for improvement.
3. Based on your self-assessment and theory of nursing practice, develop four (4) measurable goals and objectives for a practicum experience.
4. Include them on the designated area of the form.
Self-Assessment Form
Desired Clinical Skills for Students to Achieve
Confident (Can complete independently)
Mostly confident (Can complete with supervision)
Beginning (Have performed with supervision or needs supervision to feel confident)
New (Have never performed or does not apply)
Comprehensive psychiatric evaluation skills in:
Recognizing clinical signs and symptoms of psychiatric illness across the lifespan
X
Differentiating between pathophysiological and psychopathological conditions
X
Performing and interpreting a comprehensive and/or interval history and physical examination (including laboratory and diagnostic studies)
X
Performing and interpreting a mental status examination
X
Performing and interpreting a psychosocial assessment and family psychiatric history
X
Performing and interpreting a functional assessment (activities of daily living, occupational, social, leisure, educational).
X
Diagnostic reasoning skill in:
Developing and prioritizing a differential diagnoses list
X
Formulating diagnoses according to DSM 5 based on assessment data
X
Differentiating between normal/abnormal age-related physiological and psychological symptoms/changes
X
Pharmacotherapeutic skills in:
Selecting appropriate evidence based clinical practice guidelines for medication plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management)
X
Evaluating patient response and modify plan as necessary
X
Documenting (e.g., adverse reaction, the patient response, changes to the plan of care)
X
Psychotherapeutic Treatment Planning:
Recognizes concepts of therapeutic modalities across the lifespan
X
Selecting appropriate evidence based clinical practice guidelines for psychotherapeutic plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management, modality appropriate for situation)
X
Applies age appropriate psychotherapeutic counseling techniques with individuals and/or any caregivers
X
Develop an age appropriate individualized plan of care
X
Provide psychoeducation to individuals and/or any caregivers
X
Promote health and disease prevention techniques
X
Self-assessment skill:
Develop SMART goals for practicum experiences
X
Evaluating outcomes of practicum goals and modify plan as necessary
X
Documenting and reflecting on learning experiences
X
Professional skills:
Maintains professional boundaries and thera ...
1. President William McKinley, letter to Congress, April 25, 1898.AbbyWhyte974
1. President William McKinley, letter to Congress, April 25, 1898.
[I took action] under the joint resolution approved April 20, 1898, "for the recognition of the independence of the people of Cuba, demanding that the Government of Spain relinquish its authority and Government in the island of Cuba, and to withdraw its land and naval forces from Cuba and Cuban waters…"
…The Government of Spain…responds by treating the reasonable demands of this Government as measures of hostility, following with that instant and complete severance of relations by its action which by the usage of nations accompanies an existent state of war between sovereign powers.
I now recommend the adoption of a joint resolution declaring that a state of war exists between the United States of America and the Kingdom of Spain…
2. Teller Amendment, Adopted by the Senate, April 19, 1898
[The United States] hereby disclaims any disposition of intention to exercise sovereignty, jurisdiction, or control over said island except for pacification thereof, and asserts its determination, when that is accomplished, to leave the government and control of the island to its people.
3. Senator Alfred Beveridge (R-Indiana), in Congress, January 9, 1900.
. . . [J]ust beyond the Philippines are China's illimitable markets. . . We will not renounce our part in the mission of our race, trustee of God, of the civilization of the world. . . Where shall we turn for consumers of our surplus?. . . China is our natural customer. . . [England, Germany and Russia] have moved nearer to China by securing permanent bases on her borders. The Philippines gives us a base at the door of all the East. . .
They [the Filipinos] are a barbarous race, modified by three centuries of contact with a decadent race [the Spanish]. . . It is barely possible that 1,000 men in all the archipelago are capable of self-government in the Anglo-Saxon sense. . .
The Declaration [of Independence] applies only to people capable of self-government. How dare any man prostitute this expression of the very elect of self-government peoples to a race of Malay children of barbarism, schooled in Spanish methods and ideas? And you, who say the Declaration applies to all men, how dare you deny its application to the American Indian? And if you deny it to the Indian at home, how dare you grant it to the Malay abroad.
4. President Woodrow Wilson, War Message to Congress, 1917
The Imperial German Government [announced that] it was its purpose to put aside all restraints of law or of humanity and use its submarines to sink every vessel that sought to approach either the ports of Great Britain and Ireland or the western coasts of Europe or any of the ports controlled by the enemies of Germany within the Mediterranean.…
It is a war against all nations. American ships have been sunk, American lives taken, in ways which it has stirred us very deeply to learn of, but the ships and people of other neutral and friendly nations have been sunk and ...
1. Prof. Lennart Van der Zeil’s theorem says that any programming AbbyWhyte974
1. Prof. Lennart Van der Zeil’s theorem says that any programming language is complete if it can be used to write a program to compute any computable number.
a. What is a computable number?
b. What is a non-computable number?
c. If all existing programming languages are complete why do we need more than one?
2. Two methodologies are used to transform programs written in a source language (also known as a programmer-oriented language, or a horizontal language, or a high-level language) into a target language (also known as a machine language, or a vertical language, or a low-level language). There is a static method called translation and a dynamic method called interpretation. Yet FORTRAN while 98% static ., uses interpretation for the Formatted I/O statement, similarly COBOL uses interpretation for the MOVE and MOVE CORRESPONDING statements; on the other hand, Java is fully interpretative except that in some programs and certain data sets it may invoke a JIT (Just In Time) compiler to execute a bit of static code. Why do language designers mix these modalities if either is complete? Hint: This is a long question with a short answer.
3. C and C++ store numerical arrays (matrices) in row major order and each index range must begin with 0; whereas FORTRAN stores arrays in column major order and the (default) index range starts (almost always) with 1. Engineers and scientists are often faced with the problem of converting a working program, or much more often a subroutine, from one language to another. Unfortunately, due to the index range difference (0 to n-1) in C/C++ and (1 to N) in FORTRAN, viewing one array as simply the transpose of the other will not suffice. What steps would you take to convert such a subroutine to compute the product of two matrices A(N,M) and B(M,N) to produce C(N,N) from FORTRAN to C++?
4. What was the major reason Jim Gosling invented Java? Did he succeed?
5. What are the four major features of C++ that were eliminated in Java? Why were they taken out? Why do we not miss them?
6. What was Kim Polese’ role at SUN Microsystems and why did she think Java should be positioned as a general purpose computer programming language? How did she accomplish this truly incredible feat, not done since Captain (later Admiral) Grace Murray Hopper, USN standardized COBOL in the early 1960s.
7. Describe briefly the role of women in the development of computer programming and computer programming languages. (Ada Lovelace, Betty Holberton, Grace Hopper, Mandaly Grems, Kim Polese, Laura Lemay)
8. What are the pros and cons of overloaded operators in C++? Java has only one, what is it?
9. State your own arguments for allowing mixed mode arithmetic statements. (See Ch 7)
10. What is BNF and why are meta-languages like BNF and EBNF used?
...
1. Preparing for assessment. DateWeek 3Session titlePrAbbyWhyte974
1. Preparing for assessment.
Date
Week 3
Session title
Preparing for assessments
Content covered
Have enough knowledge on the university assessments before you start doing it.
Comments on readings/practice.
Making study plan and Managing time are the best method to have the peace of mind.
Most interesting points
Feeling organised when finish multiple assessments in the right time.
Most difficult points
Reading the academic articles and find the relative information that supports my topic, How to discuss more in depth.
· Introduction
The above session provided the best academic and coordination skills by explained the multiple essential tips of preparing properly for the assessments and considering the times determinant, which encouraged me to think and write professionally.
· Reflection Discussion on the study plan for assessments
As the English language is my second tongue, I have faced many difficulties with reading and writing academic articles. I found the above topic has a significant impact positively to prepare my assessments in advance, especially when it displays at the beginning of my first semester in the university. However, an ongoing experience on what I gained from this session has a huge impact on me. For instance, after this session, I organised a table that shows each type of the assessments separately, and each one has its basics and elements in its allotted box. As a result, while I’m doing my estimates, I refer to my table and find my structures ready, which helps me seize the time and be more skilled.
· Reflection Discussion on prepare well for my assessments.
As I'm in my first year at the university, I thought there was no need to have an entire assessments plan. Later on, I noticed that working on assessments without organising a plan affects the whole semester assessments, which might cause time conflict in the Assignments due date. I wasn't aware of how important it is the preparing and reading enough sources before start writing. However, Glancing and reading enough information can convert the assessment from stress work to exciting work, which will help set the scene and allow me to think critically and write academically. Based on the benefits that I acquired from the session, the critical thinking and in depth discussion in a particular topic will need to be supported by academic information from reading more articles and spend more time on this part of the work. After this session, I became able to organise my assessments, which allow me to have enough time to working on them and preventing some of the study stresses and cramming. Also, I have been able to take a period to refresh my mind and get my memory retention. However, there is no doubt that it encouraged me to provide the work in a prime manner. This experience will be beneficial in my subsequent semesters to develop my ability to be further organised in my study and aware of how to prepare before the assessments.
Conclusion
...
1. Project Description Definition of ProjectThe supervision of wAbbyWhyte974
1. Project Description Definition of Project
The supervision of workers' operations or corporate functions is difficult work for the administrative environment. Modern frameworks have certain limitations in the implementation of integrated workforce control functions. This project aims to improve the structure of EMS (employee management system). The new framework helps administrators to trace staff profiles, particularly their tasks, and it will capture the present position. The accompanying boss forecasts the workforce requirements by detailed information of workers and plans a valid timeline for each employee to reduce the difficulties of collaborative working. This project focuses on developing a user-friendly interface that helps supervisors reliably collect or store information for workers (Abdulhamid, Dada, & Ajibuwa, 2019).
2. Plan scale, deliverables, and outcomes
This project has a high scope since many companies compete for previous techniques to monitor employee records, but face challenges with data quality and human-made errors. EMS enables organizations to capture, store and exchange the details needed about current and recently entered staff. The present state of the delegated activities of workers would inevitably be monitored by employee supervision and their responsibilities would also be mainly helpful. Through the use of the EMS framework, quality control levels will ultimately be possible to delegate workers the correct stress and improve employee loyalty. The corporation would raise employee engagement rates, which would also increase group morale and person efficiency (Abdulhamid, Dada, & Ajibuwa, 2019).
3. The Project Limitations
Two main limitations, such as effort and money, have been faced throughout the project implementation period. For this sort of IT project, capital resources are important since it incorporates certain hardware and software requirements in the procurement and the project faces difficulties throughout the development process owing to proper evaluation on a budget schedule. Time is another requirement for this project. Any project mission has to be accomplished within a very limited time but job-related problems have been induced by a combination of vacations and the shortage of project participants due to sickness. However, this project was performed using productive management techniques, which collaborated in collaboration for the successful coordination and communication of the project (Denney, 2020).
4. Recommendation of Project
This initiative is about handling and tracking staff, so privacy and protection are the two main employee issues. EMS shops or collect all workers' employee records. This means that owing to certain software fixes or gaps, security attacks such as ransomware, insider attacks, and unauthorized entry, security safety is a high priority of this initiative. So, in this project, I would like to see certain improvements, first of all, I would suggest gaining some financia ...
1. PortfolioYou are expected to collate a portfolio of items toAbbyWhyte974
1. Portfolio
You are expected to collate a portfolio of items to demonstrate your learning achieved during this
module as well as you programme.
Purpose of Portfolio:
• Reflect on your strengths and weaknesses in relation to transversal skills (including
academic skills).
• Prepare a development plan to develop/enhance skills as a result from the self-reflection.
• Provide a log of activities to demonstrate how you have followed your development plan.
• Demonstrate overall, your enhanced employability as a result of the programme.
Your portfolio will be submitted in two sets:
Portfolio Set 1
This should include the following:
a) Current CV
b) Reflective Self-analysis of Skills
c) Skills Development Plan
...
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
1. PURPOSE To document and evaluate teaching skills necessary toAbbyWhyte974
1. PURPOSE: To document and evaluate teaching skills necessary to provide teaching to an individual client with a demonstrated need.
With the completion of this assignment the student will be able to achieve the following objectives.
a. Demonstrate ability to thoroughly assess the learning styles of an individual or family using given developmental or cultural models.
b. Demonstrate ability to anticipate learning needs based on developmental or cultural assessments.
c. Identify and utilize teaching/learning principles to facilitate achievement of learning goals and outcomes.
d. Select and prioritize learning strategies based on the developmental or cultural assessment to achieve learning goals and outcomes.
e. Support rationales for teaching plan using teaching and learning theories from required readings with references
2. NURSING COMPETENCIES:
a. Assessing and identifying developmental, cultural, and socioeconomic factors affecting a client.
b. Providing evidence-based health information and teaching based on developmental, cultural, and socioeconomic factors affecting a client or family
c. Integrating teaching/learning activities into client interactions based on developmental, cultural, and socioeconomic factors affecting a client or family.
d. Incorporating health promotion and teaching into the plan of care based on developmental, cultural, and socioeconomic factors affecting a family or client.
3. PLAN: submitted to the clinical instructor during the teaching experience. Your clinical instructor must approve the topic.
a. Develop nursing diagnosis (NANDA)
b. Develop two (2) learning objectives
c. State methodology (teaching methods)
d. Provide and utilize teaching aids e)
e. State needed resources
4. This write-up should be 2-3 pages to follow the Teaching Experience Rubric.
5. SUGGESTED TOPICS FOR TEACHING PLAN:
a. Mother’s with infants who have hyperbilirubinemia
b. Maternal and neonatal infection
c. Care of the Mother and Infant with Substance Abuse Problems
d. Immunization schedule for the newborn
e. Newborn care
f. Post op cesarean section care
g. Post vaginal delivery care
h. Breastfeeding
Course Number and Name
Course: NURS 316L
TEACHING EXPERIENCE PROJECT GUIDELINES & RUBRIC
i. Postpartum depression
Revision Date: Month, Year (i.e. February, 2010) Page 1
Page 1 of 3
TEACHING EXPERIENCE RUBRIC
NAME: DATE:
TOPIC:COURSE:
START TIME: END TIME:
Criteria
4
3
2
1-0
Score
Comprehensive
Assessment
· Clear and concise
discussion of patient’s admission diagnosis, demographic data,
and anticipated learning needs
· Clear and comprehensive patient assessment data to support a deficient knowledge nursing diagnosis.
· Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and anticipated learning needs.
· Vague and incomplete patient assessment data to support deficient knowledge nursing diagnosis.
· Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and antici ...
1. Rate yourself according to your confidence level performing theAbbyWhyte974
1. Rate yourself according to your confidence level performing the skills identified in the Clinical Skills Self-Assessment Form.
2. Based on your ratings, summarize your strengths and opportunities for improvement.
3. Based on your self-assessment and theory of nursing practice, develop four (4) measurable goals and objectives for a practicum experience.
4. Include them on the designated area of the form.
Self-Assessment Form
Desired Clinical Skills for Students to Achieve
Confident (Can complete independently)
Mostly confident (Can complete with supervision)
Beginning (Have performed with supervision or needs supervision to feel confident)
New (Have never performed or does not apply)
Comprehensive psychiatric evaluation skills in:
Recognizing clinical signs and symptoms of psychiatric illness across the lifespan
X
Differentiating between pathophysiological and psychopathological conditions
X
Performing and interpreting a comprehensive and/or interval history and physical examination (including laboratory and diagnostic studies)
X
Performing and interpreting a mental status examination
X
Performing and interpreting a psychosocial assessment and family psychiatric history
X
Performing and interpreting a functional assessment (activities of daily living, occupational, social, leisure, educational).
X
Diagnostic reasoning skill in:
Developing and prioritizing a differential diagnoses list
X
Formulating diagnoses according to DSM 5 based on assessment data
X
Differentiating between normal/abnormal age-related physiological and psychological symptoms/changes
X
Pharmacotherapeutic skills in:
Selecting appropriate evidence based clinical practice guidelines for medication plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management)
X
Evaluating patient response and modify plan as necessary
X
Documenting (e.g., adverse reaction, the patient response, changes to the plan of care)
X
Psychotherapeutic Treatment Planning:
Recognizes concepts of therapeutic modalities across the lifespan
X
Selecting appropriate evidence based clinical practice guidelines for psychotherapeutic plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management, modality appropriate for situation)
X
Applies age appropriate psychotherapeutic counseling techniques with individuals and/or any caregivers
X
Develop an age appropriate individualized plan of care
X
Provide psychoeducation to individuals and/or any caregivers
X
Promote health and disease prevention techniques
X
Self-assessment skill:
Develop SMART goals for practicum experiences
X
Evaluating outcomes of practicum goals and modify plan as necessary
X
Documenting and reflecting on learning experiences
X
Professional skills:
Maintains professional boundaries and thera ...
1. President William McKinley, letter to Congress, April 25, 1898.AbbyWhyte974
1. President William McKinley, letter to Congress, April 25, 1898.
[I took action] under the joint resolution approved April 20, 1898, "for the recognition of the independence of the people of Cuba, demanding that the Government of Spain relinquish its authority and Government in the island of Cuba, and to withdraw its land and naval forces from Cuba and Cuban waters…"
…The Government of Spain…responds by treating the reasonable demands of this Government as measures of hostility, following with that instant and complete severance of relations by its action which by the usage of nations accompanies an existent state of war between sovereign powers.
I now recommend the adoption of a joint resolution declaring that a state of war exists between the United States of America and the Kingdom of Spain…
2. Teller Amendment, Adopted by the Senate, April 19, 1898
[The United States] hereby disclaims any disposition of intention to exercise sovereignty, jurisdiction, or control over said island except for pacification thereof, and asserts its determination, when that is accomplished, to leave the government and control of the island to its people.
3. Senator Alfred Beveridge (R-Indiana), in Congress, January 9, 1900.
. . . [J]ust beyond the Philippines are China's illimitable markets. . . We will not renounce our part in the mission of our race, trustee of God, of the civilization of the world. . . Where shall we turn for consumers of our surplus?. . . China is our natural customer. . . [England, Germany and Russia] have moved nearer to China by securing permanent bases on her borders. The Philippines gives us a base at the door of all the East. . .
They [the Filipinos] are a barbarous race, modified by three centuries of contact with a decadent race [the Spanish]. . . It is barely possible that 1,000 men in all the archipelago are capable of self-government in the Anglo-Saxon sense. . .
The Declaration [of Independence] applies only to people capable of self-government. How dare any man prostitute this expression of the very elect of self-government peoples to a race of Malay children of barbarism, schooled in Spanish methods and ideas? And you, who say the Declaration applies to all men, how dare you deny its application to the American Indian? And if you deny it to the Indian at home, how dare you grant it to the Malay abroad.
4. President Woodrow Wilson, War Message to Congress, 1917
The Imperial German Government [announced that] it was its purpose to put aside all restraints of law or of humanity and use its submarines to sink every vessel that sought to approach either the ports of Great Britain and Ireland or the western coasts of Europe or any of the ports controlled by the enemies of Germany within the Mediterranean.…
It is a war against all nations. American ships have been sunk, American lives taken, in ways which it has stirred us very deeply to learn of, but the ships and people of other neutral and friendly nations have been sunk and ...
1. Prof. Lennart Van der Zeil’s theorem says that any programming AbbyWhyte974
1. Prof. Lennart Van der Zeil’s theorem says that any programming language is complete if it can be used to write a program to compute any computable number.
a. What is a computable number?
b. What is a non-computable number?
c. If all existing programming languages are complete why do we need more than one?
2. Two methodologies are used to transform programs written in a source language (also known as a programmer-oriented language, or a horizontal language, or a high-level language) into a target language (also known as a machine language, or a vertical language, or a low-level language). There is a static method called translation and a dynamic method called interpretation. Yet FORTRAN while 98% static ., uses interpretation for the Formatted I/O statement, similarly COBOL uses interpretation for the MOVE and MOVE CORRESPONDING statements; on the other hand, Java is fully interpretative except that in some programs and certain data sets it may invoke a JIT (Just In Time) compiler to execute a bit of static code. Why do language designers mix these modalities if either is complete? Hint: This is a long question with a short answer.
3. C and C++ store numerical arrays (matrices) in row major order and each index range must begin with 0; whereas FORTRAN stores arrays in column major order and the (default) index range starts (almost always) with 1. Engineers and scientists are often faced with the problem of converting a working program, or much more often a subroutine, from one language to another. Unfortunately, due to the index range difference (0 to n-1) in C/C++ and (1 to N) in FORTRAN, viewing one array as simply the transpose of the other will not suffice. What steps would you take to convert such a subroutine to compute the product of two matrices A(N,M) and B(M,N) to produce C(N,N) from FORTRAN to C++?
4. What was the major reason Jim Gosling invented Java? Did he succeed?
5. What are the four major features of C++ that were eliminated in Java? Why were they taken out? Why do we not miss them?
6. What was Kim Polese’ role at SUN Microsystems and why did she think Java should be positioned as a general purpose computer programming language? How did she accomplish this truly incredible feat, not done since Captain (later Admiral) Grace Murray Hopper, USN standardized COBOL in the early 1960s.
7. Describe briefly the role of women in the development of computer programming and computer programming languages. (Ada Lovelace, Betty Holberton, Grace Hopper, Mandaly Grems, Kim Polese, Laura Lemay)
8. What are the pros and cons of overloaded operators in C++? Java has only one, what is it?
9. State your own arguments for allowing mixed mode arithmetic statements. (See Ch 7)
10. What is BNF and why are meta-languages like BNF and EBNF used?
...
1. Preparing for assessment. DateWeek 3Session titlePrAbbyWhyte974
1. Preparing for assessment.
Date
Week 3
Session title
Preparing for assessments
Content covered
Have enough knowledge on the university assessments before you start doing it.
Comments on readings/practice.
Making study plan and Managing time are the best method to have the peace of mind.
Most interesting points
Feeling organised when finish multiple assessments in the right time.
Most difficult points
Reading the academic articles and find the relative information that supports my topic, How to discuss more in depth.
· Introduction
The above session provided the best academic and coordination skills by explained the multiple essential tips of preparing properly for the assessments and considering the times determinant, which encouraged me to think and write professionally.
· Reflection Discussion on the study plan for assessments
As the English language is my second tongue, I have faced many difficulties with reading and writing academic articles. I found the above topic has a significant impact positively to prepare my assessments in advance, especially when it displays at the beginning of my first semester in the university. However, an ongoing experience on what I gained from this session has a huge impact on me. For instance, after this session, I organised a table that shows each type of the assessments separately, and each one has its basics and elements in its allotted box. As a result, while I’m doing my estimates, I refer to my table and find my structures ready, which helps me seize the time and be more skilled.
· Reflection Discussion on prepare well for my assessments.
As I'm in my first year at the university, I thought there was no need to have an entire assessments plan. Later on, I noticed that working on assessments without organising a plan affects the whole semester assessments, which might cause time conflict in the Assignments due date. I wasn't aware of how important it is the preparing and reading enough sources before start writing. However, Glancing and reading enough information can convert the assessment from stress work to exciting work, which will help set the scene and allow me to think critically and write academically. Based on the benefits that I acquired from the session, the critical thinking and in depth discussion in a particular topic will need to be supported by academic information from reading more articles and spend more time on this part of the work. After this session, I became able to organise my assessments, which allow me to have enough time to working on them and preventing some of the study stresses and cramming. Also, I have been able to take a period to refresh my mind and get my memory retention. However, there is no doubt that it encouraged me to provide the work in a prime manner. This experience will be beneficial in my subsequent semesters to develop my ability to be further organised in my study and aware of how to prepare before the assessments.
Conclusion
...
1. Project Description Definition of ProjectThe supervision of wAbbyWhyte974
1. Project Description Definition of Project
The supervision of workers' operations or corporate functions is difficult work for the administrative environment. Modern frameworks have certain limitations in the implementation of integrated workforce control functions. This project aims to improve the structure of EMS (employee management system). The new framework helps administrators to trace staff profiles, particularly their tasks, and it will capture the present position. The accompanying boss forecasts the workforce requirements by detailed information of workers and plans a valid timeline for each employee to reduce the difficulties of collaborative working. This project focuses on developing a user-friendly interface that helps supervisors reliably collect or store information for workers (Abdulhamid, Dada, & Ajibuwa, 2019).
2. Plan scale, deliverables, and outcomes
This project has a high scope since many companies compete for previous techniques to monitor employee records, but face challenges with data quality and human-made errors. EMS enables organizations to capture, store and exchange the details needed about current and recently entered staff. The present state of the delegated activities of workers would inevitably be monitored by employee supervision and their responsibilities would also be mainly helpful. Through the use of the EMS framework, quality control levels will ultimately be possible to delegate workers the correct stress and improve employee loyalty. The corporation would raise employee engagement rates, which would also increase group morale and person efficiency (Abdulhamid, Dada, & Ajibuwa, 2019).
3. The Project Limitations
Two main limitations, such as effort and money, have been faced throughout the project implementation period. For this sort of IT project, capital resources are important since it incorporates certain hardware and software requirements in the procurement and the project faces difficulties throughout the development process owing to proper evaluation on a budget schedule. Time is another requirement for this project. Any project mission has to be accomplished within a very limited time but job-related problems have been induced by a combination of vacations and the shortage of project participants due to sickness. However, this project was performed using productive management techniques, which collaborated in collaboration for the successful coordination and communication of the project (Denney, 2020).
4. Recommendation of Project
This initiative is about handling and tracking staff, so privacy and protection are the two main employee issues. EMS shops or collect all workers' employee records. This means that owing to certain software fixes or gaps, security attacks such as ransomware, insider attacks, and unauthorized entry, security safety is a high priority of this initiative. So, in this project, I would like to see certain improvements, first of all, I would suggest gaining some financia ...
1. PortfolioYou are expected to collate a portfolio of items toAbbyWhyte974
1. Portfolio
You are expected to collate a portfolio of items to demonstrate your learning achieved during this
module as well as you programme.
Purpose of Portfolio:
• Reflect on your strengths and weaknesses in relation to transversal skills (including
academic skills).
• Prepare a development plan to develop/enhance skills as a result from the self-reflection.
• Provide a log of activities to demonstrate how you have followed your development plan.
• Demonstrate overall, your enhanced employability as a result of the programme.
Your portfolio will be submitted in two sets:
Portfolio Set 1
This should include the following:
a) Current CV
b) Reflective Self-analysis of Skills
c) Skills Development Plan
...
1. PortfolioYou are expected to collate a portfolio of items to
1. Read the story first.2. Bold Face TermsMake a separate l
1. 1. Read the story first.
2. Bold Face Terms:
Make a separate list of all the definitions of the bold face terms
in the story first from your reference sources like a medical
dictionary or website etc.
Start by listing all the bold face medical terms and their
definitions and cite your sources of reference. Example:
appendectomy: the surgical excision of the organ known as the
appendix which is a vestigial organ (Webster, 2010)
Then list all your full references at the bottom of your work.
Submit this list as part of your work.
3. Translate definitions into simple terms and insert them into
the story:
Next, translate all of the bold faced medical terms into simple
language as if you are explaining it to a patient or to someone
who may not understand medical terminology and incorporate
these simple translations into your story.
This means you should remove the actual medical terms in bold
face print but leave the meaning in place with your translated
explanations of these terms.
Your finished work should be easily understood. It is OK to
alter the sentence structure to accomodate your translations.
Remember to use simple basic language to explain these
complicated medical terms to another person.
Highlight your new translation either by bold facing or
capitalizing the words.
Do not just insert the definitions. You will not get credit for
this and points will be taken off.
The goal here is for you to learn how make the complicated
sound simple.
Example:
2. Initial sentence with medical term in place: The patient is
having an appendectomy.
Translation into simple terms in your story: The patient is have
his appendix cut out and removed.
In other words, rewrite the story completely in layman's terms
or plain English so that someone without a medical or science
background would be able to understand.
Your translation must be clear and easy to understand.
Take into account the context of how the terms were used.
You must use all the bold faced terms "translated meanings" in
your story.
So when you are complete you will have a list of terms plus
definitions (with sources cited) plus a rewritten story in plain
English.
4. Submitting Your Completed Work:
Submit your work on a Microsoft Word document using the
attachment tool.
Submit all work as one WORD document.. Your file name
should end in .doc or .docx or you can use a plain text file
format ending in .rtf
If unsure how to do this please contact tech support.
Include your list of definitions and your translated story and
your references.
Be sure to run a spell check on your work before submitting.
If you have any difficulty using the attachment tool please call
tech support for help.
Exams may be worked on any time during the week but must be
submitted on or before the due date.
Submit your exam by clicking on the title of this section "Exam
I -Due..." then scroll to the bottom of the page to submit
your work.
Exam 2 – part 1
Morticia was particularly interested in entering cosmetology
3. school after completing high school. She was fascinated by the
prospects of dealing with xeroderma treatments, reducing rhytid
dermis, and increasing melanin content in the epidermis. She
longed for dermatoplasty and she also had a secret plan to
collect and market all the trichomycosis she could collect. Her
father had once told her that it was a delicacy and she knew that
she could make millions selling it in his “homeland.”
Morticia had studied contusions by inflicting them on her
classmates. Her sister told her that she would also
collect candidiasis samples for her blossoming perfume
business. She looked forward to finding abscesses on the scalps
of some of her classmates in cosmetology school. She had been
fortunate enough to see a fissure and gangrene which excited
her so much that she developed impetigo on her face that had
most likely been placed there by the blush brush she used in the
department store. Oh, she was excited!
Morticia developed adenoiditis and tonsillitis which resulted
in dyspnea so severe that she developed dysphonia and was
instructed in paroxysmal breathing exercises. Morticia almost
developed anoxia and apnea, before being scheduled
for ABGs and pulse oximetry. She subsequently had
an endoscopic examination and
an adenoidectomy and tonsillectomy were scheduled. The
change in her attitude
regarding Staphylococcus aureus and necrosis had dramatically
changed when SHE was the subject.
Postoperatively, Morticia experienced
periodic laryngospasms and rhinorrhea, but there was no further
evidence of hypoxemia. This was great news for Morticia!
Part 2
The Alimentary Canal Sub Journey
The fantastic voyage was about to begin. According to the maps
that had been provided, the alimentary canal complete with each
of the associated viscera would be visited via a microscopic
4. submarine complete with cameras to capture “everything.”
Here is a synopsis of the voyage:
The sub entered the oral cavity and crash landed on
the dentition, initially resting on the tongue. Then it was put
afloat by the mucoid secretions of
the sublingual salivary glands. Thank goodness there were no
sialoliths about! There were some tense moments as the roof of
the sub hit the palate and just barely passed by
the bifurcate uvula, which seemed to equal the size of the sub.
The sub was spared from mastication and deglutition was
relatively gentle. The sub followed a caudal path through the
pharynx, passing medially through the esophagus and into the
fundus of the stomach where food is temporarily stored. The
team was very happy to see there was no erosive gastritis as that
could definitely endanger the integrity of the sub’s hull. The
sub seemed to bypass the pylorus before being “pushed” into a
long enteric canal that seemed to be endless which had three
distinct portions, the duodenum, jejunum and ileum. These areas
exhibited intense waves of peristalsis controlled by Meissner's
plexus.
The sub passed by the gallbladder which tried to emulsify it
with bile as if it were a mere triglyceride!
Just when the sub seemed as if it was going to rest for a while,
it was moved by peristalsis into the colon barely missing
a small colon polyp. The captain made a note that a colonoscopy
followed by polypectomy would be recommended. Next the sub
barely avoided becoming wedged in a diverticulum! The sub
then easily sailed by a vestigial organ called the appendix. All
was quiet there. The crew was thrilled there was no
hematochezia or melena present for their grand exodus. They
were almost home free. Finally, there was light at the end of the
proverbial tunnel or in this case the anal sphincter!