1
RISK MANAGEMENT (BAP 352)
INDIVIDUAL ASSIGNMENT | GUIDANCE PAPER
Trimester 2 2021
__________________________________________________________________
Section 1.0 Assessment Information
Length: 1500 words (± 10% excluding bibliography)
Weighting: 20%
Assessment due: Friday Week 11
Style and format: Submissions will be in the form of an essay and suggested
guideline:
1. Introduction
• General statement to introduce reader to the topic, which sets
the context for the topic in a broad way
• Outline of the main points that will be researched / analysed /
presented in your essay
2. Analysis
• What are your key findings
• Are there any impacts or implications
• One main point or key idea per paragraph
3. Recommendations
• Summarise your key recommendations, if any.
4. Conclusion
• Summarises the main points or arguments
• Restates the major point of view (your answer to the question)
• Includes no new information
• Should not need references
Note:
• At least one citation / reference for each key point/s
• List references clearly
2
Assessment Submission: Assignments to be submitted to “Turnitin”, a tool which will check
for plagiarism. Any similarity over 35% will not be accepted.
Assessment Return: Marks will be released at the beginning of Week 12.
Section 2.0 Other Important Information
2.1 Plagiarism
Taking another person’s ideas, words or inventions and presenting them as your own without
acknowledging your sources (citing or referencing), is plagiarism. Paraphrasing or rewording
another person’s work, without acknowledging its source, is also plagiarism. If you are
identified with plagiarism assessment mark will be zero and will be reported to the
Academic Integrity Committee.
2.2 Referencing
Correct referencing is important for two main reasons. The first is to enable the reader to
access source material you have relied upon, should they care to. The other is to ensure that
you have properly recognized the contribution of the work of others to your assignment. If you
do not do this properly, you are engaging in plagiarism—the theft, intentional or otherwise, of
the intellectual or creative work of others.
UBBS will not tolerate plagiarism. It is therefore important that you understand how to avoid it. It
is important that you adopt a consistent, and adequate, referencing system.
Essay Topic:
(a) Select a publicly listed company in Australia and write a brief on the company and its
products and services.
(b) Examine the company’s risk management strategy (i.e. policies) and the risk appetite.
(c) What risk areas is the company focused on and why?
Note: It is important for students to read and understand the company’s risk management
strategy and relate it to the company’s industry, products or services.
1
7
Student Name____________________________________________
COLLEGE OF EDUCATION, HUM ...
Principles of care in health and social care.docx4934bk
This document outlines the requirements for an essay and report on principles of care in health and social care. It includes 4 tasks that must be completed:
1) Explain principles of support, procedures for protecting clients, analyze benefits of person-centered care, and discuss ethical dilemmas.
2) Explain relevant policies, legislation, and codes of practice. Also how local policies are developed and the impact of regulations.
3) Explain theories underpinning practice, analyze social impacts on clients, and evaluate inter-professional collaboration.
4) Explain own role and responsibilities, evaluate contributions to policy, and make recommendations for good practice.
Please do each part on separate attachement (do them individually .docxstilliegeorgiana
Please do each part on separate attachement (do them individually as they are not related to each other)
Part1: 2 pages aoa style, reference page required.
The “Average Man”? Daniels (1952)
https://apps.dtic.mil/dtic/tr/fulltext/u2/010203.pdf
Beyond Average Hough (2020)
https://www.gse.harvard.edu/news/ed/15/08/beyond-average
Directions:
Please respond to the following prompts. Be sure to copy and paste the prompts into your report and place your response directly below the prompt to which you are responding.
Use of complete sentences (minimally 5 - 8 sentences in response to each prompt) , APA format when referencing either article, good layout and formatting, and use of a 12 pt font are expected.
Question Prompts:
1) Considering what you've read in these article, what do you think of when you hear the term 'individualized (or personalized) learning'? What do you believe individualized learning should like for students in an online classroom?
2) Use Google Scholar to find ONE online accessible resources on the topic of individualized learning in an online classroom. Cite your resource using APA format. After reading your resource, summarize in detail at least 2 key take-aways from your resource.
Part2:
See attached pdf reading for A section and youtube video for B secontion answer the below in one page (short answers) no reference page needed for part 2 (discussion style)
A-
(Mertler, 2007) defines data-driven instructional decision making (or D-DIDM) as a “process by which educators examine [data] in order to identify student strengths and deficiencies” .
1) What are Mertler's thoughts regarding the history of instructional decision making? Do you agree? Why or why not?
2) Mertler refers to the 'art of teaching'. After reading his thoughts, what do you interpret this phrase to mean? How might student learning in an online classroom be impacted by the 'art of teaching'?
3) Review what Mertler implies distinctions between the art of teaching responsibilities of researchers and those of practitioners (instructors). If you were advising an online education practitioner based on Mertler's writings, how would you describe what ONE of their responsibilities might look like? Please ensure that your response applies specifically to the role of a facilitator of online instruction.
B-
https://www.youtube.com/watch?v=-kHm6YiboHA
1) Discuss your perspective on ONE comparable and/or contrasted position taken by the two lecturers. Try to provide perspectives that have not been previously shared by other student posters to this forum.
2) List ONE characteristic that you believe the 'average online student' may possess? What could potentially be done within an online classroom to support a student possessing this characteristic? How might your suggestion support better learning outcomes for the student? Try to provide perspectives that have not been previously shared by other student posters to this forum.
Part3
Why is it import ...
Please do each part on separate attachement (do them individually .docxcherry686017
Please do each part on separate attachement (do them individually as they are not related to each other)
Part1: 2 pages aoa style, reference page required.
The “Average Man”? Daniels (1952)
https://apps.dtic.mil/dtic/tr/fulltext/u2/010203.pdf
Beyond Average Hough (2020)
https://www.gse.harvard.edu/news/ed/15/08/beyond-average
Directions:
Please respond to the following prompts. Be sure to copy and paste the prompts into your report and place your response directly below the prompt to which you are responding.
Use of complete sentences (minimally 5 - 8 sentences in response to each prompt) , APA format when referencing either article, good layout and formatting, and use of a 12 pt font are expected.
Question Prompts:
1) Considering what you've read in these article, what do you think of when you hear the term 'individualized (or personalized) learning'? What do you believe individualized learning should like for students in an online classroom?
2) Use Google Scholar to find ONE online accessible resources on the topic of individualized learning in an online classroom. Cite your resource using APA format. After reading your resource, summarize in detail at least 2 key take-aways from your resource.
Part2:
See attached pdf reading for A section and youtube video for B secontion answer the below in one page (short answers) no reference page needed for part 2 (discussion style)
A-
(Mertler, 2007) defines data-driven instructional decision making (or D-DIDM) as a “process by which educators examine [data] in order to identify student strengths and deficiencies” .
1) What are Mertler's thoughts regarding the history of instructional decision making? Do you agree? Why or why not?
2) Mertler refers to the 'art of teaching'. After reading his thoughts, what do you interpret this phrase to mean? How might student learning in an online classroom be impacted by the 'art of teaching'?
3) Review what Mertler implies distinctions between the art of teaching responsibilities of researchers and those of practitioners (instructors). If you were advising an online education practitioner based on Mertler's writings, how would you describe what ONE of their responsibilities might look like? Please ensure that your response applies specifically to the role of a facilitator of online instruction.
B-
https://www.youtube.com/watch?v=-kHm6YiboHA
1) Discuss your perspective on ONE comparable and/or contrasted position taken by the two lecturers. Try to provide perspectives that have not been previously shared by other student posters to this forum.
2) List ONE characteristic that you believe the 'average online student' may possess? What could potentially be done within an online classroom to support a student possessing this characteristic? How might your suggestion support better learning outcomes for the student? Try to provide perspectives that have not been previously shared by other student posters to this forum.
Part3
Why is it import.
Principles of care in health and social care.docxwrite5
This document outlines the requirements for an essay and report on principles of care in health and social care. It includes 4 tasks that cover: 1) understanding how principles are implemented in practice, 2) understanding the impact of policy and legislation, 3) understanding theories underpinning health and social care, and 4) contributing to development and implementation of policy. For each task, the document provides learning outcomes, case scenarios, and specific sections to address such as explaining principles, outlining procedures, analyzing approaches, and evaluating impacts, roles and contributions.
Principles of care in health and social care.docxsdfghj21
This document outlines the requirements for an essay and report on principles of care in health and social care. It includes 4 tasks that cover: 1) understanding how principles are implemented in practice, 2) understanding the impact of policy and legislation, 3) understanding theories underpinning health and social care, and 4) contributing to development and implementation of policy. For each task, the document provides learning outcomes, case scenarios, and specific sections to address such as explaining principles, outlining procedures, analyzing approaches, and evaluating impacts, roles and contributions.
This document provides instructions for an individual assignment in an Auditing and Assurance Services course. It includes 3 sections with multiple questions in each section. Section A asks students to discuss reasons why a lecturer should fail or pass a student who does not meet certain graduate attributes related to ethics. Section B asks students to discuss examples of how behavioral biases can influence auditors' judgements and to submit academic articles on the topic. Section C asks students to discuss the evolution of auditors' liability to third parties in specified countries. The assignment is due on October 10 and should be submitted in the assignment box. It will be marked out of 20 total marks.
Discussion I Highlight Metabolic SyndromeAs the incidence .docxduketjoy27252
The document provides guidelines for a course reflection assignment in NUR3826. Students are asked to reflect on competencies from the BSN Essentials related to healthcare policy and advocacy that were developed through course readings, discussions, and activities. The reflection should include a self-assessment of skills and abilities related to 13 sub-competencies. It should be 3-6 pages long and follow APA format. The reflection will be graded based on introduction, content, conclusion, writing clarity, and APA format.
Chapter 1 – Science, Society, and Criminological ResearchI.docxcravennichole326
Chapter 1 – Science, Society, and Criminological Research
Identify and define/describe the everyday errors in reasoning.
Describe the four (4) categories of purposes for social science research: descriptive, exploratory, explanatory, and evaluation.
Define and describe qualitative and quantitative research methods. How are each carried out?
Chapter 2 – The Process and Problems of Criminological Research
Discuss what makes a good research question (*hint: feasibility, social importance, and scientific relevance).
Consider the role of criminological theory in research.
· What is a theory?
· What purposes do criminological theories serve?
· What requirements do theories need to adhere to?
Consider the research process.
· What is a hypothesis?
· Define independent and dependent variables. Know the relationship between the two.
· Discuss the role of the IV(s) and DV in research hypotheses.
· Be able to identify both in research hypotheses.
The research circle consists of three (3) main research strategies: Deductive, inductive, and descriptive research. (*Please note that I would like to clarify that descriptive research is different than both inductive and deductive research.)
· Explain the research circle.
· Define and describe deductive and inductive reasoning. Know the difference between the two.
· Define each of the following: variable, independent variable, and dependent variable.
· Discuss the role of variables (independent and dependent) in the research process.
Identify the different scientific guidelines for research.
Chapter 3 – Research Ethics
Consider the Stanford Prison Experiment – Zimbardo.
· What is the main ethical concern raised by many researchers?
Consider the Belmont Report.
· What is the Belmont Report?
· Why did it come about?
· Identify and define the three (3) basic ethical principles for the protection of human subjects.
Define and describe the institutional review board (IRB)?
Identify and describe (summarize) main points regarding current ethical principles in research practice (*see assigned reading, powerpoints (on Moodle), and provided lecture notes (on Moodle).
· Achieving Valid Result
· Honesty and Openness
· Uses of Research
· Protecting Research Participants
Chapter 4 – Conceptualization and Measurement
Define concepts, conceptualization, and operationalization. Discuss the role of each in research.
Define level of measurement and describe each one, while providing examples of each – Nominal, ordinal, interval, and ratio.
Define and discuss the relevance of measurement validity and reliability. Know the difference between the two, in their roles in research.
Define/describe each of the following forms of measurement validity and reliability:
· Criterion validity
· Face validity
· Test-retest reliability
· Intraobserve ...
Principles of care in health and social care.docx4934bk
This document outlines the requirements for an essay and report on principles of care in health and social care. It includes 4 tasks that must be completed:
1) Explain principles of support, procedures for protecting clients, analyze benefits of person-centered care, and discuss ethical dilemmas.
2) Explain relevant policies, legislation, and codes of practice. Also how local policies are developed and the impact of regulations.
3) Explain theories underpinning practice, analyze social impacts on clients, and evaluate inter-professional collaboration.
4) Explain own role and responsibilities, evaluate contributions to policy, and make recommendations for good practice.
Please do each part on separate attachement (do them individually .docxstilliegeorgiana
Please do each part on separate attachement (do them individually as they are not related to each other)
Part1: 2 pages aoa style, reference page required.
The “Average Man”? Daniels (1952)
https://apps.dtic.mil/dtic/tr/fulltext/u2/010203.pdf
Beyond Average Hough (2020)
https://www.gse.harvard.edu/news/ed/15/08/beyond-average
Directions:
Please respond to the following prompts. Be sure to copy and paste the prompts into your report and place your response directly below the prompt to which you are responding.
Use of complete sentences (minimally 5 - 8 sentences in response to each prompt) , APA format when referencing either article, good layout and formatting, and use of a 12 pt font are expected.
Question Prompts:
1) Considering what you've read in these article, what do you think of when you hear the term 'individualized (or personalized) learning'? What do you believe individualized learning should like for students in an online classroom?
2) Use Google Scholar to find ONE online accessible resources on the topic of individualized learning in an online classroom. Cite your resource using APA format. After reading your resource, summarize in detail at least 2 key take-aways from your resource.
Part2:
See attached pdf reading for A section and youtube video for B secontion answer the below in one page (short answers) no reference page needed for part 2 (discussion style)
A-
(Mertler, 2007) defines data-driven instructional decision making (or D-DIDM) as a “process by which educators examine [data] in order to identify student strengths and deficiencies” .
1) What are Mertler's thoughts regarding the history of instructional decision making? Do you agree? Why or why not?
2) Mertler refers to the 'art of teaching'. After reading his thoughts, what do you interpret this phrase to mean? How might student learning in an online classroom be impacted by the 'art of teaching'?
3) Review what Mertler implies distinctions between the art of teaching responsibilities of researchers and those of practitioners (instructors). If you were advising an online education practitioner based on Mertler's writings, how would you describe what ONE of their responsibilities might look like? Please ensure that your response applies specifically to the role of a facilitator of online instruction.
B-
https://www.youtube.com/watch?v=-kHm6YiboHA
1) Discuss your perspective on ONE comparable and/or contrasted position taken by the two lecturers. Try to provide perspectives that have not been previously shared by other student posters to this forum.
2) List ONE characteristic that you believe the 'average online student' may possess? What could potentially be done within an online classroom to support a student possessing this characteristic? How might your suggestion support better learning outcomes for the student? Try to provide perspectives that have not been previously shared by other student posters to this forum.
Part3
Why is it import ...
Please do each part on separate attachement (do them individually .docxcherry686017
Please do each part on separate attachement (do them individually as they are not related to each other)
Part1: 2 pages aoa style, reference page required.
The “Average Man”? Daniels (1952)
https://apps.dtic.mil/dtic/tr/fulltext/u2/010203.pdf
Beyond Average Hough (2020)
https://www.gse.harvard.edu/news/ed/15/08/beyond-average
Directions:
Please respond to the following prompts. Be sure to copy and paste the prompts into your report and place your response directly below the prompt to which you are responding.
Use of complete sentences (minimally 5 - 8 sentences in response to each prompt) , APA format when referencing either article, good layout and formatting, and use of a 12 pt font are expected.
Question Prompts:
1) Considering what you've read in these article, what do you think of when you hear the term 'individualized (or personalized) learning'? What do you believe individualized learning should like for students in an online classroom?
2) Use Google Scholar to find ONE online accessible resources on the topic of individualized learning in an online classroom. Cite your resource using APA format. After reading your resource, summarize in detail at least 2 key take-aways from your resource.
Part2:
See attached pdf reading for A section and youtube video for B secontion answer the below in one page (short answers) no reference page needed for part 2 (discussion style)
A-
(Mertler, 2007) defines data-driven instructional decision making (or D-DIDM) as a “process by which educators examine [data] in order to identify student strengths and deficiencies” .
1) What are Mertler's thoughts regarding the history of instructional decision making? Do you agree? Why or why not?
2) Mertler refers to the 'art of teaching'. After reading his thoughts, what do you interpret this phrase to mean? How might student learning in an online classroom be impacted by the 'art of teaching'?
3) Review what Mertler implies distinctions between the art of teaching responsibilities of researchers and those of practitioners (instructors). If you were advising an online education practitioner based on Mertler's writings, how would you describe what ONE of their responsibilities might look like? Please ensure that your response applies specifically to the role of a facilitator of online instruction.
B-
https://www.youtube.com/watch?v=-kHm6YiboHA
1) Discuss your perspective on ONE comparable and/or contrasted position taken by the two lecturers. Try to provide perspectives that have not been previously shared by other student posters to this forum.
2) List ONE characteristic that you believe the 'average online student' may possess? What could potentially be done within an online classroom to support a student possessing this characteristic? How might your suggestion support better learning outcomes for the student? Try to provide perspectives that have not been previously shared by other student posters to this forum.
Part3
Why is it import.
Principles of care in health and social care.docxwrite5
This document outlines the requirements for an essay and report on principles of care in health and social care. It includes 4 tasks that cover: 1) understanding how principles are implemented in practice, 2) understanding the impact of policy and legislation, 3) understanding theories underpinning health and social care, and 4) contributing to development and implementation of policy. For each task, the document provides learning outcomes, case scenarios, and specific sections to address such as explaining principles, outlining procedures, analyzing approaches, and evaluating impacts, roles and contributions.
Principles of care in health and social care.docxsdfghj21
This document outlines the requirements for an essay and report on principles of care in health and social care. It includes 4 tasks that cover: 1) understanding how principles are implemented in practice, 2) understanding the impact of policy and legislation, 3) understanding theories underpinning health and social care, and 4) contributing to development and implementation of policy. For each task, the document provides learning outcomes, case scenarios, and specific sections to address such as explaining principles, outlining procedures, analyzing approaches, and evaluating impacts, roles and contributions.
This document provides instructions for an individual assignment in an Auditing and Assurance Services course. It includes 3 sections with multiple questions in each section. Section A asks students to discuss reasons why a lecturer should fail or pass a student who does not meet certain graduate attributes related to ethics. Section B asks students to discuss examples of how behavioral biases can influence auditors' judgements and to submit academic articles on the topic. Section C asks students to discuss the evolution of auditors' liability to third parties in specified countries. The assignment is due on October 10 and should be submitted in the assignment box. It will be marked out of 20 total marks.
Discussion I Highlight Metabolic SyndromeAs the incidence .docxduketjoy27252
The document provides guidelines for a course reflection assignment in NUR3826. Students are asked to reflect on competencies from the BSN Essentials related to healthcare policy and advocacy that were developed through course readings, discussions, and activities. The reflection should include a self-assessment of skills and abilities related to 13 sub-competencies. It should be 3-6 pages long and follow APA format. The reflection will be graded based on introduction, content, conclusion, writing clarity, and APA format.
Chapter 1 – Science, Society, and Criminological ResearchI.docxcravennichole326
Chapter 1 – Science, Society, and Criminological Research
Identify and define/describe the everyday errors in reasoning.
Describe the four (4) categories of purposes for social science research: descriptive, exploratory, explanatory, and evaluation.
Define and describe qualitative and quantitative research methods. How are each carried out?
Chapter 2 – The Process and Problems of Criminological Research
Discuss what makes a good research question (*hint: feasibility, social importance, and scientific relevance).
Consider the role of criminological theory in research.
· What is a theory?
· What purposes do criminological theories serve?
· What requirements do theories need to adhere to?
Consider the research process.
· What is a hypothesis?
· Define independent and dependent variables. Know the relationship between the two.
· Discuss the role of the IV(s) and DV in research hypotheses.
· Be able to identify both in research hypotheses.
The research circle consists of three (3) main research strategies: Deductive, inductive, and descriptive research. (*Please note that I would like to clarify that descriptive research is different than both inductive and deductive research.)
· Explain the research circle.
· Define and describe deductive and inductive reasoning. Know the difference between the two.
· Define each of the following: variable, independent variable, and dependent variable.
· Discuss the role of variables (independent and dependent) in the research process.
Identify the different scientific guidelines for research.
Chapter 3 – Research Ethics
Consider the Stanford Prison Experiment – Zimbardo.
· What is the main ethical concern raised by many researchers?
Consider the Belmont Report.
· What is the Belmont Report?
· Why did it come about?
· Identify and define the three (3) basic ethical principles for the protection of human subjects.
Define and describe the institutional review board (IRB)?
Identify and describe (summarize) main points regarding current ethical principles in research practice (*see assigned reading, powerpoints (on Moodle), and provided lecture notes (on Moodle).
· Achieving Valid Result
· Honesty and Openness
· Uses of Research
· Protecting Research Participants
Chapter 4 – Conceptualization and Measurement
Define concepts, conceptualization, and operationalization. Discuss the role of each in research.
Define level of measurement and describe each one, while providing examples of each – Nominal, ordinal, interval, and ratio.
Define and discuss the relevance of measurement validity and reliability. Know the difference between the two, in their roles in research.
Define/describe each of the following forms of measurement validity and reliability:
· Criterion validity
· Face validity
· Test-retest reliability
· Intraobserve ...
Primary Health Care MultidisciplinaryTeam.docx4934bk
This document provides information about an assessment task for a subject focusing on primary health care and multidisciplinary teams. The assessment involves responding to a challenge brief from an industry partner. Students will draft a 200-400 word email to the client reframing the challenge and outlining their initial approach. They will also produce a 1,600 word annotated bibliography of four sources directly related to the challenge, including required sources on the Australian healthcare system and two peer-reviewed journal articles. The assessment aims to develop students' skills in problem solving, communication, and evidence-based solutions for the healthcare industry.
Long term careAssignment 1. Challenges in Long-Term Care.docxgauthierleppington
Long term care
Assignment 1.
Challenges in Long-Term Care
Your instructor will assign you a research article relating to the current challenges in the long-term care continuum and their impact on the current long-term care industry. Read the assigned research paper and research the South University Online Library and the Internet to learn more about the topic. After you have completed your review, create a 1- to 2-page synopsis in a Microsoft Word document addressing the main challenges discussed in the paper. Be sure to incorporate the following:
Introduction and background of the research paper
Stakeholders interested in the study
Challenges in the long-term care continuum
Impact of the challenges on the long-term care system (specifically on staffing, funding, and regulation)
Recommendations to address the challenges
Support your responses with examples.
Cite any sources in APA format.
Submission Details
Assignment 2 Grading Criteria
Maximum Points
Provided introduction and background of the research paper.
10
Identified stakeholders interested in the study.
5
Analyzed the challenges in the long-term care continuum.
10
Described the impact of the challenges on the long-term care system.
10
Recommended solutions to address the challenges.
10
Used correct spelling, grammar, and professional vocabulary. Cited all sources using APA format.
5
Total:
50
Assignment 2.
Course Project: Long-Term Care Facilities I
Choose two long-term care facilities—one from nursing facilities, assisted living, or subacute care and another from adult day care, home health care, or hospice care—on which you would want to base your research work. Research the South University Online Library and the Internet to read about your chosen long-term care facilities.
Assume you are responsible for the management and administration of the two facilities. You have to orient the newly appointed manager by providing an overview on managing long-term care. You also need to discuss the programs of the two facilities. From this perspective and based on your research about the facilities, prepare a Microsoft PowerPoint presentation of 10
–
15 slides including the following:
What are the various multidisciplinary departments (teams) included in your facilities?
Who comprise the target population being served by the various programs provided by your chosen facilities?
What are the major staffing and human resource issues faced by your chosen facilities?
What are the significant trends in long-term care likely to impact the operation of the various programs provided by your chosen facilities, and what is your plan of action to overcome them?
What are the various forms of cooperation and integration existing in your chosen facilities? Discuss the nature of management, financing, and quality issues related to integration and cooperation in the facilities?
Support your responses with examples.
Use the Notes section of the slides to provide additional information.
Cite.
Introduction and Summary In NU you developed your proposal.docxstudywriters
This document provides guidance for completing sections of a research proposal, including the introduction/background, specific aims, methods, population/recruitment, informed consent, confidentiality, risks/discomforts, and benefits. It instructs the reader to incorporate relevant information from previous assignments and proposals into these sections. The reader is asked to describe their research plan concisely and address specific questions about the procedures, timeline, analyses, inclusion/exclusion criteria, recruitment, consent process, data storage, risks, and potential benefits of the study.
Chronic Illnesses - DiscussionsSection 2Here you will b.docxsleeperharwell
Chronic Illnesses - Discussions
Section 2:
Here you will be evaluating and critiquing a scholarly article from a professional journal that is relevant to the course. CalSouthern has fabulous data bases where you will be able to locate articles in their entirely such as ProQuest.
https://learners.calsouthern.edu/Library/Default.aspx pageType=DW&parent_id=108
<https://learners.calsouthern.edu/Library/Default.aspx?pageType=DW&parent_id=108>
Using the University Virtual Library, find an article from a professional journal dated within the past 2 years that has significance to this course or you can select one of the resources listed in the Bibliography section, which is located under the course Resources tab. Include the following:
o title, author, date, and source
o a brief summary of the article and relevance to the course
o discuss the strengths and limitations
o discuss your interpretation of the findings or conclusions.
Section 3:
For this assignment you are required to watch a video on chronic illness
Your posting must include:
Summary of the information presented in the video
What you found as the most enlightening and educational in the video
Your own understanding of the application of the video to the course
Relevance of the video presentation to your own life or work experience
One specific area covered in the video that you would like to learn more about
Watch the following video in its entirety.
How to Live With a Chronic Illness
https://www.youtube.com/watch?v=DYnUaX67VbU
Section 4:
For this assignment you are required to watch a 3 brief videos on chronic pain
Your posting must include:
Summary of the information presented in the videos
What you found as the most enlightening and educational in the videos
Your own understanding of the application of the videos to the course
Relevance of the video presentations to your own life or work experience
One specific area covered in the videos that you would like to learn more about
Watch all 3 of the following videos in their entirety.
Dr Mark Morningstar Chronic Pain Workshop- Sources Of Pain 1of 6https://www.youtube.com/watch?v=GNNrAN_0F60
Dr Mark Morningstar - Chronic Pain - Auto Immune Disorders 2 of 6https://www.youtube.com/watch?v=LX89LfDKncA
Dr Morninstar Chronic Pain Workshop-Heavy Metal and Chemical Toxicity 3 of 6
https://www.youtube.com/watch?v=KKmRMVzM8cc
Section 5:
For this assignment you are required to watch 3 brief videos on chronic pain
Your posting must include:
Summary of the information presented in the videos
What you found as the most enlightening and educational in the videos
Your own understanding of the application of the videos to the course
Relevance of the video presentations to your own life or work experience
One specific area covered in the videos that you would like to learn more about
Watch all 3 of the following videos in their entirety.
Dr Morninstar Chronic Pain Workshop-Heavy Metal and Chemical To.
1
1
3
Writing Assignment #3
Proposal Memo to the Decision-maker
Summary of assignment
· Task: You will complete the following:
· Identify the decision-maker or group of decision-makers to whom you will write this memo.
· Consider the secondary research you conducted on your topic for writing assignment #2 and what additional secondary research you will need.
· Write a proposal memo to your decision-maker asking for permission to write a report based upon your research.
· Length: 700-1000 words
· Format: A template for the memo is provided on page 2.
How This Assignment Informs Writing Assignment #4
This proposal memo is a preliminary step you take prior to writing your final paper, which is the research-based report (writing assignment #4). Your final paper in WRTG 394 will be a report in which you:
· define a problem in your workplace or community persuasively and accurately.
· propose a solution or solutions to the problem or issue.
As part of defining the problem and proposing a solution, you must conduct additional secondary research to that which you conducted for your synthesis literature review.
In Writing Assignment #3, the proposal to conduct research, you are persuading a decision-maker or group of decisionmakers to authorize you to begin conducting this research that will end up in your final report.
The main purposes of the research proposal memo are to accomplish the following:
· Demonstrate that the problem you’ve identified for Project #4 is significant enough to warrant investigation.
· Present a feasible plan or blueprint for your research.
· Set forth potential benefits to the organization or community from the research that justify the use of time and resources.
Template for Submitting Your Memo
Note: Please use the format outlined below, including the headers provided in bold, for the memo.
(
To: [Decision Maker Name(s) and title(s)]
From: [Your Name and title]
Date: [Today’s Date]
Subject: Request to Conduct Research on […]
Summary
[
Write one or two sentences
to explain
why you are writing this memo.
Specifically request to conduct research for a report on the topic.
]
What the Problem Is and Why It Needs to Be Investigated
[
In a series of paragraphs, describe the problem to which you are going to propose a solution and
explain why you think this problem is important.]
What
S
econdary
Research I Have Conducted
/Will Conduct
about the Problem
In one
-two
paragraph
s
describe
the secondary
research you have conducted on the problem
.]
[
[Be sure to mention both [Be
[
Be sure to mention both scholarly and trade/professional sources you have used
or hope to use.] to use
.]
Why We Will Benefit from My Research and Recommendations
[In one or two paragraphs, describe your recommendations to the problem/situation you are
describing. Include a description of the potential benefits that your organization or community
will incur by author ...
The document provides instructions for Writing Assignment #3, which requires students to write a proposal memo requesting permission to conduct additional research and write a report on an identified problem. The memo must identify the decision-maker, summarize previous and planned additional secondary research, and explain the benefits of authorizing the proposed research. A template is provided that outlines the required sections and formatting of the memo. Examples are also given to demonstrate how to make research topics specific and relevant to the intended audience.
Part 1 advocacy and policy reform compare and contrast three nuPOLY33
This document provides guidelines for a course reflection assignment in NUR3655. It outlines the purpose, course outcomes, requirements, and grading criteria for a reflective essay where students will:
1) Reflect on course readings, discussions and activities regarding preparedness in specific BSN competencies related to healthcare policy and advocacy.
2) Include a self-assessment of skills, knowledge and abilities gained in three to six pages using examples from the course to support assertions about selected competencies.
3) Conclude by summarizing benefits of pertinent BSN competencies pertaining to evidence-based practice.
The reflection will be graded on introduction, reflection content, conclusion, writing clarity, and APA format.
DNP-835A Patient Outcomes and Sustainable ChangeASSIGNMENT 2.docxpauline234567
DNP-835A: Patient Outcomes and Sustainable Change
ASSIGNMENT 2:
Please see the ATTACHED Quality and Sustainability Paper: Part 1
Quality and Sustainability Paper: Part 2
Assessment Description
The purpose of this assignment is to determine what is needed to promote successful implementation and sustainability of a quality or safety program for your selected health care entity/issue.
General Guidelines:
Use the following information to ensure successful completion of the assignment:
· This assignment uses a rubric. Please review the rubric prior to beginning the assignment to become familiar with the expectations for successful completion.
· Doctoral learners are required to use APA style for their writing assignments. The APA Style Guide is located in the Student Success Center.
· This assignment requires that you support your position by referencing six to eight scholarly resources. At least three of your supporting references must be from scholarly sources other than the assigned readings.
· You are required to submit this assignment to LopesWrite. A link to the LopesWrite technical support articles is located in Class Resources if you need assistance.
· Learners will submit this assignment using the assignment dropbox in the digital classroom. In addition, learners must upload this deliverable to the Learner Dissertation Page (LDP) in the DNP PI Workspace for later use.
Directions:
Write a paper (2,000-2,500 words) that provides the following:
1. Incorporate all necessary revisions and corrections suggested by your instructor for Part 1. Synthesize the different elements of Part 1 and Part 2 into one paper using transitions to connect ideas and concepts.
2. Evaluate current evidenced-based quality and/or safety program designs that can be implemented to improve the quality and/or safety outcomes for your selected quality and/safety issue at your identified health care entity. Based on this evaluation, propose an evidence-based quality and/or safety program to address your selected issue from Part 1. Explain how your proposed design will better improve the outcomes for the selected quality and/or safety issue as compared to the program currently in place at the health care entity.
3. Identify potential obstacles (such as economics or ethical issues) that may hinder the implementation of the proposed quality and/or safety program and suggest ways to overcome these.
4. Identify stakeholders within the selected health care entity with whom you may need to collaborate and discuss the role of each stakeholder in the implementation of the proposed program. In the identification of stakeholders, also include specific groups and leaders that are needed.
5. Identify a change management theory you will use to support the implementation of your quality and/or safety program. Provide evidence that supports the use of this theory within the program you designed.
6. Discuss the expected outcomes of the implementation of your proposed quality and/or saf.
The document provides guidelines for a pathophysiology nursing reflection paper assignment. It outlines the requirements, which include writing a 3-6 page paper in APA format reflecting on how a pathophysiology course helped students develop skills in 33 BSN essential competencies. Students must introduce their reflection, assess their learning as it relates to each competency using examples, and conclude by summarizing the benefits of the competencies for evidence-based practice. The guidelines also include grading criteria such as an 8-point introduction, 80-point reflection on competencies, 4-point conclusion, and points for writing clarity, citations, and formatting.
BUS 499 Module 3 Homework AssignmentDirections Throughout this.docxRAHUL126667
BUS 499: Module 3 Homework Assignment
Directions: Throughout this course, you will be working on your senior capstone project. You will submit a component for this project at the end of each module.
Submit the following:
1. Find at least four more articles (scholarly journal articles) that apply to your topic.
2. Submit an Annotated Bibliography for each article you found. This is to be separate from the bibliography for the research proposal (also known as references in APA format).
3. Submit a bibliography in correct APA format for all of the articles you have read for your research proposal up to this point. You will add to this as you continue with your project with updated research that you find, but this will constitute the basis of your research on your topic.
4. Identify the top two articles that you find most pertinent to your topic and explain why.
5. Explain the theories and research methods that were used in those top 2 articles.
6. Explain whether you will use one of those theories to study your particular business problem.
7. Separately, submit a progress report that is one page in length and covers the state of the project, including accomplishments, issues, and concerns.
American Psychological Association. Basics of APA Style (http://www.apastyle.org/.).
xercise I: Developing a research instrument
QUANTITATIVE STUDIES
Now that you have gone through all the chapters that constitute Step I of the research process, this exercise provides you with an opportunity to apply that knowledge to formulate a research problem that is of interest to you. As you know, selecting a research problem is one of the most important aspects of social research, so this exercise will, therefore, help you in formulating your research problem by raising questions and issues that will guide you to examine critically various facets and implications of what you are proposing to study. The exercise is designed to provide a directional framework that guides you through the problem formulation path. Keep in mind that the questions and issues raised in this exercise are not prescriptive but indicative and directional; hence you need to be critical and innovative while working through them. Thinking through a research problem with care can prevent a tremendous wastage of human and financial resources.
A research problem should be clearly stated and be specific in nature. The feasibility of the study in terms of the availability of technical expertise, finances, and time, and in terms of its relevance, should be considered thoroughly at the problem-formulation stage. In studies that attempt to establish a causal relationship or an association, the accuracy of the measurement of independent (cause) and dependent (effect) variables is of crucial importance and, hence, should be given serious consideration. If you have already selected a problem, you need not go through this process.
Start by identifying a broad area you are interested in. For e ...
The document outlines learning competencies for English III, including listening skills, literature analysis skills, and writing skills. It discusses competencies such as identifying reasons cited in argumentative texts, determining whether arguments are logical or illogical, tracing character development in narratives, and differentiating literary genres. The competencies are designed to develop analytical thinking and appreciation of varied genres of British and American literature.
This document provides guidance on how to write and publish a scientific paper in 3 steps:
1. Plan adequate time for writing a high-quality paper that will be accepted for publication. Previous studies show lack of time is the top reason papers are not published.
2. Carefully review the instructions for authors on the target journal's website and adhere strictly to formatting requirements. Ignoring guidelines is a common reason for rejection.
3. The paper should have key sections - an informative abstract, introduction establishing the study's purpose and novelty, thorough methods section, clear results, and conclusions tying it all together. Following best practices increases the chances of successful publication.
2Compensation and Benefits Strategy Grading GuideIndividual .docxtamicawaysmith
2
Compensation and Benefits Strategy Grading GuideIndividual Assignment: Compensation and Benefits StrategyPurpose of Assignment
The purpose of this assignment is to give learners experience developing a total rewards program. Students will assess the needs of an organization and discuss current trends. Students will present a total rewards strategy with recommendations for an organization. It is important to students to understand the decision points for compensation and benefits.Grading Guide
Content
Met
Partially Met
Not Met
Comments:
Discuss current trends shaping total rewards for employees in a business industry synonymous with the organization chosen for the assignment.
Evaluate current compensation plans for that business industry.
Summarize your data in narrative and table format showing diverse levels of responsibility and compensation.
Devise a Total Rewards Strategy with recommendations for the organization.
Include in table format a list of compensation components for your plan.
Include an analysis of legislation that may impact decisions made about compensation and benefits.
Include a one page survey that you would use as a resource to collect information from employees about the rewards they desire in a reward package.
The paper is 1,225 words in length.
Total Available
Total Earned
8
#/8
Writing Guidelines
Met
Partially Met
Not Met
Comments:
The paper—including tables and graphs, headings, title page, and reference page—is consistent with APA formatting guidelines and meets course-level requirements.
Intellectual property is recognized with in-text citations and a reference page.
Paragraph and sentence transitions are present, logical, and maintain the flow throughout the paper.
Sentences are complete, clear, and concise.
Rules of grammar and usage are followed including spelling and punctuation.
Total Available
Total Earned
2
#/2
Assignment Total
#
10
#/10
Additional comments:
Wellness
submit a two- to three-page outline of your final project presentation. Think of it as a script with notes to help add context to the points you will be making. It does not need to use complete sentences or paragraphs, but it should contain enough detail to allow your instructor to offer you some feedback.
Your outline should be based on the critical elements listed below (from the Final Project Guidelines and Rubric document). Note that these are not in any particular order; they can be constructed in your presentation in any configuration.
I. Introduction: For this part of the assessment, you will examine the role of wellness in society and how it influences aspects of culture and the individual. This is on general 6 dimensions of wellness
A. Analyze how social practices have shaped our idea of wellness and how that idea of wellness has shaped social practices.
B. Utilizing interdisciplinary approaches, explain how a topic discussed in this course has or has not shaped o ...
GE 3000 – Introduction Section (Research Problem Statement)Int.docxshericehewat
GE 3000 – Introduction Section (Research Problem Statement)
Introduction: Formulating a Research Problem is the first and most important step of the research process. While the main portion of your work for this semester is focused on the Literature Review, the introduction to the research paper - The Research Problem Statement – is an important step in setting up the research problem to be investigated.
The Research Problem Statement comes before the Literature Review and acts as an introduction in a full-length research paper. The Research Problem Statement should be about 250-350 words in length, or about a page to a page-and-a-half when double-spaced. You must cite a minimum of two references (two scholarly sources) in proper MLA or APA format.
The main questions a Research Problem answers are:
· What will be researched? Identify a specific problem, program, or phenomenon
· Who will be researched? Who is the study population (people)?
Questions you should ask yourself when composing the Research Problem:
(Note that these questions are not necessarily going to be explicitly answered question-by-question in the Research Problem Statement. Rather, these are things that you should be thinking about and able to answer for yourself before you begin constructing the document).
· Who is the study population? How can you further refine the study population?
· What exactly do you want to understand about the topic/problem?
· Is the Research Problem too broad?
· How relevant is the research to your study area/discipline/major/interests?
· What motivates you to do the research on the chosen topic/problem?
· Why should others be interested in your chosen topic/problem?
· What are the concepts and issues to be studied?
· What concepts and measurements have to be further defined before the study begins?
· Do you have enough time to complete the research?
· Is an answer to the Research Problem obvious?
Constructing a Research Problem
A Research Problem typically consists of three parts: 1) the ideal, 2) the reality, and 3) the consequences.
1. Part A- the ideal: Describes a desired goal or ideal situation; explains how things should be.
2. Part B - the reality: Describes a condition that prevents the goal, state, or value in Part A from being achieved or realized at this time; explains how the current situation falls short of the goal or ideal.
3. Part C - the consequences: Identifies the way you propose to improve the current situation and move it closer to the goal or ideal.
Steps to Writing a Research Problem:
Step 1 (statement 1): Construct statement 1 by describing a goal or desired state of a given situation, phenomenon etc. This will build the ideal situation (what should be, what is expected, desired). How should things be in your topic? What is the ideal scenario?
Step 2 (statement 2): Describe a condition that prevents the goal, state, or value discussed in step 1 from being achieved or realized at the present time. This will build ...
BOS 3701, Industrial Ergonomics 1
Course Description
Review of the principles and practices of ergonomics as it applies to the industrial environment. Demonstrates how to
collect data on users and operators and how to convert the data to good workplace design.
Course Textbook
Bush, P. M. (2012). Ergonomics: Foundational principles, applications, and technologies. Boca Raton, FL: CRC Press.
Course Learning Outcomes
Upon completion of this course, students should be able to:
1. Specify and design ergonomically appropriate industrial workstations for the industrial and office work
environment.
2. Identify information-centered human factors relating to visual, illumination, controls, displays, and symbols.
3. Compare, contrast, and assess human body-centered ergonomic designs for posture, material handling,
repetitive motion factors, heat stress, noise, and vibration.
4. Examine and evaluate organizational or management-centered ergonomic factors for training, skills, and cognitive
task analysis.
5. Define the ergonomic factors intrinsic in evaluating accidents, human errors, and safety related incidents.
6. Illustrate and assess the ergonomic factors in computer work station design.
7. Discuss and identify key components of cost-benefit analysis in human factors and ergonomic design.
8. Summarize key components in conducting a human factors or ergonomics related investigation.
Credits
Upon completion of this course, the students will earn three (3) hours of college credit.
Course Structure
1. Unit Learning Outcomes: Each unit contains Learning Outcomes that specify the measurable skills and
knowledge students should gain upon completion of the unit..
2. Unit Lesson: Each unit contains a Unit Lesson, which discusses lesson material.
3. Reading Assignments: Each unit contains Reading Assignments from one or more chapters from the textbook
or a publication from the NIOSH. Suggested Readings are provided in the unit study guides to aid students in
their course of study.
4. Learning Activities (Non-Graded): These non-graded Learning Activities are provided to aid students in their
course of study.
5. Key Terms: Key Terms are intended to guide students in their course of study. Students should pay particular
attention to Key Terms as they represent important concepts within the unit material and reading.
6. Discussion Boards: Discussion Boards are a part of all CSU term courses. Information and specifications
regarding these assignments are provided in the Academic Policies listed in the Course Menu bar.
7. Unit Assessments: This course contains six Unit Assessments, one to be completed at the end of Units I-III and
V-VII. Assessments are composed of multiple-choice questions and written response questions.
8. Unit Assignments: Students are required to submit for grading Unit Assignments in Units IV and VIII. Specific
information and instructions regarding these assignmen ...
MGT 410Homework Set 1Provide a short answer to each of the fDioneWang844
MGT 410
Homework Set 1
Provide a short answer to each of the following questions.
1. Explain the difference between internal and external customers.
2. What might be some of the dangers of relying solely on customer input when designing or improving a product or service? What other inputs should be taken into account?
3. Compare and contrast Deming’s, Juran’s, and Crosby’s philosophies about quality.
4. What is the difference between quality control and quality assurance?
5. Discuss the differences between a dimension and a metric. How are they related? How do they differ?
6. Why is it important to assign weights to dimensions? What do the weights indicate?
7. How does a weighted dimension score differ from a raw dimension score?
8. What is the difference between the validity and reliability of a survey questionnaire?
9. How might an affinity diagram assist in content analysis?
10. Would “excellent product quality” be a strength for your firm if it was equivalent to the quality of competing products in the same market? Why or why not?
Exhibit 6.B: Elements of a Formally Structured Needs Assessment
Elements
Examples
Decide to conduct needs assessment
Make a conscious decision to complete a needs assessment with a commitment from key decision makers.
The Division of Continuing Medical Education, as part of the requirements for three major grant proposals, conducts a systematic statewide needs assessment of primary care physicians in a variety of settings.
Identify people and develop plan for needs assessment
Identify individuals to be involved in planning and overseeing the needs assessment, and develop a plan.
A steering committee of seven people is appointed, composed of two members of the Continuing Medical Education (CME) staff, two primary care physicians, a medical school faculty member, the assistant dean of the medical school, and an outside consultant. One of the CME staff is appointed as the project manager. The majority of the committee meetings are held online.
Determine context, purpose, and major questions
Determine important contextual factors, and develop purpose and major questions for the needs assessment.
The political and economic climate of the state, current trends in health care, and changes in the delivery of medicine constitute important contextual factors. The purpose for the needs assessment is to fulfill grant requirements for the proposals CME staff are preparing. With this context and purpose in mind the steering committee focuses the needs assessment on the following questions: (1) what are the major issues, needs, problems, and opportunities primary care physicians face in their practice?; and (2) in three years, how might these identified areas change, based on future forecasts and trends?
Determine logistics
Layout the target dates, time lines, budget, and staff.
The steering committee determines that it has to complete the needs assessment in six months. Two members of the CME staff ...
School of Community and Environmental HealthMPH Program .docxWilheminaRossi174
School of Community and Environmental Health
MPH Program
Epidemiology: MPH 746
(
Second
Assignment
)
(
Type in you name here as
First Name , Last Name
)
Read the Paper below and answer the following questions. Your answer should be typed in below; and the submitted document should be in Microsoft Word document. The answer for any question should not exceed one paragraph (5-6 lines). The deadline for submission is 11:59 pm EST Nov. 9th, 2022.
(
Ellison LF, Morrison HI:
Low serum cholesterol concentration and risk of suicide
.
Epidemiology
2001,
12
(2):168-172.
)
Question1 (Max. 0.5 point)
What is the purpose of the study?
Question2 (Max. 0.5 point)
What is the study design? What is the exposure? What is the outcome?
Question3 (Max. 2 points)
How the exposure was measured? How the outcome was measured?
Question4 (Max. 1.5 points)
From Table II, calculate the Crude Rate Ratio for serum total cholesterol <4.27 mmol/l compared to >5.77 mmol/l. (must show the details of calculation)
Question5 (Max. 1.5 points)
What is the meaning of this crude Rate Ratio?
Question6 (Max. 1.5 points)
In Table 3, what is the meaning of age and sex adjusted RR of serum total cholesterol <4.27 mmol/l compared to serum total cholesterol >5.77 mmol/l. Was there confounding by age and sex, why or why not? Is the RR statistically significant? What is the meaning of the 95%CI for the RR?
Question7 (Max. 0.5 points)
Was the ascertainment of the outcome as complete as possible? Was there a follow chart?
Question8 (Max. 0.5 points)
The authors stated in the discussion “The possibility of under-ascertainment of suicide deaths is always a concern, although it is probably unlikely that ascertainment varied by serum total cholesterol level”
Explain what the authors meant by their statement.
Question9 (Max. 0.5 points)
Were those who measured the outcome blinded from the exposure status?
Question10 (Max. 0.5 points)
Have the exposures been well measured, or is there any random or systematic misclassification?
Question11 (Max. 5 points)
Do the “exposed” differ from the “unexposed” with respect to other factors? Have these differences taken into account in the design or analysis? i.e. How the authors dealt with confounding?
1
image1.png
Students will synthesize the information they have gathered during the course to formulate a presentation advocating for a practice change in relation to an area of interest to NP practice.
Creating a Professional PowerPoint PresentationDownload Creating a Professional PowerPoint Presentation
In a PowerPoint Presentation, address the following.
1.
Title Slide
2.
Introduction (1 slide): Slide should identify concepts to be addressed and sections of the presentation. Include speaker’s notes that explain, in more detail, what will be covered.
.
BOS 3401, Construction Safety 1 Course Description .docxhartrobert670
BOS 3401, Construction Safety 1
Course Description
Exploration of the OSHA regulations and related safety practices governing the construction industry. Provides an
analysis of the high incident/accident rates in the construction industry and how it contributed to the passage of the OSH
Act in 1970. Presents practical examples of how to apply “on the job” construction safety and health programs and
policies.
Prerequisites
None
Course Textbook
Goetsch, D. L. (2010). Construction safety and the OSHA standards. Upper Saddle River, NJ: Prentice Hall.
Course Learning Objectives
Upon completion of this course, students should be able to:
1. Examine and explain the theories and concepts of construction safety and health.
2. Discuss, evaluate, and interpret OSHA's construction standards and related safety practices.
3. Describe how to apply construction safety and health programs and policies while on the job.
4. Identify and discuss safety and health issues and practices in the workplace.
5. Explain how to estimate the costs of work accidents and rates.
6. Describe contractors and safety and health teams.
7. Discuss ethics and safety, including how ethics is an important part in the construction safety profession.
8. Explain the Workers' Compensation Program.
9. Discuss hazard analysis and risk assessment.
10. Define and discuss stress, workplace violence, and conflict resolution.
11. Explain the emergency response system and its importance to the construction safety professional.
12. Discuss ISO 14000 and its importance to the construction professional.
Credits
Upon completion of this course, the students will earn three (3) hours of college credit.
Course Structure
1. Unit Learning Objectives: Each unit contains Unit Learning Objectives that specify the measurable skills
and knowledge students should gain upon completion of the unit.
2. Written Lectures: Each unit contains a Written Lecture, which discusses lesson material.
3. Reading Assignments: Each unit contains Reading Assignments from one or more chapters from the
textbook. Supplemental Readings are provided in Units III and V to aid students in their course of study.
4. Learning Activities (Non-Graded): These non-graded Learning Activities are provided in Unit VI to aid
students in their course of study.
5. Key Terms: Key Terms are intended to guide students in their course of study. Students should pay
particular attention to Key Terms as they represent important concepts within the unit material and reading.
BOS 3401, Construction Safety
Course Syllabus
BOS 3401, Construction Safety 2
6. Discussion Boards: Discussion Boards are a part of all CSU term courses. Information and specifications
regarding these assignments are provided in the Academic Policies listed in the Course Menu bar.
7. Unit Assessments: This course contains eight Unit Assessments, one to be completed at the end of each ...
Critical Thinking MOD 82 PGS TOTALStart by reading and follo.docxmydrynan
Critical Thinking
MOD 8
2 PGS TOTAL
Start by reading and following these instructions:
1. Quickly skim the questions or assignment below and the assignment rubric to help you focus.
2. Read the required chapter(s) of the textbook and any additional recommended resources. Some answers may require you to do additional research on the Internet or in other reference sources. Choose your sources carefully.
3. Consider the discussion and the any insights you gained from it.
4. Create your Assignment submission and be sure to cite your sources, use APA style as required, check your spelling.
Assignment:
1. What is the difference between Physical Causal Explanations and Behavioral Casual Explanations, and how do they tie into critical thinking?
2. Name the types of explanations and how they are evaluated. Use examples from your life to support your answer.
3. What is an Inference to the Best Explanation and how does it relate to forming a hypothesis?
4. What are the definitions of aesthetic value and judgment? Use examples from your life to support your definition.
INTRODUCTION TO ETHICS
MOD 8
Start by reading and following these instructions:
1. Quickly skim the questions or assignment below and the assignment rubric to help you focus.
2. Read the required chapter(s) of the textbook and any additional recommended resources. Some answers may require you to do additional research on the Internet or in other reference sources. Choose your sources carefully.
3. Consider the discussion and the any insights you gained from it.
4. Create your Assignment submission and be sure to cite your sources, use APA style as required, check your spelling.
Assignment:
Write an essay addressing each of the following points/questions. Separate your paper into sections outlined below. Each section in your paper needs a clear heading that allows your professor to know which bullet you are addressing in that section of your paper Review the rubric criteria for this assignment.
Your final assignment is to pull together all the information within the modules 1 – 8 to complete the final submission of your topic of choice from module 1. This assignment must be thorough and completely cover the aspects outlined in module 1.
When finalizing your final assignment, please:
· Introduce the topic you chose with its definition/background,
· Explain your opinion, for or against the topic, when you started your research and analysis,
· Discuss 2-3 reasons “from scholars” in favor and against the topic
· In summary format, review your findings and provide an answer if you are for or against the issue (your opinion) and why, based on the facts your scholarly research.
Assignment Expectations
Length: 2000 – 2250 words for this assignment
Structure: Include a title page and reference page in APA style. These do not count towards the minimum word requirement for this assignment.
References: Use the appropriate APA style in-text citations and references for all resources utilized to a.
Liberty UniversitySMGT 699 INTERNSHIPPORTFOLIO GUIDELINES.docxjesssueann
Liberty University
SMGT 699 INTERNSHIP
PORTFOLIO GUIDELINES
The following outline is intended to provide you with the guidelines for your internship. Although the focus of each student is primarily oriented to accomplishing the tasks and responsibilities assigned by each host organization, the following guidelines represent the writing and reporting requirements, which need to be submitted in the final week of the semester in order to receive a final grade for the experience.
The specific due date will be provided in Blackboard. Students are required to create a portfolio (word documents and/or excel spreadsheet). This submission will satisfy the “culminating experience” requirement by Liberty University in order to successfully complete graduate school.
INTERNSHIP FINAL REPORT:
This Report/Portfolio will be due during the final week of your internship and includes the following requirements for acceptance.
A. Length and Format: This report shall be as long or short as necessary to communicate the required information, Times or Times New Roman font size 12 pt. should be used. Feel free to include charts and supporting material that may be provided in an attached appendix.
B. Place and Date of Submission: ONLY an electronic copy of the final report should be submitted via Blackboard. Faxed reports will not be accepted. Do not mail a paper report.
C. Optional Revisions of Final Report: A student has the option of submitting the Final Report to the professor no later than Week 12. If an internship report is deemed unsatisfactory for any reason, it will be returned to the respective intern for revisions and modifications. Presentation and factualness of data, spelling, and grammar will be reviewed carefully and may result in required revisions. This report should be treated as a business report which will be evaluated and will be available for community review by faculty, staff, and students. If no revisions are necessary, the report will be accepted as final.
STRUCTURE OF FINAL INTERNSHIP REPORT
An internship final report should be structured to include the following sections and subsections.
I. THE ORGANIZATION:
A. Overview of Host Organization: Briefly describe the type of organization in which you worked and where/how it fits into the sport industry (e.g., local, regional, national, or international). Please include its primary constituencies and the primary nature of its operations (i.e., goods or services). Briefly describe the major purposes of the organization including its mission, goals, and strategic objectives. Please include any relevant promotional brochures and any other pertinent information that describes the work of the host organization. The data might include any strategic documents such as an annual report and/or strategic management plans.
B. Structure and Personnel of Host Organization: Briefly describe the organizational structure and its effectiveness with regard to management philosophies, leadersh.
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
More Related Content
Similar to 1 RISK MANAGEMENT (BAP 352) INDIVIDUAL ASSIGNMENT
Primary Health Care MultidisciplinaryTeam.docx4934bk
This document provides information about an assessment task for a subject focusing on primary health care and multidisciplinary teams. The assessment involves responding to a challenge brief from an industry partner. Students will draft a 200-400 word email to the client reframing the challenge and outlining their initial approach. They will also produce a 1,600 word annotated bibliography of four sources directly related to the challenge, including required sources on the Australian healthcare system and two peer-reviewed journal articles. The assessment aims to develop students' skills in problem solving, communication, and evidence-based solutions for the healthcare industry.
Long term careAssignment 1. Challenges in Long-Term Care.docxgauthierleppington
Long term care
Assignment 1.
Challenges in Long-Term Care
Your instructor will assign you a research article relating to the current challenges in the long-term care continuum and their impact on the current long-term care industry. Read the assigned research paper and research the South University Online Library and the Internet to learn more about the topic. After you have completed your review, create a 1- to 2-page synopsis in a Microsoft Word document addressing the main challenges discussed in the paper. Be sure to incorporate the following:
Introduction and background of the research paper
Stakeholders interested in the study
Challenges in the long-term care continuum
Impact of the challenges on the long-term care system (specifically on staffing, funding, and regulation)
Recommendations to address the challenges
Support your responses with examples.
Cite any sources in APA format.
Submission Details
Assignment 2 Grading Criteria
Maximum Points
Provided introduction and background of the research paper.
10
Identified stakeholders interested in the study.
5
Analyzed the challenges in the long-term care continuum.
10
Described the impact of the challenges on the long-term care system.
10
Recommended solutions to address the challenges.
10
Used correct spelling, grammar, and professional vocabulary. Cited all sources using APA format.
5
Total:
50
Assignment 2.
Course Project: Long-Term Care Facilities I
Choose two long-term care facilities—one from nursing facilities, assisted living, or subacute care and another from adult day care, home health care, or hospice care—on which you would want to base your research work. Research the South University Online Library and the Internet to read about your chosen long-term care facilities.
Assume you are responsible for the management and administration of the two facilities. You have to orient the newly appointed manager by providing an overview on managing long-term care. You also need to discuss the programs of the two facilities. From this perspective and based on your research about the facilities, prepare a Microsoft PowerPoint presentation of 10
–
15 slides including the following:
What are the various multidisciplinary departments (teams) included in your facilities?
Who comprise the target population being served by the various programs provided by your chosen facilities?
What are the major staffing and human resource issues faced by your chosen facilities?
What are the significant trends in long-term care likely to impact the operation of the various programs provided by your chosen facilities, and what is your plan of action to overcome them?
What are the various forms of cooperation and integration existing in your chosen facilities? Discuss the nature of management, financing, and quality issues related to integration and cooperation in the facilities?
Support your responses with examples.
Use the Notes section of the slides to provide additional information.
Cite.
Introduction and Summary In NU you developed your proposal.docxstudywriters
This document provides guidance for completing sections of a research proposal, including the introduction/background, specific aims, methods, population/recruitment, informed consent, confidentiality, risks/discomforts, and benefits. It instructs the reader to incorporate relevant information from previous assignments and proposals into these sections. The reader is asked to describe their research plan concisely and address specific questions about the procedures, timeline, analyses, inclusion/exclusion criteria, recruitment, consent process, data storage, risks, and potential benefits of the study.
Chronic Illnesses - DiscussionsSection 2Here you will b.docxsleeperharwell
Chronic Illnesses - Discussions
Section 2:
Here you will be evaluating and critiquing a scholarly article from a professional journal that is relevant to the course. CalSouthern has fabulous data bases where you will be able to locate articles in their entirely such as ProQuest.
https://learners.calsouthern.edu/Library/Default.aspx pageType=DW&parent_id=108
<https://learners.calsouthern.edu/Library/Default.aspx?pageType=DW&parent_id=108>
Using the University Virtual Library, find an article from a professional journal dated within the past 2 years that has significance to this course or you can select one of the resources listed in the Bibliography section, which is located under the course Resources tab. Include the following:
o title, author, date, and source
o a brief summary of the article and relevance to the course
o discuss the strengths and limitations
o discuss your interpretation of the findings or conclusions.
Section 3:
For this assignment you are required to watch a video on chronic illness
Your posting must include:
Summary of the information presented in the video
What you found as the most enlightening and educational in the video
Your own understanding of the application of the video to the course
Relevance of the video presentation to your own life or work experience
One specific area covered in the video that you would like to learn more about
Watch the following video in its entirety.
How to Live With a Chronic Illness
https://www.youtube.com/watch?v=DYnUaX67VbU
Section 4:
For this assignment you are required to watch a 3 brief videos on chronic pain
Your posting must include:
Summary of the information presented in the videos
What you found as the most enlightening and educational in the videos
Your own understanding of the application of the videos to the course
Relevance of the video presentations to your own life or work experience
One specific area covered in the videos that you would like to learn more about
Watch all 3 of the following videos in their entirety.
Dr Mark Morningstar Chronic Pain Workshop- Sources Of Pain 1of 6https://www.youtube.com/watch?v=GNNrAN_0F60
Dr Mark Morningstar - Chronic Pain - Auto Immune Disorders 2 of 6https://www.youtube.com/watch?v=LX89LfDKncA
Dr Morninstar Chronic Pain Workshop-Heavy Metal and Chemical Toxicity 3 of 6
https://www.youtube.com/watch?v=KKmRMVzM8cc
Section 5:
For this assignment you are required to watch 3 brief videos on chronic pain
Your posting must include:
Summary of the information presented in the videos
What you found as the most enlightening and educational in the videos
Your own understanding of the application of the videos to the course
Relevance of the video presentations to your own life or work experience
One specific area covered in the videos that you would like to learn more about
Watch all 3 of the following videos in their entirety.
Dr Morninstar Chronic Pain Workshop-Heavy Metal and Chemical To.
1
1
3
Writing Assignment #3
Proposal Memo to the Decision-maker
Summary of assignment
· Task: You will complete the following:
· Identify the decision-maker or group of decision-makers to whom you will write this memo.
· Consider the secondary research you conducted on your topic for writing assignment #2 and what additional secondary research you will need.
· Write a proposal memo to your decision-maker asking for permission to write a report based upon your research.
· Length: 700-1000 words
· Format: A template for the memo is provided on page 2.
How This Assignment Informs Writing Assignment #4
This proposal memo is a preliminary step you take prior to writing your final paper, which is the research-based report (writing assignment #4). Your final paper in WRTG 394 will be a report in which you:
· define a problem in your workplace or community persuasively and accurately.
· propose a solution or solutions to the problem or issue.
As part of defining the problem and proposing a solution, you must conduct additional secondary research to that which you conducted for your synthesis literature review.
In Writing Assignment #3, the proposal to conduct research, you are persuading a decision-maker or group of decisionmakers to authorize you to begin conducting this research that will end up in your final report.
The main purposes of the research proposal memo are to accomplish the following:
· Demonstrate that the problem you’ve identified for Project #4 is significant enough to warrant investigation.
· Present a feasible plan or blueprint for your research.
· Set forth potential benefits to the organization or community from the research that justify the use of time and resources.
Template for Submitting Your Memo
Note: Please use the format outlined below, including the headers provided in bold, for the memo.
(
To: [Decision Maker Name(s) and title(s)]
From: [Your Name and title]
Date: [Today’s Date]
Subject: Request to Conduct Research on […]
Summary
[
Write one or two sentences
to explain
why you are writing this memo.
Specifically request to conduct research for a report on the topic.
]
What the Problem Is and Why It Needs to Be Investigated
[
In a series of paragraphs, describe the problem to which you are going to propose a solution and
explain why you think this problem is important.]
What
S
econdary
Research I Have Conducted
/Will Conduct
about the Problem
In one
-two
paragraph
s
describe
the secondary
research you have conducted on the problem
.]
[
[Be sure to mention both [Be
[
Be sure to mention both scholarly and trade/professional sources you have used
or hope to use.] to use
.]
Why We Will Benefit from My Research and Recommendations
[In one or two paragraphs, describe your recommendations to the problem/situation you are
describing. Include a description of the potential benefits that your organization or community
will incur by author ...
The document provides instructions for Writing Assignment #3, which requires students to write a proposal memo requesting permission to conduct additional research and write a report on an identified problem. The memo must identify the decision-maker, summarize previous and planned additional secondary research, and explain the benefits of authorizing the proposed research. A template is provided that outlines the required sections and formatting of the memo. Examples are also given to demonstrate how to make research topics specific and relevant to the intended audience.
Part 1 advocacy and policy reform compare and contrast three nuPOLY33
This document provides guidelines for a course reflection assignment in NUR3655. It outlines the purpose, course outcomes, requirements, and grading criteria for a reflective essay where students will:
1) Reflect on course readings, discussions and activities regarding preparedness in specific BSN competencies related to healthcare policy and advocacy.
2) Include a self-assessment of skills, knowledge and abilities gained in three to six pages using examples from the course to support assertions about selected competencies.
3) Conclude by summarizing benefits of pertinent BSN competencies pertaining to evidence-based practice.
The reflection will be graded on introduction, reflection content, conclusion, writing clarity, and APA format.
DNP-835A Patient Outcomes and Sustainable ChangeASSIGNMENT 2.docxpauline234567
DNP-835A: Patient Outcomes and Sustainable Change
ASSIGNMENT 2:
Please see the ATTACHED Quality and Sustainability Paper: Part 1
Quality and Sustainability Paper: Part 2
Assessment Description
The purpose of this assignment is to determine what is needed to promote successful implementation and sustainability of a quality or safety program for your selected health care entity/issue.
General Guidelines:
Use the following information to ensure successful completion of the assignment:
· This assignment uses a rubric. Please review the rubric prior to beginning the assignment to become familiar with the expectations for successful completion.
· Doctoral learners are required to use APA style for their writing assignments. The APA Style Guide is located in the Student Success Center.
· This assignment requires that you support your position by referencing six to eight scholarly resources. At least three of your supporting references must be from scholarly sources other than the assigned readings.
· You are required to submit this assignment to LopesWrite. A link to the LopesWrite technical support articles is located in Class Resources if you need assistance.
· Learners will submit this assignment using the assignment dropbox in the digital classroom. In addition, learners must upload this deliverable to the Learner Dissertation Page (LDP) in the DNP PI Workspace for later use.
Directions:
Write a paper (2,000-2,500 words) that provides the following:
1. Incorporate all necessary revisions and corrections suggested by your instructor for Part 1. Synthesize the different elements of Part 1 and Part 2 into one paper using transitions to connect ideas and concepts.
2. Evaluate current evidenced-based quality and/or safety program designs that can be implemented to improve the quality and/or safety outcomes for your selected quality and/safety issue at your identified health care entity. Based on this evaluation, propose an evidence-based quality and/or safety program to address your selected issue from Part 1. Explain how your proposed design will better improve the outcomes for the selected quality and/or safety issue as compared to the program currently in place at the health care entity.
3. Identify potential obstacles (such as economics or ethical issues) that may hinder the implementation of the proposed quality and/or safety program and suggest ways to overcome these.
4. Identify stakeholders within the selected health care entity with whom you may need to collaborate and discuss the role of each stakeholder in the implementation of the proposed program. In the identification of stakeholders, also include specific groups and leaders that are needed.
5. Identify a change management theory you will use to support the implementation of your quality and/or safety program. Provide evidence that supports the use of this theory within the program you designed.
6. Discuss the expected outcomes of the implementation of your proposed quality and/or saf.
The document provides guidelines for a pathophysiology nursing reflection paper assignment. It outlines the requirements, which include writing a 3-6 page paper in APA format reflecting on how a pathophysiology course helped students develop skills in 33 BSN essential competencies. Students must introduce their reflection, assess their learning as it relates to each competency using examples, and conclude by summarizing the benefits of the competencies for evidence-based practice. The guidelines also include grading criteria such as an 8-point introduction, 80-point reflection on competencies, 4-point conclusion, and points for writing clarity, citations, and formatting.
BUS 499 Module 3 Homework AssignmentDirections Throughout this.docxRAHUL126667
BUS 499: Module 3 Homework Assignment
Directions: Throughout this course, you will be working on your senior capstone project. You will submit a component for this project at the end of each module.
Submit the following:
1. Find at least four more articles (scholarly journal articles) that apply to your topic.
2. Submit an Annotated Bibliography for each article you found. This is to be separate from the bibliography for the research proposal (also known as references in APA format).
3. Submit a bibliography in correct APA format for all of the articles you have read for your research proposal up to this point. You will add to this as you continue with your project with updated research that you find, but this will constitute the basis of your research on your topic.
4. Identify the top two articles that you find most pertinent to your topic and explain why.
5. Explain the theories and research methods that were used in those top 2 articles.
6. Explain whether you will use one of those theories to study your particular business problem.
7. Separately, submit a progress report that is one page in length and covers the state of the project, including accomplishments, issues, and concerns.
American Psychological Association. Basics of APA Style (http://www.apastyle.org/.).
xercise I: Developing a research instrument
QUANTITATIVE STUDIES
Now that you have gone through all the chapters that constitute Step I of the research process, this exercise provides you with an opportunity to apply that knowledge to formulate a research problem that is of interest to you. As you know, selecting a research problem is one of the most important aspects of social research, so this exercise will, therefore, help you in formulating your research problem by raising questions and issues that will guide you to examine critically various facets and implications of what you are proposing to study. The exercise is designed to provide a directional framework that guides you through the problem formulation path. Keep in mind that the questions and issues raised in this exercise are not prescriptive but indicative and directional; hence you need to be critical and innovative while working through them. Thinking through a research problem with care can prevent a tremendous wastage of human and financial resources.
A research problem should be clearly stated and be specific in nature. The feasibility of the study in terms of the availability of technical expertise, finances, and time, and in terms of its relevance, should be considered thoroughly at the problem-formulation stage. In studies that attempt to establish a causal relationship or an association, the accuracy of the measurement of independent (cause) and dependent (effect) variables is of crucial importance and, hence, should be given serious consideration. If you have already selected a problem, you need not go through this process.
Start by identifying a broad area you are interested in. For e ...
The document outlines learning competencies for English III, including listening skills, literature analysis skills, and writing skills. It discusses competencies such as identifying reasons cited in argumentative texts, determining whether arguments are logical or illogical, tracing character development in narratives, and differentiating literary genres. The competencies are designed to develop analytical thinking and appreciation of varied genres of British and American literature.
This document provides guidance on how to write and publish a scientific paper in 3 steps:
1. Plan adequate time for writing a high-quality paper that will be accepted for publication. Previous studies show lack of time is the top reason papers are not published.
2. Carefully review the instructions for authors on the target journal's website and adhere strictly to formatting requirements. Ignoring guidelines is a common reason for rejection.
3. The paper should have key sections - an informative abstract, introduction establishing the study's purpose and novelty, thorough methods section, clear results, and conclusions tying it all together. Following best practices increases the chances of successful publication.
2Compensation and Benefits Strategy Grading GuideIndividual .docxtamicawaysmith
2
Compensation and Benefits Strategy Grading GuideIndividual Assignment: Compensation and Benefits StrategyPurpose of Assignment
The purpose of this assignment is to give learners experience developing a total rewards program. Students will assess the needs of an organization and discuss current trends. Students will present a total rewards strategy with recommendations for an organization. It is important to students to understand the decision points for compensation and benefits.Grading Guide
Content
Met
Partially Met
Not Met
Comments:
Discuss current trends shaping total rewards for employees in a business industry synonymous with the organization chosen for the assignment.
Evaluate current compensation plans for that business industry.
Summarize your data in narrative and table format showing diverse levels of responsibility and compensation.
Devise a Total Rewards Strategy with recommendations for the organization.
Include in table format a list of compensation components for your plan.
Include an analysis of legislation that may impact decisions made about compensation and benefits.
Include a one page survey that you would use as a resource to collect information from employees about the rewards they desire in a reward package.
The paper is 1,225 words in length.
Total Available
Total Earned
8
#/8
Writing Guidelines
Met
Partially Met
Not Met
Comments:
The paper—including tables and graphs, headings, title page, and reference page—is consistent with APA formatting guidelines and meets course-level requirements.
Intellectual property is recognized with in-text citations and a reference page.
Paragraph and sentence transitions are present, logical, and maintain the flow throughout the paper.
Sentences are complete, clear, and concise.
Rules of grammar and usage are followed including spelling and punctuation.
Total Available
Total Earned
2
#/2
Assignment Total
#
10
#/10
Additional comments:
Wellness
submit a two- to three-page outline of your final project presentation. Think of it as a script with notes to help add context to the points you will be making. It does not need to use complete sentences or paragraphs, but it should contain enough detail to allow your instructor to offer you some feedback.
Your outline should be based on the critical elements listed below (from the Final Project Guidelines and Rubric document). Note that these are not in any particular order; they can be constructed in your presentation in any configuration.
I. Introduction: For this part of the assessment, you will examine the role of wellness in society and how it influences aspects of culture and the individual. This is on general 6 dimensions of wellness
A. Analyze how social practices have shaped our idea of wellness and how that idea of wellness has shaped social practices.
B. Utilizing interdisciplinary approaches, explain how a topic discussed in this course has or has not shaped o ...
GE 3000 – Introduction Section (Research Problem Statement)Int.docxshericehewat
GE 3000 – Introduction Section (Research Problem Statement)
Introduction: Formulating a Research Problem is the first and most important step of the research process. While the main portion of your work for this semester is focused on the Literature Review, the introduction to the research paper - The Research Problem Statement – is an important step in setting up the research problem to be investigated.
The Research Problem Statement comes before the Literature Review and acts as an introduction in a full-length research paper. The Research Problem Statement should be about 250-350 words in length, or about a page to a page-and-a-half when double-spaced. You must cite a minimum of two references (two scholarly sources) in proper MLA or APA format.
The main questions a Research Problem answers are:
· What will be researched? Identify a specific problem, program, or phenomenon
· Who will be researched? Who is the study population (people)?
Questions you should ask yourself when composing the Research Problem:
(Note that these questions are not necessarily going to be explicitly answered question-by-question in the Research Problem Statement. Rather, these are things that you should be thinking about and able to answer for yourself before you begin constructing the document).
· Who is the study population? How can you further refine the study population?
· What exactly do you want to understand about the topic/problem?
· Is the Research Problem too broad?
· How relevant is the research to your study area/discipline/major/interests?
· What motivates you to do the research on the chosen topic/problem?
· Why should others be interested in your chosen topic/problem?
· What are the concepts and issues to be studied?
· What concepts and measurements have to be further defined before the study begins?
· Do you have enough time to complete the research?
· Is an answer to the Research Problem obvious?
Constructing a Research Problem
A Research Problem typically consists of three parts: 1) the ideal, 2) the reality, and 3) the consequences.
1. Part A- the ideal: Describes a desired goal or ideal situation; explains how things should be.
2. Part B - the reality: Describes a condition that prevents the goal, state, or value in Part A from being achieved or realized at this time; explains how the current situation falls short of the goal or ideal.
3. Part C - the consequences: Identifies the way you propose to improve the current situation and move it closer to the goal or ideal.
Steps to Writing a Research Problem:
Step 1 (statement 1): Construct statement 1 by describing a goal or desired state of a given situation, phenomenon etc. This will build the ideal situation (what should be, what is expected, desired). How should things be in your topic? What is the ideal scenario?
Step 2 (statement 2): Describe a condition that prevents the goal, state, or value discussed in step 1 from being achieved or realized at the present time. This will build ...
BOS 3701, Industrial Ergonomics 1
Course Description
Review of the principles and practices of ergonomics as it applies to the industrial environment. Demonstrates how to
collect data on users and operators and how to convert the data to good workplace design.
Course Textbook
Bush, P. M. (2012). Ergonomics: Foundational principles, applications, and technologies. Boca Raton, FL: CRC Press.
Course Learning Outcomes
Upon completion of this course, students should be able to:
1. Specify and design ergonomically appropriate industrial workstations for the industrial and office work
environment.
2. Identify information-centered human factors relating to visual, illumination, controls, displays, and symbols.
3. Compare, contrast, and assess human body-centered ergonomic designs for posture, material handling,
repetitive motion factors, heat stress, noise, and vibration.
4. Examine and evaluate organizational or management-centered ergonomic factors for training, skills, and cognitive
task analysis.
5. Define the ergonomic factors intrinsic in evaluating accidents, human errors, and safety related incidents.
6. Illustrate and assess the ergonomic factors in computer work station design.
7. Discuss and identify key components of cost-benefit analysis in human factors and ergonomic design.
8. Summarize key components in conducting a human factors or ergonomics related investigation.
Credits
Upon completion of this course, the students will earn three (3) hours of college credit.
Course Structure
1. Unit Learning Outcomes: Each unit contains Learning Outcomes that specify the measurable skills and
knowledge students should gain upon completion of the unit..
2. Unit Lesson: Each unit contains a Unit Lesson, which discusses lesson material.
3. Reading Assignments: Each unit contains Reading Assignments from one or more chapters from the textbook
or a publication from the NIOSH. Suggested Readings are provided in the unit study guides to aid students in
their course of study.
4. Learning Activities (Non-Graded): These non-graded Learning Activities are provided to aid students in their
course of study.
5. Key Terms: Key Terms are intended to guide students in their course of study. Students should pay particular
attention to Key Terms as they represent important concepts within the unit material and reading.
6. Discussion Boards: Discussion Boards are a part of all CSU term courses. Information and specifications
regarding these assignments are provided in the Academic Policies listed in the Course Menu bar.
7. Unit Assessments: This course contains six Unit Assessments, one to be completed at the end of Units I-III and
V-VII. Assessments are composed of multiple-choice questions and written response questions.
8. Unit Assignments: Students are required to submit for grading Unit Assignments in Units IV and VIII. Specific
information and instructions regarding these assignmen ...
MGT 410Homework Set 1Provide a short answer to each of the fDioneWang844
MGT 410
Homework Set 1
Provide a short answer to each of the following questions.
1. Explain the difference between internal and external customers.
2. What might be some of the dangers of relying solely on customer input when designing or improving a product or service? What other inputs should be taken into account?
3. Compare and contrast Deming’s, Juran’s, and Crosby’s philosophies about quality.
4. What is the difference between quality control and quality assurance?
5. Discuss the differences between a dimension and a metric. How are they related? How do they differ?
6. Why is it important to assign weights to dimensions? What do the weights indicate?
7. How does a weighted dimension score differ from a raw dimension score?
8. What is the difference between the validity and reliability of a survey questionnaire?
9. How might an affinity diagram assist in content analysis?
10. Would “excellent product quality” be a strength for your firm if it was equivalent to the quality of competing products in the same market? Why or why not?
Exhibit 6.B: Elements of a Formally Structured Needs Assessment
Elements
Examples
Decide to conduct needs assessment
Make a conscious decision to complete a needs assessment with a commitment from key decision makers.
The Division of Continuing Medical Education, as part of the requirements for three major grant proposals, conducts a systematic statewide needs assessment of primary care physicians in a variety of settings.
Identify people and develop plan for needs assessment
Identify individuals to be involved in planning and overseeing the needs assessment, and develop a plan.
A steering committee of seven people is appointed, composed of two members of the Continuing Medical Education (CME) staff, two primary care physicians, a medical school faculty member, the assistant dean of the medical school, and an outside consultant. One of the CME staff is appointed as the project manager. The majority of the committee meetings are held online.
Determine context, purpose, and major questions
Determine important contextual factors, and develop purpose and major questions for the needs assessment.
The political and economic climate of the state, current trends in health care, and changes in the delivery of medicine constitute important contextual factors. The purpose for the needs assessment is to fulfill grant requirements for the proposals CME staff are preparing. With this context and purpose in mind the steering committee focuses the needs assessment on the following questions: (1) what are the major issues, needs, problems, and opportunities primary care physicians face in their practice?; and (2) in three years, how might these identified areas change, based on future forecasts and trends?
Determine logistics
Layout the target dates, time lines, budget, and staff.
The steering committee determines that it has to complete the needs assessment in six months. Two members of the CME staff ...
School of Community and Environmental HealthMPH Program .docxWilheminaRossi174
School of Community and Environmental Health
MPH Program
Epidemiology: MPH 746
(
Second
Assignment
)
(
Type in you name here as
First Name , Last Name
)
Read the Paper below and answer the following questions. Your answer should be typed in below; and the submitted document should be in Microsoft Word document. The answer for any question should not exceed one paragraph (5-6 lines). The deadline for submission is 11:59 pm EST Nov. 9th, 2022.
(
Ellison LF, Morrison HI:
Low serum cholesterol concentration and risk of suicide
.
Epidemiology
2001,
12
(2):168-172.
)
Question1 (Max. 0.5 point)
What is the purpose of the study?
Question2 (Max. 0.5 point)
What is the study design? What is the exposure? What is the outcome?
Question3 (Max. 2 points)
How the exposure was measured? How the outcome was measured?
Question4 (Max. 1.5 points)
From Table II, calculate the Crude Rate Ratio for serum total cholesterol <4.27 mmol/l compared to >5.77 mmol/l. (must show the details of calculation)
Question5 (Max. 1.5 points)
What is the meaning of this crude Rate Ratio?
Question6 (Max. 1.5 points)
In Table 3, what is the meaning of age and sex adjusted RR of serum total cholesterol <4.27 mmol/l compared to serum total cholesterol >5.77 mmol/l. Was there confounding by age and sex, why or why not? Is the RR statistically significant? What is the meaning of the 95%CI for the RR?
Question7 (Max. 0.5 points)
Was the ascertainment of the outcome as complete as possible? Was there a follow chart?
Question8 (Max. 0.5 points)
The authors stated in the discussion “The possibility of under-ascertainment of suicide deaths is always a concern, although it is probably unlikely that ascertainment varied by serum total cholesterol level”
Explain what the authors meant by their statement.
Question9 (Max. 0.5 points)
Were those who measured the outcome blinded from the exposure status?
Question10 (Max. 0.5 points)
Have the exposures been well measured, or is there any random or systematic misclassification?
Question11 (Max. 5 points)
Do the “exposed” differ from the “unexposed” with respect to other factors? Have these differences taken into account in the design or analysis? i.e. How the authors dealt with confounding?
1
image1.png
Students will synthesize the information they have gathered during the course to formulate a presentation advocating for a practice change in relation to an area of interest to NP practice.
Creating a Professional PowerPoint PresentationDownload Creating a Professional PowerPoint Presentation
In a PowerPoint Presentation, address the following.
1.
Title Slide
2.
Introduction (1 slide): Slide should identify concepts to be addressed and sections of the presentation. Include speaker’s notes that explain, in more detail, what will be covered.
.
BOS 3401, Construction Safety 1 Course Description .docxhartrobert670
BOS 3401, Construction Safety 1
Course Description
Exploration of the OSHA regulations and related safety practices governing the construction industry. Provides an
analysis of the high incident/accident rates in the construction industry and how it contributed to the passage of the OSH
Act in 1970. Presents practical examples of how to apply “on the job” construction safety and health programs and
policies.
Prerequisites
None
Course Textbook
Goetsch, D. L. (2010). Construction safety and the OSHA standards. Upper Saddle River, NJ: Prentice Hall.
Course Learning Objectives
Upon completion of this course, students should be able to:
1. Examine and explain the theories and concepts of construction safety and health.
2. Discuss, evaluate, and interpret OSHA's construction standards and related safety practices.
3. Describe how to apply construction safety and health programs and policies while on the job.
4. Identify and discuss safety and health issues and practices in the workplace.
5. Explain how to estimate the costs of work accidents and rates.
6. Describe contractors and safety and health teams.
7. Discuss ethics and safety, including how ethics is an important part in the construction safety profession.
8. Explain the Workers' Compensation Program.
9. Discuss hazard analysis and risk assessment.
10. Define and discuss stress, workplace violence, and conflict resolution.
11. Explain the emergency response system and its importance to the construction safety professional.
12. Discuss ISO 14000 and its importance to the construction professional.
Credits
Upon completion of this course, the students will earn three (3) hours of college credit.
Course Structure
1. Unit Learning Objectives: Each unit contains Unit Learning Objectives that specify the measurable skills
and knowledge students should gain upon completion of the unit.
2. Written Lectures: Each unit contains a Written Lecture, which discusses lesson material.
3. Reading Assignments: Each unit contains Reading Assignments from one or more chapters from the
textbook. Supplemental Readings are provided in Units III and V to aid students in their course of study.
4. Learning Activities (Non-Graded): These non-graded Learning Activities are provided in Unit VI to aid
students in their course of study.
5. Key Terms: Key Terms are intended to guide students in their course of study. Students should pay
particular attention to Key Terms as they represent important concepts within the unit material and reading.
BOS 3401, Construction Safety
Course Syllabus
BOS 3401, Construction Safety 2
6. Discussion Boards: Discussion Boards are a part of all CSU term courses. Information and specifications
regarding these assignments are provided in the Academic Policies listed in the Course Menu bar.
7. Unit Assessments: This course contains eight Unit Assessments, one to be completed at the end of each ...
Critical Thinking MOD 82 PGS TOTALStart by reading and follo.docxmydrynan
Critical Thinking
MOD 8
2 PGS TOTAL
Start by reading and following these instructions:
1. Quickly skim the questions or assignment below and the assignment rubric to help you focus.
2. Read the required chapter(s) of the textbook and any additional recommended resources. Some answers may require you to do additional research on the Internet or in other reference sources. Choose your sources carefully.
3. Consider the discussion and the any insights you gained from it.
4. Create your Assignment submission and be sure to cite your sources, use APA style as required, check your spelling.
Assignment:
1. What is the difference between Physical Causal Explanations and Behavioral Casual Explanations, and how do they tie into critical thinking?
2. Name the types of explanations and how they are evaluated. Use examples from your life to support your answer.
3. What is an Inference to the Best Explanation and how does it relate to forming a hypothesis?
4. What are the definitions of aesthetic value and judgment? Use examples from your life to support your definition.
INTRODUCTION TO ETHICS
MOD 8
Start by reading and following these instructions:
1. Quickly skim the questions or assignment below and the assignment rubric to help you focus.
2. Read the required chapter(s) of the textbook and any additional recommended resources. Some answers may require you to do additional research on the Internet or in other reference sources. Choose your sources carefully.
3. Consider the discussion and the any insights you gained from it.
4. Create your Assignment submission and be sure to cite your sources, use APA style as required, check your spelling.
Assignment:
Write an essay addressing each of the following points/questions. Separate your paper into sections outlined below. Each section in your paper needs a clear heading that allows your professor to know which bullet you are addressing in that section of your paper Review the rubric criteria for this assignment.
Your final assignment is to pull together all the information within the modules 1 – 8 to complete the final submission of your topic of choice from module 1. This assignment must be thorough and completely cover the aspects outlined in module 1.
When finalizing your final assignment, please:
· Introduce the topic you chose with its definition/background,
· Explain your opinion, for or against the topic, when you started your research and analysis,
· Discuss 2-3 reasons “from scholars” in favor and against the topic
· In summary format, review your findings and provide an answer if you are for or against the issue (your opinion) and why, based on the facts your scholarly research.
Assignment Expectations
Length: 2000 – 2250 words for this assignment
Structure: Include a title page and reference page in APA style. These do not count towards the minimum word requirement for this assignment.
References: Use the appropriate APA style in-text citations and references for all resources utilized to a.
Liberty UniversitySMGT 699 INTERNSHIPPORTFOLIO GUIDELINES.docxjesssueann
Liberty University
SMGT 699 INTERNSHIP
PORTFOLIO GUIDELINES
The following outline is intended to provide you with the guidelines for your internship. Although the focus of each student is primarily oriented to accomplishing the tasks and responsibilities assigned by each host organization, the following guidelines represent the writing and reporting requirements, which need to be submitted in the final week of the semester in order to receive a final grade for the experience.
The specific due date will be provided in Blackboard. Students are required to create a portfolio (word documents and/or excel spreadsheet). This submission will satisfy the “culminating experience” requirement by Liberty University in order to successfully complete graduate school.
INTERNSHIP FINAL REPORT:
This Report/Portfolio will be due during the final week of your internship and includes the following requirements for acceptance.
A. Length and Format: This report shall be as long or short as necessary to communicate the required information, Times or Times New Roman font size 12 pt. should be used. Feel free to include charts and supporting material that may be provided in an attached appendix.
B. Place and Date of Submission: ONLY an electronic copy of the final report should be submitted via Blackboard. Faxed reports will not be accepted. Do not mail a paper report.
C. Optional Revisions of Final Report: A student has the option of submitting the Final Report to the professor no later than Week 12. If an internship report is deemed unsatisfactory for any reason, it will be returned to the respective intern for revisions and modifications. Presentation and factualness of data, spelling, and grammar will be reviewed carefully and may result in required revisions. This report should be treated as a business report which will be evaluated and will be available for community review by faculty, staff, and students. If no revisions are necessary, the report will be accepted as final.
STRUCTURE OF FINAL INTERNSHIP REPORT
An internship final report should be structured to include the following sections and subsections.
I. THE ORGANIZATION:
A. Overview of Host Organization: Briefly describe the type of organization in which you worked and where/how it fits into the sport industry (e.g., local, regional, national, or international). Please include its primary constituencies and the primary nature of its operations (i.e., goods or services). Briefly describe the major purposes of the organization including its mission, goals, and strategic objectives. Please include any relevant promotional brochures and any other pertinent information that describes the work of the host organization. The data might include any strategic documents such as an annual report and/or strategic management plans.
B. Structure and Personnel of Host Organization: Briefly describe the organizational structure and its effectiveness with regard to management philosophies, leadersh.
Similar to 1 RISK MANAGEMENT (BAP 352) INDIVIDUAL ASSIGNMENT (20)
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
How to Add Chatter in the odoo 17 ERP ModuleCeline George
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
The simplified electron and muon model, Oscillating Spacetime: The Foundation...RitikBhardwaj56
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
1. 1
RISK MANAGEMENT (BAP 352)
INDIVIDUAL ASSIGNMENT | GUIDANCE PAPER
Trimester 2 2021
_____________________________________________________
_____________
Section 1.0 Assessment Information
Length: 1500 words (± 10% excluding bibliography)
Weighting: 20%
Assessment due: Friday Week 11
Style and format: Submissions will be in the form of an essay
and suggested
guideline:
1. Introduction
• General statement to introduce reader to the topic, which sets
the context for the topic in a broad way
2. • Outline of the main points that will be researched / analysed /
presented in your essay
2. Analysis
• What are your key findings
• Are there any impacts or implications
• One main point or key idea per paragraph
3. Recommendations
• Summarise your key recommendations, if any.
4. Conclusion
• Summarises the main points or arguments
• Restates the major point of view (your answer to the question)
• Includes no new information
• Should not need references
Note:
• At least one citation / reference for each key point/s
3. • List references clearly
2
Assessment Submission: Assignments to be submitted to
“Turnitin”, a tool which will check
for plagiarism. Any similarity over 35% will not be accepted.
Assessment Return: Marks will be released at the beginning of
Week 12.
Section 2.0 Other Important Information
2.1 Plagiarism
Taking another person’s ideas, words or inventions and
presenting them as your own without
acknowledging your sources (citing or referencing), is
plagiarism. Paraphrasing or rewording
another person’s work, without acknowledging its source, is
also plagiarism. If you are
identified with plagiarism assessment mark will be zero and will
be reported to the
4. Academic Integrity Committee.
2.2 Referencing
Correct referencing is important for two main reasons. The first
is to enable the reader to
access source material you have relied upon, should they care
to. The other is to ensure that
you have properly recognized the contribution of the work of
others to your assignment. If you
do not do this properly, you are engaging in plagiarism—the
theft, intentional or otherwise, of
the intellectual or creative work of others.
UBBS will not tolerate plagiarism. It is therefore important that
you understand how to avoid it. It
is important that you adopt a consistent, and adequate,
referencing system.
Essay Topic:
(a) Select a publicly listed company in Australia and write a
brief on the company and its
products and services.
5. (b) Examine the company’s risk management strategy (i.e.
policies) and the risk appetite.
(c) What risk areas is the company focused on and why?
Note: It is important for students to read and understand the
company’s risk management
strategy and relate it to the company’s industry, products or
services.
1
7
Student
Name____________________________________________
COLLEGE OF EDUCATION, HUMANITIES, and
BEHAVIORAL SCIENCES
Alabama A&M University
Normal, AL 35762
COURSE SYLLABUS
Summer 2021
Course Number
PED 511
Course Title
Science and Medicine in Sport
Call Number/Section
Class Days/Time
6. Monday – Thursday 0730 - 0850
Class Location
On-line / Virtual on ZOOM
Prerequisites
Admittance into Graduate School; or, by special permission
from the professor,
Department Chair, appropriate Dean(s), and/or VP of Academic
Affairs/Provost
Textbook(s)
American Psychological Association. (2020). Publication
Manual of the American Psychological Association (7th ed.).
Washington, DC: American Psychological Association.
Professor
Dr. Terry Conkle
Office
29-U Elmore Gym (On NE corner/side of balcony)
Office Hours
By Appointment During Summer Term
E-mail address
[email protected]
Telephone number
256 – 372 – 5303
AAMU Quality Enhancement Plan (QEP):
“Enhancing Students’ Critical Thinking Skills”
Critical Thinking Definition: Critical thinking is analyzing,
evaluating, and synthesizing information into logical
conclusions.
COURSE DESCRIPTION
Science and Medicine in Sport – 3 Hours. This course is
designed for students who expect to pursue careers as certified
athletic trainers, sport coaches, fitness professionals, physical
therapists, physical educators, or any other area of exercise and
sport science. This course will cover the (professional -based
7. and scholarly-based) body of knowledge that can help them
effectively perform the responsibilities of their job, regarding
many aspects of sport medicine and sport science - concerning
both recreational and competitive athletes.
STUDENT LEARNING OUTCOMES
As a result of this course students will be able to:
01] Define the terms Sport Science and Sport Medicine.
02] Identify key sport medicine and sport science
organizations.
03] Identify key members of a sport medicine team and discuss
their varied roles as part of that team.
04] Explain the importance of good nutrition in enhancing
human performance and preventing injuries.
05] Describe the advantages and disadvantages of dietary
supplementation in an athlete's diet.
06] Discuss common eating and drinking practices of the
athlete population.
07] List the signs of disordered eating.
08] Identify types of protective equipment available for various
body parts, in multiple sports
(from ankle braces to sport shoe selection, etc.).
09] Describe the potential dangers of adverse environmental
conditions in sport.
10] Discuss the concept of Cold-Water Immersion or Pre-
Cooling as contemporary sport science practices.
11] Discuss how athletes might respond psychologically to
injury (including the “Athlete Identity,” “Athlete Career
Termination
and Life Transition,” etc.).
12] Identify stressors in an athlete's life.
13] Discuss how the sport medicine team can serve as a support
mechanism for helping injured athletes psychologically.
14] Explain what bloodborne pathogens are and how they can
infect those involved in sport (e.g., Athletes, ATCs, Coaches,
8. etc.).
15] Describe the transmission, signs and symptoms, and
treatment for each type of Hepatitis.
16] List the pros and cons of sport participation by athletes
diagnosed with Hepatitis or HIV.
17] Discuss how therapeutic modalities can be used in a
rehabilitation program following sport injuries.
18] Identify the short-term and long-term goals of an injury
rehabilitation program.
19] Discuss the various general medical conditions and
additional health concerns associated with sport participation
(e.g., skin infections, respiratory illness,
gastrointestinal conditions, diabetes, hypertension, anemias,
grand mal seizures, viral diseases, menstrual-related
issues, STDs, etc.).
20] Discuss issues associated with preventing and managing
injuries in young athletes.
21] Differentiate between acute and chronic injury.
22] Describe various acute traumatic injuries (e.g., fractures,
dislocations, subluxations, contusions, ligament sprains,
muscle strains, muscle soreness, nerve injuries,
etc.).
23] Discuss chronic overuse injuries and differentiate between
tendinitis, tendinosis, bursitis, osteoarthritis, and
key myofascial trigger points.
24] Discuss the 3 phases of the healing process.
25] Demonstrate an ability to cite and reference experts in the
broad areas of science and medicine as part of sport
discussions, as opposed to personal opinions.
26] Demonstrate an ability to analyze and critique published
research in the broad areas of science and medicine i n sport.
CLASS FORMAT
01] There is no textbook for this course, therefore it is
imperative that students attend all scheduled synchronous on-
line class-meetings. Because there is no textbook, the
9. professor's background, experience, and knowledge
(supplemented by Blackboard-posted handouts and PowerPoint
material) will be the basis of course content. All posted
materials and content from class discussions are subject to
appear on exams (including the Comprehensive Exam that most
Kinesiology students take before they graduate. ALL
MATERIAL IS VITAL or class time and readings would not be
devoted to it. This is not easy subject-matter, so students are
invited to ask questions for clarification purposes or better
understanding of a topic. Reading and research outside of class
may be required, to supplement class discussions. Additionally,
there may be outside-of-class assignments requiring word-
processing, proof-reading, revision, and repeated proof-
reading/revision for submitting superior work.
02] Assignments are due promptly at the university-appointed
class start time, unless otherwise explicitly stated by Dr.
Conkle. Late assignments receive a 30% per-class-day grade
reduction from the earned grade. On-line/Blackboard-submitted
assignments should be submitted as Portable Document Format
(PDF) items – there will be an automatic cut-off pre-set on
Blackboard after which assignments will be considered “late.”
If at such time assignments are accepted in-person (as hard-
copy), they should be stapled in the upper left corner (when
possible) or (if too thick) placed in an appropriate 3-clasp or 3-
ring binder for submission at the specified time BEFORE
ENTERING THE ELMORE GYM/BUILDING. The previous
policy does not apply if an unusual circumstance has been
“cleared” already by Dr. Conkle.
03] Written work must be computer-generated, and should
demonstrate evidence of proofreading, revision, and neatness
(i.e., professionalism). Unless otherwise EXPLICITLY
SPECIFIED or DIRECTED, adhere to these guidelines – any
assignment not meeting 1 or more of these guidelines may result
in a student receiving a grade of ZERO or
10. NO CREDIT:
Students should consult the most recent APA Publication
Manual, for assistance in most Kinesiology courses –
A] Typed using size 12, Times New Roman font (ALL TEXT
from first letter through last in a document should
adhere, unless otherwise explicitly specified by the
professor)
B] Double-spaced (when writing on paper that means write on
every-other-line)
C] Computer-generated materials should be printed on 1 side of
the page, with 1-inch margins on all 4 edges,
and NEVER “justify” text
D] All pages numbered in upper right corner - Insert as a
“Header” (see word-processor tool-bar)
E] Student’s name and final 4 digits of Student Number at end
of assignment or on cover page – depending on the
nature of the assignment and directions from the professor
F] Staple multiple pages together in the upper left-hand corner
or secure within a binder.
Students MUST NOT use a “plastic strip folder” to submit
work, when submitted as hard-copy.
04] Unless otherwise approved/specified, E-MAILED
assignments are INAPPROPRIATE and
will NOT be ACCEPTED for credit.
05] Make-up test arrangements must be scheduled BEFORE a
college-sponsored class absence on test-day. “Other” excused
absences (that can be authoritatively
documented/supported) will be scheduled after the fact, per
agreed-upon time/date
between the student and Dr. Conkle. Students who are
absent for the same event, should all make-up the exam
together!!
11. 06] ACADEMIC INTEGRITY - It is expected that students
attending this institution will be scrupulously honest.
Dishonesty,
such as cheating, or plagiarism (published/typed/written
use of a concept, expression, idea, or thought without giving
documented credit to the original source), or
fabricating/furnishing false information, including forgery,
alteration or
misuse of University documents, records, or identification,
will be regarded as a serious offense subject to severe penalty,
including but not limited to, loss of credit and possible
dismissal from the institution. See the University Policies for
specific information regarding penalties associated with
dishonest and/or unethical behavior. Unless otherwise indicated
by Dr. Conkle that a task is a “group” assignment, all
student work must be completed individually. Plagiarism is
presenting the concepts, ideas, work, or words of another
as one’s own. This includes purchasing papers, downloading a
paper from the Internet or having someone else prepare a
paper. Plagiarism and cheating (the latter is also a matter of
“Academic Integrity”) will be dealt with according to
university policies – or at the very least a significantly low
grade
will result).
07] ON EXAM/TEST DAYS, unless EXPLICITLY SPECIFIED
electronic devices (including cell phones and high-technology
watches capable of storing digital information for the
course) must not be present or checked by students during
exams/
tests (this constitutes a violation of “Academic Integrity.”
Any student observed trying to view “devices” in a lap, pocket,
or on a desk/table surface (powered-on or not) or
manipulating/viewing any electronic device once an exam is
being/has
12. been distributed the guilty student will receive a grade of
zero on that exam/test. It is the student's responsibility to have
ALL ELECTRONIC DEVICES powered-off and completely
hidden from sight during exams/tests!! It may be best to
leave “questionable electronic devices” (such as the high-
tech’ watch) with the professor during the test, to prevent
suspicions of cheating.
08] ON EXAM/TEST DAYS, when meeting for brick-and-
mortar class sessions, students will not be permitted to enter the
classroom later than 05 minutes after the official start of
class time!! Students should arrive promptly and punctually for
class, but most especially on test day(s)!!
09] ON EXAM/TEST DAYS, when meeting for brick-and-
mortar class sessions, no student will be permitted to leave the
room unless they submit their test materials and electronic
devices to the professor. It is the student's responsibility to use
the restroom before entering the classroom, and to have
tissues paper, etc. for runny noses, etc. Once a student exits the
door, their test-taking time ends!!
10] ON EXAM/TEST DAYS, head-dresses/head-wear should be
removed once the classroom is entered. Failure to remove
head-wear can result in a student being dismissed from
class and receiving a grade of ZERO on the exam. This policy
pertains to hats, caps, sun-visors, bandanas, scarves,
kerchiefs, skull caps, head-wraps, turbans, or other attire
intended
as head apparel.
11] Chit-chat / Idle / Private conversations should occur before
and after class, not during – class time is for class discussion
and “public consumption.” If something is vital enough to
discuss with a neighbor, it is important enough to interact with
the professor and all classmates regarding the issue /
13. problem / topic. Students perceived as disrupting a class -
session, will
be directed to exit class and can be counted absent for that
class-meeting.
12] Active participation is expected (thus required) and part of
high-quality education.
That also means using polite and respectful language.
13] Any clarification or problem regarding an assignment, a
peer, or the professor should be communicated to Dr. Conkle
at the earliest possible time.
14] Students should be IN THE CLASSROOM (On-line or
brick-and-mortar) BEFORE Dr. Conkle begins class and
remain until dismissed.
15] It is a student's responsibility to seek clarification(s) and
follow directions for all course tasks. If a student fails to do so,
they accept that their course grade will potentially and
accordingly suffer.
16] A few philosophical truisms that will help students
understand their professor and his approach to the collegiate
educational
process (The following paragraph is a note from your course
professor) –
Welcome to this course. It should be a mutually beneficial
learning experience for us. We should form a partnership so
you can maximize your learning experience (I expect each
student to actively – not passively - participate in the
educational process). I expect you to increase your overall
knowledge of the allied professions that fall under traditional
14. HPERD (in contemporary terms, often known as Kinesiology or
Human Performance), and develop a comprehensive sense of
professionalism. It has been my experience that students get
from a course exactly as much or as little effort/time as they
invest in it. Given the nature of this course, there will likely be
topics or concepts that are new to you, some with which you
disagree based upon a limited background or experience - some
may be totally alien to you. However, the purpose of
professional education is to push students into areas of study
they had no idea existed.You should take advantage of this
opportunity, and apply your new-found knowledge, to broaden
your horizons and develop yourself professionally.
Tough love is in effect here:
I will not accept you as you are. Instead, I will show you a
vision of what you could be, and helpyou achieve it !!
– Dr. Terry Conkle
"We teach more than what is in a book." – Dr. Chris Washam
(Kinesiology Department Chair, Mississippi College)
"Motivation is simple; you eliminate those who are not
motivated." – Football Coach, Lou Holtz
"Perfection is not attainable; but, if we chase perfection we can
catch excellence" – Football Coach, Vince Lombardi
"Nobody got anywhere in the world by simply being content." –
Author, Louis L'Amour
COURSE OUTCOMES
This course will address the following broad topics and help
students:
01] enhance their knowledge of science and medicine
underpinning optimal performance in sport and exercise.
02] develop an understanding of current theory, research, and
debates in sport science and provide the opportunity to study
several chosen areas of interest.
15. 03] develop professional skills, including: communication
(verbal and written), critical analysis and thinking, citing and
referencing experts' concepts, expressions, ideas, or
thoughts by giving documented credit to the original source.
SERVICES FOR PERSONS WITH DISABILITIES
The University provides environmental and programmatic
access for persons with documented disabilities as defined in
Section 504 of the Rehabilitation Act of 1973 and the
Americans with Disability Act of 1990. Any student who
desires information or assistance in arranging needed services
for a disabling condition should contact the Director of Special
Students Services, Student Center, Room 203, (256) 372-4263.
ATTENDANCE POLICY
Alabama A&M Policy: Graduate students are expected to attend
every class-meeting, given the condensed schedule and rigor of
the graduate-level program of study!!
Dr. Conkle will keep accurate attendance records. The
attendance policy *IS* communicated here (in writing) and will
be discussed in class on Day 1 of each academic term.
Student Excuses:
01] Class attendance is expected, as well as a privilege, and
students are required to be punctual and prepared. Any student
NOT PRESENT when attendance is checked will be counted as
absent – a “Tardy” does not exist in this course!! A student is
either “Present” or “Not Present.”
02] Learning experiences proceed at such a rapid pace that
attendance is necessary if students are to acquire the
knowledge, and develop competence, skills and strategies that
students need to be successful in their endeavors.
03] Students are required to carry out all assigned work and to
16. take examinations and quizzes at the class period designated.
04] Failure to take examinations and quizzes and carry out
assignments at the designated times may result in an appropriate
reduction in the final grade, except as provided in item 6 below.
05] Arrangements for make-up work, due to excused absences,
must be initiated by the student.
06] Excused absences can be obtained upon presenting
documentation to Special Student Services for the following
reasons indicated below:
A] Personal Illness or Illness of a Family Member:
Documentation bearing the signature of doctors, dormitory
counselors,
infirmary and/or hospital officials, athletic trainers, etc.
shall constitute proof.
B] Death in the Family: Funeral programs, newspaper
obituaries, statements from funeral directors shall constitute
proof.
C] Subpoena for Court Appearances: The student’s copy of the
document shall constitute proof.
D] Emergencies or Circumstances over which the Student has
no Immediate Control: Appropriate corroboration,
documentation and/or explanation shall constitute proof.
E] Trips and/or activities by members of student organizations
sponsored by academic units, and activities officially
authorized: Authorized excuses, dispatched from the
appropriate offices, instructors, coaches or sponsors over
signature of
the Department Chairperson and Dean or Director, shall
constitute proof.
Dr. Conkle's Policy for Excused Absences – An ORIGINAL
OFFICIAL EXCUSE must be submitted directly to the professor
(PERSONALLY – NOT placed in a mailbox, placed under an
17. Office Door, or given to a secretary) within SEVEN (7)
calendar days following each excused absence (or the final day
of an extended excused absence time-period). Dr. Conkle will
retain Official Excuses for his records. It is a student's
responsibility to obtain multiple original copies of the excuse if
others must see it, or if the student wants a personal copy. Use
the space below to document all absences, note which were
authoritatively excused per AAMU Policy with excuses
submitted promptly to Dr Conkle, DO NOT ASK Dr. Conkle to
recap your absence dates:
Absences: ______ ______ ______ ______ ______ ______
______ ______ ______ ______ ______ ______
TUTORIAL ASSISTANCE
Tutorial assistance for undergraduate courses can be obtained
from the Tutorial Assistance Network (TAN), a subsidiary of
the Office of Academic Support Services. TAN is located in
Room 100C Buchanan Hall. The telephone number is 256-372-
5487.
Dr. Conkle may schedule tutoring sessions when students
indicate a need for them.
GRADE DETERMINATION
Course Requirements
Percent of Total
Points Possible
Points Earned
BONUS ASSGNMENT
BONUS
50 BONUS
_____
09 Assignments
18. Research Critique Assign 01
Research Critique Assign 02
Research Critique Assign 03
Research Critique Assign 04
Research Critique Assign 05
Research Critique Assign 06
Research Critique Assign 07
Research Critique Assign 08
Research Critique Assign 09
81%
810
90
90
90
90
90
90
90
90
90
_____
_____
_____
_____
_____
_____
_____
_____
_____
Exam 1
19%
190
19. _____
Final Course Grade
100 %
1000
Total Points
A
B
C
D
F
90% – 100%
80% – 89.9%
70% – 79.9%
60% – 69.9%
00% – 59.9%
900 – 1000
800 – 899.9
700 – 799.9
600 – 699.9
000 – 599.9
__/1000
INCOMPLETE GRADES
“I” grades are solely intended as interim course evaluation
ratings. They are used when students perform satisfactorily
(defined as a “C average” or better), have completed at least
75% of the course requirements, and there is an excusable
reason for not having completed all requirements prior to grade
20. reporting time. Students may obtain credit for courses in which
their grades are “incomplete” only by completing their course
work satisfactorily within one year of the date an “I” is
awarded, or the end of the next term that course is offered. If
this is not done, the “I” grade automatically results in failure
(“F”).
DESCRIPTION OF COURSE GRADING SYSTEM
A “Subtraction” from 1000 to calculate grades at semester's-
end. Note that, in the end, all 3 methods show the same exact
grade. If/When mid-term grades are reported, the “Average”
method will be used – this indicates to a student that if they
continue performing similarly, that is close to what their grade
will be in the end. It is a student's responsibility to strive for
excellence. Aim for excellence, and fall short, then grades
could be good. Shoot for mediocrity and fall short, then grades
could be bad. Using the “Subtraction” method, a student
ALWAYS knows their grade for the course (using simple math),
and the highest grade they can possibly earn in the course - and
easily determine what they must do to maintain it. A student
can start at Zero and simply add points from there if they wish
but it is more positive and informative to begin at 1000 and
deduct what is not earned.
DESCRIPTION OF SPECIFIC ASSIGNMENTS
Course Tasks
Brief Description
Student Information Form
Students will submit an information form, for BONUS CREDIT.
This form includes contact information that is standard for Dr.
Conkle’s courses.
Research Critiques (RCs)
21. Students will use / follow APA format & style to computer-
generate and:
Complete ONE (1) critique of a RESEARCH article, on an
approved sport
science/sport medicine topic. Lit’ Reviews,Abstracts,
Commentaries, Editorials, and
Position Papers / Consensus Statements are INAPPROPRIATE
for these assignments –
they must be from “published” Original Research
Reports/Articles!
These assignments/papers should be submitted as WORD or
PDF Documents via Blackboard along with the PDF research
report/article on which the assignment is based. Although
students will have seen the rubric that is used to grade the
assignments, do NOT submit one.
Exam 1
Students will complete a written exam (essay/Comprehensive
Exam format or style) that covers ALL course material through
the exam date.
BLACKBOARD INFORMATION AND MATERIAL
Course materials, content, and announcements (including exam
grades, under announcements using the final 4 digits of
students’ A#s) will be posted on Blackboard at the earliest
possible time. When “CONTENT” is posted, it is advisable to
“save” it to a flash-drive and/or print the material. It is vital to
print or have immediate access to the course syllabus for class,
to note key announced alterations. Assignments, Handouts,
PowerPoint Slides will NOT remain posted “indefinitely!” All
material will “roll-off” Blackboard (after an appropriate time-
period there) at some point and not saving/printing them may
result in not having key items when needed at the figurative or
22. literal “last minute” for reference or studying. Also, situations
may arise when the Internet is “down” or a technological snafu
that prevent(s) access to the site. IN THIS COURSE, since
there is no textbook, IT IS VITAL TO PRINT EVERY
HANDOUT AND HAVE FOR DAILY REFERENCE.
FINAL EXAMS – WARNING
Given several instances of students arriving late for “brick-and-
mortar” exams in general, and final exams specifically (NOTE
that there is a 5-minute grace-period for arrival to any exam/test
for Dr. Conkle's courses). Final exams are scheduled for a
specific time-period, that should be understood; BUT, that does
not imply that students can arrive at their leisure or at any given
point of their choosing during an exam to complete it!!!!!
The 5-minute grace-period is in effect for all “brick-and-
mortar” exams with Dr. Conkle!
23. COURSE OUTLINE
Dates
Topics for the Week
Tasks Due
06/01 (T)
Course/Professor Introduction – Assignment 1 Info ***(0730)
06/02 (W)
Exam Study Tips, Critiquing Articles, & Sport Nutrition
06/03 (R)
Sport Nutrition
Information Form due on Blackboard by NOON
06/07 (M)
Sport Nutrition
06/08 (T)
Protective Sport Equipment
Assign 01 (Sport Nutrition) due by NOON
06/09 (W)
Protective Sport Equipment
06/10 (R)
Environmental Conditions & Sport
06/14 (M)
Environmental Conditions
06/15 (T)
Environmental Conditions
Assign 02 (Protective Equipment) due by NOON
06/16 (W)
Blood-borne Pathogens / Wound Care
24. 06/17 (R)
Blood-borne Pathogens / Wound Care
06/21 (M)
Blood-borne Pathogens / Wound Care
Assign 03 (Environmental Conditions) due by NOON
06/22 (T)
Psychology of Injured Athletes ***(0730)
06/23 (W)
Psychology of Injured Athletes ***(0730)
06/24 (R)
General Medical Conditions & Health Concerns
Assign 04 (Pathogens/Wound Care) due NOON
06/28 (M)
General Medical Conditions & Health Concerns
06/29 (T)
General Medical Conditions & Health Concerns
06/30 (W)
Injury Rehabilitation
Assign 05 (Psychology of Injuries) due by NOON
07/01 (R)
TBA
07/05 (M)
TBA
07/06 (T)
Injury Rehabilitation
Assign 06 (Gen. Medical/Health Conditions) due by NOON
07/07 (W)
Injury Rehabilitation
25. 07/08 (R)
Cultural Trends & Injuries of Young Athletes
07/12 (M)
Cultural Trends & Injuries of Young Athletes
Assign 07 (Injury Rehab’) due by NOON
07/13 (T)
Cultural Trends & Injuries of Young Athletes
07/14 (W)
Management of Specific Sport Injuries & Conditions
Assign 08 (Young Athletes’ Injuries) due by NOON
07/15 (R)
Management of Specific Sport Injuries & Conditions
07/19 (M)
Review
Assign 09 (Specific Injuries/Conditions) due NOON
07/20 (T)
Review
07/21 (W)
Review
07/22 (R)
Exam 1 – (Comprehensive Exam Format) ***(0730)
ALL Course Content to date, including posted handouts
NOTES
% = given that ZOOM often bumps students off-line after 45
minutes, class will generally meet from 0800-0845,
except when noted otherwise.
$ = Grades and feedback for each assignment will be provided
26. at the earliest possible time.
# = Students must utilize excellent time-management skills to
ensure assignments are submitted promptly.
COVID-19 HYFLEX and VIRTUAL ON-LINE Courses
Experience has shown that students’ grades correlate closely to
the amount of serious effort/time they invest in a course. Given
the nature of this course, your background and your experience,
there could be material that is new to you. However, that is the
purpose of professional education – to push students outside
their comfort zones into unfamiliar content. I hope you seize
this opportunity and broaden your horizons as you develop
professionally. Although Dr. Conkle reviews the syllabus on
Day 1 of class, it is presumed that students will READ each
word of it and know that it is designed to enhance learning.
Please re-read and note any points that seem unclear initially.
Your signature indicates that Dr. Conkle will presume you have
read the syllabus fully. If there are questions regarding the
syllabus, it is the student's responsibility to ask.
Students are expected to understand that -
1] It is their responsibility to await Dr. Conkle’s arrival in a
virtual class-meeting for 15 minutes after class is scheduled to
begin (the same for
brick-and-mortar class) – if the professor does not arrive in
a class session within that time-frame no absence will be
counted. And, each
student should know it is their responsibility to regularly
check Blackboard for “Announcements,” and e-mail, for each
course. Students are
expected to be “in class” and ready for class when it begins
each day.
27. 2] Using a laptop/desktop/tablet for class sessions,
assignments, tests, and virtual class-meetings is advisable
(rather than a cell-phone).
3] Assignments are due (at/before/by/on) via BLACKBOARD
as announced and explicitly stated by Dr. Conkle. Late
assignments receive a
30% per-class-meeting grade reduction from an “earned”
grade. This policy applies unless an unusual circumstance is
cleared by
Dr. Conkle.
4] Assignments must be computer-generated (and saved as PDF
or WORD depending on what is specified – NEVER as a
GOOGLE DOC), and
should demonstrate evidence of proofreading, revision,
neatness, and professionalism. Unless otherwise specified,
adhere to these guidelines:
When applicable, students should consult the most recent APA
Publication Manual for assistance –
A] Typed using size 12, Times New Roman font
B] Double-spaced (when writing on paper that means write on
every-other-line)
C] Use 1-inch margins on all 4 edges, and DO NOT “justify”
text
D] Insert all pages numbered in upper right corner
E] Student’s name and final 4 digits of “A-Number” at end of
assignment or on cover page – whichever is specified or most
appropriate
F] Save all documents on your computer as follows – Last
Name-First Name-Course Number-Due Date
5] ALL assignments/computer-generated work should be
submitted as digital/electronic documents via BLACKBOARD
28. by the specified time and
due-date! Assignments and exams must be submitted as
WORD or PDF, per instructions for each task. Based on
experience since March 2020,
each student must understand their upload/download speed
limitations and adjust submissions accordingly. For example, if
an assignment is due
at 1200 noon and the general upload time for a given
student is 2 HOURS, the upload should begin well BEFORE
1000. If the upload time is
typically 5 MINUTES for a given student, the upload should
begin BEFORE 1155.
6] Make-up test arrangements must be scheduled BEFORE a
college-sponsored class absence that will occur on test-day.
“Other” excused absences
(that can be authoritatively documented/supported) will be
evaluated on a case-by-case basis, and make-up exams
scheduled as appropriate, per
agreed-upon time/date between the student and Dr. Conkle.
7] It is their responsibility to seek clarification(s) and follow
directions for all assignments. If failing to do so, they accept
that their
course grade may suffer.
8] It is their responsibility to attend ALL class meetings, and
that they may be REQUIRED to activate their camera so they
are seen in class,
and that they are expected to un-mute and verbally participate
in classes. They must further understand that having a “job” in
conflict with class time does not serve as an “excused” absence
and they are not owed a “make-up exam” or “extra time” on
assignments when missing classes for this reason (or other
reasons such as a: vacation, wedding, friend’s baby being born,
etc.). If a class is missed it is the student’s responsibility to
29. obtain an Official AAMU University Excuse and submit it to
Dr. Conkle BEFORE they can get credit for an assignment that
was due, or to take an exam that was administered. They must
also understand that assignments will not be accepted by e-mail,
they must be sent through the Blackboard Submission Portal for
the course.
9] It is in their best interest to enter class BEFORE the
scheduled class-time (not start attempting to log-in at the
assigned class-time (which wastes
valuable minutes), because class should begin promptly.
They should re-enter class each time as soon as possible if
“bumped-out.”
10] It is in their best interest to actively participate in class
regardless of the platform used (e.g., ZOOM, face-to-face, etc.).
11] It is their responsibility to use their “Bulldog” e-mail
account, as opposed to yahoo, gmail, etc.
12] AGAIN - Save all documents on your computer and submit
as follows (failure to do so may result in a Grade of ZERO!) –
Last Name - First Name - Course Number - Due Date (and then
other wording Dr. Conkle specifies), something like this,
for example (note that the dates are by month day and year):
Bunyon-Paul-PED511-05-13-21Article01PDF
Bunyon-Paul-PED511-05-22-21Article02PDF
Bunyon-Paul-PED511-05-31-21Article03PDF
Bunyon-Paul-PED511-05-13-21Assign01WORD
Bunyon-Paul-PED511-05-22-21Assign02WORD
Bunyon-Paul-PED511-05-31-21Assign03WORD
30. PED 511 Research Critique (RC) Grading Rubric (2021) – 80
Points Possible per Critique
Student’s Name: Topic: 1 2 3 4 5 6 7 8 9
Date Due: _____ / _____ / ____
90 Points 100%
08 – 09
of 9 criteria met
77 Points ~ 85%
06 – 07
of 9 “A” criteria met
63 Points ~ 70%
04 – 05
of 9 “A” criteria met
50 Points ~ 55%
< 03
of 9 “A” criteria met
00 Points 00%
31. Appropriate Article Selected –
Original Research and
On Assigned Topic
Assignment must be TNR,
Size 12, Double-spaced,
1-inch Margins
Dr. Conkle's standard directions ARE FOLLOWED
COMPLETELY
Pay Attention to Details!
XXXXX
XXXXX
XXXXX
Article NOT Scholarly / Scientific
Article was NOT on assigned topic
Article was NOT submitted to
Blackboard by deadline
(stated on syllabus)
Article was NOT PDF,
was NOT TNR,
was NOT Size 12,
was NOT Double-spaced,
did NOT have 1-inch Margins
32. The article can NOT be HTML
Correct APA Reference –
ZERO errors
Reference has 1 error
Reference has 2 errors
Reference has > 3 errors
XXXXX
Title – At least 6 of the questions addressed / discussed clearly
5 of the questions addressed clearly
4 of the questions addressed clearly
< 3 of the questions addressed clearly
XXXXX
Abstract – All relevant questions addressed, if an abstract was
part of article
XXXXX
XXXXX
Not discussed, or insufficient discussion
– if one was part of article
XXXXX
Introduction - All 7 components addressed / discussed clearly
5 - 6 of the questions addressed clearly
3 - 4 of the questions addressed clearly
< 2 of the questions addressed clearly
XXXXX
Methodology - Substantial
discussion of S – I – P & Data
XXXXX
33. XXXXX
Discussion seems insufficient, regarding what could be
discussed
XXXXX
Results - All 5 questions
addressed / discussed clearly
4 of the questions addressed clearly
3 of the questions addressed clearly
< 2 of the questions addressed clearly
XXXXX
Discussion - At least 10 questions addressed / discussed clearly
8 – 9 of the questions addressed clearly
6 – 7 of the questions addressed clearly
< 5 of the questions addressed clearly
XXXXX
Personal Reflection / Summary
At Least 5 Paragraphs -
Overall Evaluation / Rating of Report's Quality is Provided,
What was Learned,
How Info Read can be Used,
How it Changed Student's Views, Etc.
XXXXX
XXXXX
Evaluation or rating is not given; or,
34. Less than a 5-paragraph discussion
XXXXX
Conventions of Professional
Graduate-Level Writing - Excellent spelling, grammar,
punctuation, sentence structure, smooth flow, good transitions –
writing makes sense
< 5 errors noted
XXXXX
> 6 errors noted
XXXXX
Final Grade =
LATE = minus 30 Points
/ 90
Assignment will receive a 30% off the final earned grade if not
submitted through Blackboard by due date/time (according to
digital time-stamp).
*The assignment must be submitted through Blackboard (as a
MS Word or PDF Doc), and the article must be submitted as a
PDF!
35. KIN 799 Research Critique Assignment #13 2
Conkle, M. T., & Shannon, D. (2020). Correlates of winning
interscholastic “Gridiron Football”
championships. ASAHPERD Journal, 40(1), 9-20.
TITLE
The title of this work seemingly summarized the article’s main
idea simply and in an informative way. Based on the title it is
somewhat difficult to know all variables concerning this study.
However, the word “correlates” implied there are at least two
significant independent variables tested and found in the study,
and the dependent variable is obviously winning an
interscholastic “American” football championship. The sample
in this research report was mentioned. It was non-human and
non-animal since it is football championship games. No
geographic location was specified, but it was a region of the
world where “American Football” competitions occur (and
champions determined) at the high school level. Since this
research did not involve school curricula, no subject matter was
addressed in the title; but, from a physical activity perspective,
football might be considered the focus area. Waste-words were
not found at the beginning on the title. From this research
report’s title, it is difficult to determine what the most
important word or phrase should have been, all seem vital given
how short the title was. The title was seven words long, so it
complies with the 3rd through 7th editions of the APA
Publication Manual (that have fluctua ted relative to title length
guidelines).
ABSTRACT
There was no Abstract for this work. (07 words)
INTRODUCTION
The authors set the context for their study by citing several
36. works from the previous literature. It appears that sources
ranged from 1931 through the second decade of the 21st
Century, providing some reasonably thorough historical
background. There were two previous studies mentioned that
related directly to high school football, Barker (1964) and
Brown (2008), which were not only the most recent pertinent
studies - presumably those were the only studies linked to
interscholastic football. Citations for interscholastic football
were both research reports, but there were also sources in the
Introduction that included studies at higher levels of football as
well as “opinion,” “philosophical,” and “theoretical” works.
Justification for the study was given, and a scarcity of studies
regarding interscholastic football was noted. Based on the
literature review in the Introduction, Conkle and Shannon
replicated the Barker (1964) study, testing “in-game statistics”
or variables (on a much larger scale, when looking ahead in the
report). Four objectives were stated. Based on the study’s
purposes, there are indications that it was a mixed-methods
quantitative study (it dealt heavily in game statistics), since it
mentioned correlations (association), sought to determine the
most significant variables, and compared winning and losing
teams (difference) in championship games. Data were testable
given how the problems were phrased.
METHODOLOGY (Subjects, Sample, or Participants)
This study was unique in that it did not involve human or
animal subjects, it concerned sport events. The sample included
championship football games (N = 280). ALL championship
football games (a type of “census” study) governed by the
Alabama High School Athletic Association (AHSAA) were
analyzed, except four that ended in ties and had co-champions
crowned - which nullified that data. Both public and parochial
schools participating in the games were included. To this point
no subdividing or assigning games to groups was evident.
Games in the sample were treated as one large group, comparing
winners to losers, as noted earlier, and no special treatments or
37. manipulations. Finally, the study was approved by an
Institutional Review Board at the institution where Conkle was
employed at the time. (131 words)
METHODOLOGY (Instrumentation)
Data were collected from public-domain records found on the
Internet from the AHSAA, a “historical web-site,” and box
scores, game summaries, and newspaper articles reviewed in
key libraries that housed major newspaper archives. Data were
“cross-checked” for accuracy and reliability of information.
Given that data were verified from multiple sources, the authors
apparently did everything humanly possible to ensure data
accuracy.
METHODOLOGY (Procedures)
There is no strict description of the procedures they followed
other than what is stated in the previous section. The authors
could have addressed the timeline and procedures followed, in
better detail. How long it took to gather all data from start to
finish could be useful information for anyone wanting to
conduct a similar study, so they would be more aware of time
and effort involved. It may have been over-kill, but it would be
informative if they mentioned whether notebooks, pens/pencils,
photocopies, a computer, etc. were used (but it could be helpful
for readers learning about research methods) in data collection.
RESULTS and DISCUSSION
Findings relative to the previous literature were discussed, so
the Results and Discussion sections are combined here, as they
were in the published research report. For this reason, the
authors did a good job discussing their results relative to
previous studies and the existing, related, literature. The
specific data analysis program used was reported in the article –
SPSS Version 23. Descriptive statistics were computed (i.e.,
frequencies, percentages, ranges, means, and standard
38. deviations) and discussed, as well as presented in tabular form.
Those tables displayed somewhat massive but clear information.
Reading so many numbers in text format would have been
difficult. Data analyses and tables indicated this was a mixed
methods study - with correlations, descriptive summaries,
MANOVA and ANOVA. Statistical tests used by the
researchers seem appropriate for their purposes. Who
performed the data analyses is not addressed. All data were
reliable and valid, based on how they were reported. All tables
are clear and understandable, including the one at the end being
logical and insightful. Outcomes are summarized well in-text
and are comprehendible. Altogether, the text and tables balance
one another and are beneficial. The researchers’ conclusions
state clear answers to the research problems in the introduction.
They also urged other researchers to investigate this issue in
their locales. In other words, others are encouraged to refine
the methods used in this study or to modify the research design
to study similar problems or questions. Restricted suggestions
made for good study replication.
REACTION / REFLECTION (5-paragraphs)
Conkle and Shannon’s research report covers most things that
readers need to know, and other researchers should find, in a
well-organized study and article. There were some things
missing that may have improved the article’s quality. A few
more re-readings will be necessary to decide. Overall, the work
was excellent (even if I did not understand everything about the
statistics). It opened my eyes wider to the sport of football and
helped me understand how many possible statistics or variables
that can influence which team wins or loses a game – in this
case, championship competitions. Until now I never realized
that sport statistics can be variables and utilized from a research
perspective. I always thought game statistics were simply to
help coaches know who plays well and who has not, as well as
to establish individual and team records.
As a former high school football player, it was always obvious
39. that the final score matters most in any sport or game. Points
scored in a certain half or a given quarter maybe affecting the
outcome more than other times in a game was a surprising
factor in this study. That was enlightening. It was interesting
to see the possible connections and differences among variables
concerning “Margin of Victory” and what correlated to
“Winning” football games. It is also clearer what possibly had
a negative influence and what had a positive influence back in
my high school (and now) in games.
As a volunteer coach at James Madison High School, I will
discuss this article and its results with the school’s full -time
coaches. There is a lot from the report that should be
considered and discussing it with seasoned football coaches
could serve as professional development for me and the entire
coaching staff. With 17 football coaches at James Madison, and
three volunteer coaches, there could be many viewpoints to
ponder. That many perspectives could help me (and them)refine
my beliefs. It could also help the veteran coaches become more
successful coaches (and the football program improve overall)
in the future.
As a hopeful (future) head coach, I will emphasize the “running
game” over the “passing game,” when the talent is available to
do that (based on what I saw in this article). Maybe there will
be follow-up research studies reported by Conkle and Shannon
that shed more light on this issue. It would also be interesting
to read research conducted in other states or regions of the
United States, as well as from other nations where “American
Football” is played. Most specifically, findings being very
different or quite similar could benefit me greatly. In the right
circumstances, what I learn could motivate or stimulate me to
move outside my comfort-zone as a coach, and use new
strategies and tactics to win games, that I would have never
contemplated before.
In summary, this was an article that I rate highly. It was a new
or unfamiliar line of research to me. Given a lack of published
40. studies regarding which variables or statistics help teams win
high school football games most, it seems reasonable that it is a
new line of research for many readers. It has become obvious
that research is conducted in countless areas of interest. Some
researched issues or problems are obvious because they are
often in the news. Many people may never consider other topics
as something that could be (or are) studied by researchers –
until they read research studies on new or obscure topics.
February 31, 2050
Terry Conkle
A# 6285
The article this paper matches is posted too. Note how
everything is 3rd-person throughout the paper until the end, and
at that point 1st-person is minimal and there is no “you” or
“your” anywhere in the paper (those words are preachy and/or
accusatory – not to mention they get redundant very quickly).
Many student papers get too wordy within sentences, and every
attempt was made here to maintain brevity and conciseness yet
still provide good flow and transition. This sample assignment
is ~1550 words (student assignments may be much longer or
shorter depending on each article critiqued). DO NOT
PLAGIARIZE by copying this and simply typing in a few
choice words that pertain to each specific assignment. All
articles are very different and require good discussion of the
topic and the given article’s content. Read the “Writing Tips”
that have been posted, they will eliminate possible errors that
are commonly noted in graded papers.
PED 511 Research Critique Outline / Template (Label ALL
Parts)
Title
Abstract