mge_a4_study_q4.pdfORIGINAL RESEARCHpublished 12 Octobe.docx

mge_a4_study_q4.pdf
ORIGINAL RESEARCH
published: 12 October 2015
doi: 10.3389/fmicb.2015.01063
Edited by:
Miklos Fuzi,
Semmelweis University, Hungary
Reviewed by:
Atte Von Wright,
University of Eastern Finland, Finland
Dmitri Debabov,
NovaBay Pharmaceuticals, USA
*Correspondence:
Anne-Brit Kolstø,
Laboratory for Microbial Dynamics,
Department of Pharmaceutical
Biosciences, School of Pharmacy,
University of Oslo, Postbox 1068
Blindern, 0316 Oslo, Norway
[email protected]
†Present address:

Roger Simm,
Norwegian Veterinary Institute, Oslo,
Norway;
Massoud Saidijam,
Research Centre for Molecular
Medicine, Department of Molecular
Medicine and Genetics, School
of Medicine, Hamadan University
of Medical Sciences, Hamadan, Iran
Specialty section:
This article was submitted to
Antimicrobials, Resistance
and Chemotherapy,
a section of the journal
Frontiers in Microbiology
Received: 17 August 2015
Accepted: 15 September 2015
Published: 12 October 2015
Citation:
Kroeger JK, Hassan K, Vörös A,
Simm R, Saidijam M, Bettaney KE,
Bechthold A, Paulsen IT,
Henderson PJF and Kolstø A-B
(2015) Bacillus cereus efflux protein

BC3310 – a multidrug transporter
of the unknown major facilitator family,
UMF-2. Front. Microbiol. 6:1063.
doi: 10.3389/fmicb.2015.01063
Bacillus cereus efflux protein
BC3310 – a multidrug transporter of
the unknown major facilitator family,
UMF-2
Jasmin K. Kroeger1,2, Karl Hassan3, Aniko Vörös1, Roger
Simm1†, Massoud Saidijam4†,
Kim E. Bettaney4, Andreas Bechthold2, Ian T. Paulsen3, Peter
J. F. Henderson4 and
Anne-Brit Kolstø1*
1 Laboratory for Microbial Dynamics, Department of
Pharmaceutical Biosciences, School of Pharmacy, University of
Oslo,
Oslo, Norway, 2 Institut für Pharmazeutische Biologie und
Biotechnologie, Albert-Ludwigs Universität, Freiburg,
Germany,
3 Department of Chemistry and Biomolecular Sciences,
Macquarie University, Sydney, NSW, Australia, 4 School of
BioMedical Sciences and Astbury Centre for Structural
Molecular Biology, University of Leeds, Leeds, UK
Phylogenetic classification divides the major facilitator
superfamily (MFS) into 82 families,
including 25 families that are comprised of transporters with no
characterized functions.
This study describes functional data for BC3310 from Bacillus
cereus ATCC 14579, a
member of the “unknown major facilitator family-2” (UMF-2).
BC3310 was shown to

be a multidrug efflux pump conferring resistance to ethidium
bromide, SDS and silver
nitrate when heterologously expressed in Escherichia coli DH5α
�acrAB. A conserved
aspartate residue (D105) in putative transmembrane helix 4 was
identified, which was
essential for the energy dependent ethidium bromide efflux by
BC3310. Transport
proteins of the MFS comprise specific sequence motifs.
Sequence analysis of UMF-
2 proteins revealed that they carry a variant of the MFS motif
A, which may be used
as a marker to distinguish easily between this family and other
MFS proteins. Genes
orthologous to bc3310 are highly conserved within the B. cereus
group of organisms
and thus belong to the core genome, suggesting an important
conserved functional role
in the normal physiology of these bacteria.
Keywords: MFS, drug resistance, efflux protein, Bacillus
cereus, UMF-2
Introduction
Bacillus cereus sensu stricto (B. cereus) is a Gram-positive,
endospore forming organism known to
cause foodborne illness in humans. It is a member of the B.
cereus group of bacteria (Bacillus cereus
sensu lato) that, in addition to B. cereus encompasses the
species B. anthracis, B. thuringiensis,
B. mycoides, B. pseudomycoides, B. weihenstephanensis, and
B. cytotoxicus (Kolsto et al., 2009;
Guinebretiere et al., 2013). The B. cereus group members are
genetically closely related with
high level of syntheny (conserved gene order). The high

similarity results in an intertwinement
of the B. cereus, B. thuringiensis, and B. weihenstephanensis
branches in the phylogenetic tree
(Ash et al., 1991). However, the B. cereus group organisms
exhibit different phenotypes, inhabit
diverse ecological niches and are pathogenic against different
hosts. The three species B. mycoides,
B. pseudomycoides, and B. weihenstephanansis are regarded as
non-pathogenic. B. anthracis is the
causative agent of anthrax in humans and animals (Mock and
Fouet, 2001). B. thuringiensis is
Frontiers in Microbiology | www.frontiersin.org 1 October 2015
| Volume 6 | Article 1063
http://www.frontiersin.org/Microbiology/
http://www.frontiersin.org/Microbiology/editorialboard
http://www.frontiersin.org/Microbiology/editorialboard
http://dx.doi.org/10.3389/fmicb.2015.01063
http://creativecommons.org/licenses/by/4.0/
http://dx.doi.org/10.3389/fmicb.2015.01063
http://crossmark.crossref.org/dialog/?doi=10.3389/fmicb.2015.0
1063&domain=pdf&date_stamp=2015-10-12
http://journal.frontiersin.org/article/10.3389/fmicb.2015.01063/
abstract
http://loop.frontiersin.org/people/273869/overview
http://www.frontiersin.org/
http://www.frontiersin.org/Microbiology/archive

Kroeger et al. Bacillus cereus efflux protein BC3310
an insect pathogen that is commercially used as a biopesticide
(Melo et al., 2014). B. cytotoxicus causes enteritis in humans
and is thermotolerant and highly cytotoxic (Guinebretiere et al.,
2013). In the natural environment B. cereus is found as a
saprophyte in soil, associated with the rizosphere of plants and
in the gut of invertebrates (Jensen et al., 2003; Berg et al.,
2005).
Even though B. cereus is most frequently associated with food-
borne enteric infections in humans, it is able to cause other
local or systemic infections such as endophthalmitis, cutaneous
infections, endocarditis, central nervous system infection, or
bacteremia (Steen et al., 1992; Callegan et al., 1999; Centers
for Disease Control and Prevention, 2005; Callegan et al.,
2006; Martinez et al., 2007; Kim et al., 2010; Sasahara et al.,
2011; Stevens et al., 2012). Clinically serious infections of
B. cereus are treated with antibiotics such as carbapenems,
clindamycin, ciprofloxacin, and vancomycin (Kervick et al.,
1990; Bottone, 2010; Uchino et al., 2012; Matsuda et al., 2014).
However, resistance against carbapenem and clindamycin has
been reported, which eventually led to failed treatments
including
cases with fatal outcomes (Kervick et al., 1990; Kiyomizu et al.,
2008; Savini et al., 2009; Uchino et al., 2012).
According to the transportdb database, the B. cereus group
strains constitute between 390 and 455 transporters per strain
(Ren et al., 2007; Ren and Paulsen, 2007). The unusually high
number of transporters per B. cereus group strain may reflect
the different lifestyles of these bacteria. Importantly, each
group
member contains approximately 100 transporters, predicted to
efflux drugs.
Drug efflux systems are part of the resistance machinery to

counteract antibiotics (Sun et al., 2014). They are divided into
six different transporter superfamilies: (i) MFS (major
facilitator
superfamily); (ii) ABC (ATP binding cassette) transporter
superfamily; (iii) MATE (multidrug and toxic compound
extrusion) family; (iv) RND (resistance nodulation division)
family; (v) DMT (drug/metabolite transporter) superfamily,
and (vi) PACE (proteobacterial antimicrobial compound efflux)
(Poole, 2007; Hassan et al., 2015). Of these, MFS pumps
constitute the majority of efflux transporters encoded in B.
cereus
group strains, typically more than 50 per strain. The MFS
comprises secondary transporters that use the electrochemical
gradient of protons or sodium ions across the cell membrane
to energize substrate transport, including drug efflux (Pao et al.,
1998; Saier et al., 1999; Reddy et al., 2012). The ‘transporter
classification system’ (see http://www.tcdb.org/) classifies the
MFS into 82 families. With respect to drug efflux pumps, the
drug:H+ antiporter families (DHA)1 to 3 are the largest and
best investigated drug exporter families in the MFS (Saier et al.,
2014).
In this study, we characterize the phylogenetic and some
functional properties of the putative multidrug transporter
BC3310 from B. cereus ATCC 14579. BC3310 was classified by
in silico analysis as a member of the major facilitator
superfamily
and the phylogenetic relationship within this group was
determined. A deletion mutant of bc3310 was constructed and
overexpression of BC3310 allowed for functional
characterization
in a heterogenous host as well as purification and partial
biochemical characterization in vitro.
Materials and Methods

Bioinformatics Analyses
Bacterial sequence information was collected using the IMG
homepage from the Joint Genome Institute (Markowitz et al.,
2012). Sequence alignments were performed using MEGA
MUSCLE alignment with default settings (Tamura et al., 2013)
and the phylogenetic tree was constructed using MrBayes
(Ronquist et al., 2012). Prediction of the transmembrane helices
was done by submitting the primary protein sequence of
BC3310 (UniProt Q81B77) to HMMTOP (Tusnady and Simon,
2001).
Construction of B. cereus bc3310 Deletion
Mutant
A markerless mutant of bc3310 was constructed as described
(Simm et al., 2012) in the B. cereus ATCC 14579 wild type
according to the method of Janes and Stibitz (2006) and using
the primers listed in Table 1. The B. cereus plasmid pBClin15
was lost during the process of making the markerless mutant
and therefore a plasmid cured strain was used for phenotypic
comparison as in previous investigations (Voros et al., 2013).
The presence of the deletion was confirmed by sequencing.
B. cereus was grown in LB medium at 30◦C, unless otherwise
stated.
Escherichia coli BC3310 Expression
Constructs
The expression levels of genes cloned into pTTQ18-based
plasmids are inducible by isopropyl β-D-thiogalactopyranoside
(IPTG). Furthermore, the genes are fused with a sequence
coding for a C-terminal (His)6 tag for identification and
TABLE 1 | Primers used in this study.
Primer for Sequence (5′→3′)
Overexpression in pTTQ18

pTTQ18-bc3310F
CATGGATCCATGCGTTTTACTTTTTGGATTATGG
pTTQ18-bc3310R CCGCCTGCAGCGGTTGTTTTGTCATGCCC
D105 mutants
bc3310_D105N_f
GATTTCTAGTTGGAGTTGGAAATCATATGCTTCATGTC
GGAAC
bc3310_D105N_r
GTTCCGACATGAAGCATATGATTTCCAACTCCAACTAG
AAATC
bc3310_D105A_f
GATTTCTAGTTGGAGTTGGAGCTCATATGCTTCATGTC
GGAAC
bc3310_D105A_r
GTTCCGACATGAAGCATATGAGCTCCAACTCCAACTAG
AAATC
bc3310_D105E_f
GATTTCTAGTTGGAGTTGGAGAACATATGCTTCATGTC
GGAAC
bc3310_D105E_r
GTTCCGACATGAAGCATATGTTCTCCAACTCCAACTAG
AAATC
Deletion mutant
dbc3310_5′ _f CGCGGATCCATGAACAAACTATATTAC
dbc3310_5′ _r CAATTTCCCTTCCCAAAAAGTAAAACGCAT

dbc3310_3′ _f
GTTTTACTTTTTGGGAAGGGAAATTGAAGTAA
dbc3310_3′ _r ACGCGTCGACTAGTTTGATATACCTGTTC
http://www.tcdb.org/
purification of the expressed protein. The plasmid construct
pTTQ18-bc3310 (pbc3310) was made by general molecular
biology techniques according to Sambrook and Russell (2001)
by amplifying the gene bc3310 from genomic DNA of B. cereus
ATCC 14579 using the primers listed in Table 1. The
plasmids for expressing BC3310 D105 mutants pbc3310D105A,
pbc3310D105N, and pbc3310D105E were made using sequence
and ligation-independent cloning (Li and Elledge, 2007). The
presence of each mutation was confirmed by sequencing. The
E. coli strain DH5α �acrAB (Simm et al., 2012) carrying
pTTQ18 empty vector or the overexpression plasmids was
made for minimal inhibition concentration (MIC) testing. For
protein purification the E. coli strain BL21 was transformed
with
pbc3310.
Escherichia coli strains harboring plasmids were grown in 50
or 250 ml LBmedium with ampicillin (100 μg ml−1) at 37◦C and
180 rpm in 250 ml or 1 l baffled flasks or on LB agar plates at
37◦C, unless otherwise stated.

MIC Tests
Overnight cultures of B. cereus ATCC 14579 (without pBClin)
and B. cereus �3310 or E. coli DH5α �acrAB (Simm et al.,
2012) with relevant plasmid were inoculated 1:100 and grown
to an OD600 between 0.8 and 1.0 at 37◦C and 180 rpm.
These pre-cultures were diluted to a final OD600 of 0.02.
The test was performed at least three times in duplicate
in microtiter plates and antibiotics were added in a 2-fold
serial dilution. For susceptibility assay using E. coli strains
100 μg ml−1 ampicillin and 0.01 mM IPTG were added to
all cultures. The cultures were incubated at 37◦C for 20–24 h
and visually inspected for growth. The lowest concentration,
at which no growth was observed, was determined as the
MIC.
Ethidium Bromide Accumulation Assay
Escherichia coli strains DH5α �acrABwith the plasmids
pTTQ18
and pbc3310 were grown on LB agar plates supplemented with
100 μg ml−1 ampicillin and 0.01 mM IPTG at 37◦C over
night. Cells were collected with a loop and resuspended
in PBS supplemented with 0.4% glucose (pH 7-7.4) to an
OD600 of 1.000 (±0.005). These cells were applied on a
microtiter plate and, where appropriate, carbonyl cyanide
m-chlorophenylhydrazone (CCCP) was added to achieve
an end concentration of 200 μM. Thereafter, ethidium
bromide was added to an end concentration of 25 μM and
the fluorescence change was measured over 60 min in a
Safire spectrophotometer (Tecan, Crailsheim, Germany) with
excitation and emission wavelength of 518 and 605 nm,
respectively. Duplicate measurements were recorded on at least
two cultures.
Heterologous Expression of BC3310 and Its
Mutants with (His)6-tag and Western Blot
Overnight cultures of E. coli DH5α �acrAB carrying pbc3310,

the empty vector (pTTQ18) or plasmids encoding the bc3310
mutants (pbc3310D105A, pbc3310D105N, or pbc3310D105E)
were transferred to fresh LB (amp) medium and grown to
an OD680 between 0.4 and 0.6. Expression was induced with
0.75 mM IPTG and the cultures were grown for another
3 h. For quantification of expression, Western blot assays
were performed. One milliliter of the overexpression cultures
was harvested by centrifugation at 15000 g, 4◦C for 5 min.
The pellet was washed (20 mM Tris-HCl pH 7.6, 100 mM
NaCl, 5% glycerol, 1 mM phenylmethanesulfonylfluoride
(PMSF)) and resuspended depending on cell mass in ice-
cold lysis buffer (50 mM Tris-HCl pH 7.6, 100 mM NaCl,
5% glycerol, 5 mM β-mercaptoethanol, 1 mM PMSF, 1 μg
ml−1 DNase). Cells were lysed by continuous sonication for
25 min in a cold water bath. SDS-PAGE and Western blots
were performed as described in Sambrook and Russell (2001).
(His)6-tag detection was done using a mouse anti-(His)6
antibody (Qiagen, Hilden, Germany) and a horse anti-mouse
horseradish peroxidase-labeled secondary antibody (New
England Biolabs. ECL advanced chemiluminescence detection
reagent (Amersham Pharmacia Biotech, Pittsburgh, PA, USA)
was used and chemiluminescence was measured by using the
Analyzer Universal hood (Bio Rad, München) and the Quantity
one 4.6.6 Software. Quantification was performed by pixel
counting of five biological replicates on five different Western
blots.
Purification of the BC3310 Protein by Affinity
Chromatography
For protein expression and purification, the method described
by
Ward et al. (2000) was used. In short, E. coli strain BL21
pbc3310
was grown in 2TYmedium (1.6% tryptone, 1% yeast extract,
0.5%

sodium chloride, pH 7) and expression was induced at an
OD680
between 0.4 and 0.6 with 0.75 mM IPTG. The culture was
grown
for another 3 h and cells were harvested. For inner membrane
preparation, E. coli cells were resuspended in 20 mM Tris-HCl
(pH 8.0), 0.5 mMEDTA and kept frozen at –80◦C. After
thawing,
cells were disrupted with a Continuous Flow Disruptor
(Constant
Systems, UK) and inner membranes isolated by sucrose gradient
centrifugation. Samples were kept at –80◦C in Tris-HCl (pH
7.5)
and EDTA.
Inner membranes were solubilized in 20 mM CAPSO (pH
10.0), 300 mM sodium chloride, 20% glycerol, 1% n-dodecyl β-
D-maltoside (DDM), 20 mM imidazole (pH10.0). Immobilized
metal affinity chromatography (IMAC) was performed using
20 mM CAPSO (pH 10.0), 10% glycerol, 0.05% DDM, 20 mM
imidazole (pH 10.0) as wash buffer and 20 mM CAPSO (pH
10.0), 200mM imidazole, 5% glycerol, and 0.05%DDM as
elution
buffer.
Circular Dichroism Measurement
Purified protein was washed using a spin concentrator with
20 mM CAPSO (pH 10.0), 5% glycerol and 0.05% DDM until
imidazole-free. CD spectral analysis was performed from 270 to
195 nm in a 1 nm step resolution using a spectropolarimeter
(Jasco J-715) with constant nitrogen flushing and a scan rate of
10 nm min−1. Response time was set at 1 s with a sensitivity
of 100 mdeg and 10 nm bandwidth. The data comprised an
accumulation of 20 scans, from which the buffer contribution
was
subtracted.

FIGURE 1 | Dendrogram comparing BC3310 from Bacillus
cereus ATCC 14579 with orthologous proteins and other
multidrug transporters from the
DHA1 and DHA3 families. BC3310 from B. cereus ATCC
14579 (UniProt accession number: Q81B77; bold font) and
orthologous proteins from B. cereus ATCC
10987 (Q734U9), B. cereus ATCC 10876 (C2N377), B.
anthracis str. Ames (Q81N75), B. cereus ssp. cytotoxis
(A7GQF7), B. weihenstephanensis (A9VLS6),
B. mycoides (C3AET4), B. pseudomycoides (C3BM93),
Geobacillus sp. Y4.1MC1 (E3IFM2), Halobacillus halophilus
(I0JJA0), B. subtilis (O34929), Listeria innocua
(Q92AX8), Listeria monocytogenes (S5JWD1), Geobacillus
kaustophilus (Q5L2X3), Lysinibacillus sphaericus (B1HUQ2),
Exiguobacterium sibiricum (B1YK36),
Anoxybacillus flavithermus (B7GFW5), M. caseolyticus
(B9E839), Brevibacillus brevis (C0ZL32), Escherichia coli
(P21503), and DHA1 proteins from Lactococcus
lactis (Q48658), B. subtilis (Q797E3, O34546, P39843,
P33449), Pseudomonas aeruginosa (P32482) and DHA3 proteins
from Streptococcus pyrogenes (P95827),
B. subtilis (P39642, O31600, P42112), B. clausii (Q5WAS7),
Pseudomonas syringae (Q887F7), Clostridium perfringens
(Q46305) and the sugar transporter AraE
from B. subtilis (P96710) as an outgroup were used to build the

tree. Posterior probability values are shown at each node and
the bar represents the expected
number of amino acid substitutions per site. The seven protein
sequences marked with ∗ were aligned in Figure 5.
Results
BC3310 is Conserved in the B. cereus Group
To date, 228 strains of the B. cereus group of bacteria have
been sequenced (Markowitz et al., 2012). A BLASTP search
showed that the protein BC3310 is highly conserved within
this group. In 225 strains BC3310 orthologs with >91%
amino acid identity were identified. The predicted ortholog
from the reduced genome sized B. cereus cytotoxis NVH
391-98 displayed 88% identity. The two strains (B. anthracis
3154 and B. anthracis A2012) in which no BC3310 ortholog
was found are draft genomes which display a gap at the
relevant genomic position (data not shown). Orthologs of the
BC3310 protein are also found in other bacteria of the order
Bacillales including B. subtilis (51% amino acid identity),
Listeria
innocua (47% amino acid identity), Geobacillus kaustophilus
(47% amino acid identity), Lysinibacillus sphaericus (50%
amino
acid identity), Exiguobacterium sibiricum (39% amino acid
identity), Anoxybacillus flavithermus (49% amino acid

identity),
Macrococcus caseolyticus (42% amino acid identity),
Brevibacillus
brevis (41% amino acid identity). The phylogenetic relationship
of BC3310 to a selection of orthologs is depicted in a
dendrogram
(Figure 1). BC3310 clusters very closely with orthologous
proteins from other B. cereus group members, thus forming a
distinct cluster separate from the orthologs of other Bacillales
species.
B. cereus �bc3310 is More Susceptible to
Ethidium Bromide Compared to the Wild Type
To examine the role of BC3310 in conferring drug tolerance in
B. cereus ATCC 14579 a microbroth dilution test was conducted
comparing the B. cereus wild type to its isogenic markerless
knock-out mutant. Growth of the strains in twofold serial
dilutions of ten compounds, including antibiotics from different
classes, was tested. The susceptibility of the �bc3310 mutant
only differed from the susceptibility of the wild type strain
for one of the 10 tested compounds. B. cereus �bc3310 was
two times more susceptible to ethidium bromide compared to
the wild type (Table 2). It is possible that redundancy among
efflux transporters masks the substrate range of the BC3310
transporter or that the transporter is not expressed under the
conditions studied. Hence, a heterologous E. coli expression
system with a hypersensitive E. coli strain and IPTG-inducible
BC3310 expression was used to further investigate possible
substrates.
Expression of BC3310 Protein in E. coli
The ability of E. coli to heterologously express intact BC3310
protein was investigated. The bc3310 gene was cloned into
the expression vector pTTQ18 as described (Saidijam et al.,
2006, 2011; Szakonyi et al., 2007). BC3310 was expressed with

a
C-terminal RGSHis6 tag and detected by Western blotting
using an antibody against the RGSHis6 tag (Figure 2).
The protein was solubilized from the inner membrane
fraction with DDMand purified by affinity chromatography
(Figure 2). The major band on the Coomassie stained gel
was subjected to Edman degradation and confirmed to
contain the first eight predicted amino acids of BC3310.
Topology analysis with HMMTOP predicted 12 transmembrane
helices in the BC3310 transport protein. Circular dichroism
measurements of the purified protein resulted in a spectrum
with nodes at 210 and 222 nm (Figure 3), indicating a
prevailing α-helical structure (Wallace et al., 2003) and thus
confirming the integrity of the heterologously produced
protein.
Thereafter the substrate range of heterologously expressed
BC3310 was determined. A susceptibility assay was performed
using E. coli DH5α �acrAB in which the major multidrug efflux
TABLE 2 | Minimal inhibition concentration (MIC) of E. coli
DH5α �acrAB expressing BC3310 (pbc3310) compared to
empty vector control (pTTQ18) and
Bacillus cereus ATCC 14579 �bc3310 (�bc3310) compared to
B. cereus ATCC 14579 (wild type).
MIC [μg ml−1]
E. coli DH5α �acrAB B. cereus ATCC 14579
Compound Empty vector pbc3310 § Wild type �bc3310 §
Apramycin n.d.∗ n.d. 12.5 12.5 1
Chloramphenicol 1.25 1.25 1 3.13 3.13 1
Erythromycin 12.5 12.5 1 0.25 0.25 1

Kanamycin 2.5 2.5 1 12.5 12.5 1
Lincomycin 400 400 1 n.d. n.d.
Nalidixic acid n.d. n.d. 5 5 1
Novobiocin 1.25 1.25 1 n.d. n.d.
Phleomycin n.d. n.d. 50 50 1
Tetracycline 1.25 1.25 1 1.25 1.25 1
Ethidium bromide 3.13 12.5 4 50 25 0.5
SDS 100 400 4 100 100 1
Silver nitrate 1.3 2.7 2 0.43 0.43 1
§represents fold difference between E. coli or B. cereus strains,
experiments were conducted at least three times in duplicate.
∗ denotes not determined.
FIGURE 2 | Purification of BC3310-RGSHis6 . BC3310 was
expressed with
RGS(His)6-tag in E. coli and inner and outer membranes were

separated.
BC3310-RGSHis6 was solubilized with DDM and purified by
immobilized
metal affinity chromatography (IMAC). The SDS-PAGE was
loaded as follows
and stained with Coomassie Blue: (1) molecular weight marker;
(2) inner
membrane fraction; (3) solubilized protein; (4) unsolubilized
protein; (5)
flow-through after IMAC binding; (6) eluted protein. (7)
Western blot detection
of eluted BC3310 protein after affinity chromatography using an
antibody to
the RGSHis6 epitope.
complex was disrupted. TheMICs of different compounds for
the
strain expressing BC3310 from pTTQ18 were compared to the
MICs for the empty vector control. The E. coli strain expressing
BC3310 showed a fourfold higher MIC for ethidium bromide
and
SDS and a twofold higher MIC for silver nitrate (Table 2).
FIGURE 3 | Circular dichroism analysis of purified BC3310-
RGSHis6
protein. The analysis was performed at 1 nm intervals over 270–
190 nm with
a scan rate of 10 nm min−1. The spectrum represents an
averaged
accumulation of 20 scans, from which the buffer contribution
was subtracted.
FIGURE 4 | Uncoupler-sensitive efflux of ethidium associated
with
expression of BC3310. Accumulation of ethidium bromide after
30 min was

measured in IPTG-induced E. coli DH5α �acrAB host cells
either expressing
bc3310 (pBC3310, dark gray) or not using an empty vector
control (pTTQ18,
light gray) without (-CCCP) and with addition of CCCP (+
CCCP). Values are
means of four independent experiments and error bars indicate
standard
deviations, ∗ p < 0.01, unpaired Student’s t-test.
Ethidium Bromide Efflux of BC3310 is
Disrupted by CCCP
Major facilitator superfamily efflux proteins are secondary
active
transporters that utilize the electrochemical gradient across the
cell membrane to extrude compounds. The BC3310 protein
sequence displays motifs characteristic of an MFS transporter
(see below) and so the ability of BC3310 to confer resistance
to ethidium bromide by means of drug efflux was investigated
further. A whole cell ethidium bromide accumulation assay
with the E. coli DH5α �acrAB strain expressing BC3310
was performed. Ethidium bromide fluoresces upon binding to
double-stranded DNA, and the fluorescence intensity correlates
with the accumulation of ethidium bromide. The E. coli
strain expressing bc3310 (pbc3310) showed less fluorescence
compared to the empty vector control (pTTQ18), thereby
implying that BC3310 exports ethidium bromide (Figure 4).
Addition of the protonophore CCCP led to an increase
in fluorescence intensity in the strain expressing bc3310 to
approximately the control level (pTTQ18) (Figure 4, dark gray
bars). This increase indicates the inability of BC3310 to export
ethidium bromide due to the disruption of the electrochemical
gradient.
Mutation of the Conserved Aspartic Acid
Residue (D105) Abolishes Ethidium Bromide

Efflux
Proton or substrate translocations by transport proteins often
require acidic residues within transmembrane helices (Paulsen
et al., 1996a; Edgar and Bibi, 1997; Sanderson et al., 1998;
FIGURE 5 | Multiple sequence alignment of BC3310 and its
homologs. BC3310 from B. cereus ATCC 14579 (UniProt
accession number: Q81B77) was
aligned using MUSCLE with orthologs from Brevibacillus
brevis (C0ZL32), Exiguobacterium sibiricum (B1YK36),
Listeria innocua (Q92AX8), B. subtilis (O34929),
Geobacillus kaustophilus (Q5L2X3) and Halobacillus halophilus
(I0JJA0). Shading corresponds to >80% (dark blue), >60%
(blue), >40% (light blue), and ≤40%
(white) amino acid identity, respectively. The conserved acidic
residue in transmembrane region 4 is displayed in red.
Transmembrane regions have gray bars under
and conserved MFS motifs are depicted above the sequence.
Dang et al., 2010). Sequence alignment of BC3310 with
orthologous proteins revealed a conserved acidic residue in
putative TMS 4 (Figure 5). In order to investigate the
importance of this conserved aspartate residue (D105) for efflux
activity, mutational analyses were conducted. Three constructs
were made in which the aspartate residue was mutated to
glutamate (D105E), asparagine (D105N), or alanine (D105A).

The expression of the mutant proteins was detected and
quantified by Western blot (Figure 6). This showed that the
expression of all mutant proteins was three to four times
higher compared to the expression of wild type protein.
MIC determination of ethidium bromide and silver nitrate
was performed to investigate the functionality of the mutant
BC3310 proteins (Table 3). Even though more mutant protein
was expressed, the susceptibility of strains expressing mutant
BC3310 was reduced to levels approximating those of the
empty vector control-strain. Thus, mutational change of the
aspartate residue to another acidic or a structurally similar
residue abolished the efflux ability of BC3310 for ethidium
bromide and silver nitrate, indicating that both the size and
charge of the side chain at position 105 are important for
protein
function.
BC3310 Belongs to the UMF-2 Family of the
MFS
BC3310 showed prevailing α-helical structure in our CD
analysis and is predicted to be a 12-TMS multidrug transporter
belonging to the MFS. Most of the 12 TMS-containing
MFS proteins that efflux several drugs are members of the
drug:H+ antiporter families DHA1 and DHA3. To determine
if BC3310 belongs to one of these families within the MFS, a
multiple alignment of sequences orthologous to BC3310 and
sequences from the well described DHA1 and DHA3 families
was performed. From this alignment a dendrogram was built

FIGURE 6 | Western blot detection of the BC3310 protein and
its
mutants in Escherichia coli. E. coli DH5α �acrAB was
transformed with
empty pTTQ18 vector plasmid or pTTQ18 with the indicated
insert; wild type
BC3310 with his-tag and mutants D105N, D105A, and D105E
under an IPTG
inducible promoter. The cells were grown and prepared for
SDS-PAGE as
described in Section “Materials and Methods”. Numbers
indicate: (1) empty
pTTQ18 vector; (2) BC3310 wild type; (3) D105N mutant; (4)
D105A mutant;
(5) molecular weight marker; (6) D105E mutant. BC3310 and its
mutants
migrate at ∼30 kDa.
which showed clustering of BC3310 and orthologs in a distinct
clade separate from the DHA1 and DHA3 family proteins
included in the analysis (Figure 1). This analysis supported
the transporter classification database (TCDB) division of YfkF,
the BC3310 ortholog in B. subtilis, into a separate family,
TABLE 3 | Relative expression rate and relative MIC of E. coli
strains
producing no BC3310, BC3310 wild type, D105N, D105A, or
D105E mutant
protein.
E. coli DH5α �acrAB
producing

Relative
expressionb [%]
Relative resistance to [%]a
Ethidium
bromide
Silver
nitrate
BC3310 wild-type 100 100 100
No BC3310 NAc 20 60
D105N 440 20 50
D105A 330 25 50
D105E 380 30 60
aMICs were determined in E. coli DH5α �acrAB pTTQ18
expressing bc3310 in LB
media or LB media without NaCl (for silver nitrate)
supplemented with 0,04 mM
IPTG and 75 μg ml-1 carbenicillin.
baverage of five different Western blots of five different
cultures.
cNA, not applicable.
the unknown major facilitator family-2 (UMF-2) (Saier et al.,
2014).
Transport Proteins within the UMF-2 Family
Contain a Variant of the MFS Signature Motif A

Sequence alignment revealed that amino acid sequence motifs
characteristic for MFS transporters, namely motif A, B, C,
and G were conserved in BC3310 and orthologous proteins
(Figure 5) (Henderson and Maiden, 1987; Griffith et al.,
1992; Paulsen et al., 1996b). Motif A is conserved in the
loop region between transmembrane segments (TMS) 2 and
3, and has been called the MFS signature motif due to
its conservation across the superfamily. In the majority of
MFS transporters, including the DHA1 family proteins, the
motif A consensus sequence is G-x-L-a-D-r/k-x-G-r/k-r/k-x-
x-I (x indicating any amino acid; capital and lower case
letters representing amino acid frequency of >70% and 40–
70%, respectively; Henderson and Maiden, 1987; Griffith et al.,
1992; Paulsen et al., 1996b). However, a functional variant of
this motif has been described in the Clostridium perfringens
DHA3 family tetracycline efflux protein TetA(P): E-x-P-x-x-x-
x-x-D-x-x-x-R-K (bold letters overlap with D, r/k,r/k of the
canonical motif A) (Bannam et al., 2004). In BC3310 and its
orthologs a modified motif A (motif A′) was identified, which
represents a hybrid of the canonical motif A and the TetA(P)
motif A (Table 4) (Paulsen et al., 1996b; Bannam et al., 2004).
The N-terminal sequence of motif A′ in BC3310 orthologs
resembles the TetA(P) (DHA3) motif A, with E and P conserved
in both motifs, whereas the C-terminal sequence corresponds
to the DHA1 motif A. This results in the BC3310 modified
motif A′ sequence E-r/k-P-L-x-r/k-x-G-x-r/k-P-x-I (bold letters
correspond to sequences of the previously described motif A
sequences).
As in other MFS transporters, a second motif A-like
sequence is present between TMS 8 and TMS 9 in BC3310
(consensus sequence: G-x-L-S-D-r/k-x-G-R-r/k-x-x-i/l). This
sequence coincides more with the signature motif A compared
to the motif A′ sequence between TMS 2 and TMS 3 (Henderson
and Maiden, 1987; Griffith et al., 1992).

Discussion
Heterologous expression of BC3310 in a drug hypersusceptible
E. coli strain increased the tolerance of the bacteria to AgNO3,
SDS, and ethidium bromide, indicating that it has a role in
resistance to multiple drugs. Whole cell accumulation assays of
ethidium bromide in E. coli expressing bc3310 demonstrated
CCCP-sensitive efflux of ethidium in the drug hypersusceptible
E. coli strain confirming a function as a drug efflux protein.
Hence, BC3310 is an energy-dependent multidrug efflux pump.
Inactivation of bc3310 in B. cereus ATCC 14579, also resulted
in increased susceptibility to ethidium bromide, but not to
SDS or AgNO3, suggesting, low basal expression of bc3310
under the conditions used in our experiments. It has, however,
previously been reported that addition of 1 mM AgNO3
to exponentially growing cultures of B. cereus ATCC 14579
TABLE 4 | Consensus sequences of motif A variants found in
MFS drug export families.
MFS family Consensus sequence of motif A variants
DHA1 G x L a D r/k x G r/k r/k x x I
TetA(P) (DHA3) E x P x x x x x D x x x R K

BC3310 (UMF-2) E r/k P – – – – L x r/k x G x r/k P x I
x indicates any amino acid; capital, and lower case letters
represent an amino acid frequency occurrence of >70 and 40–
70%, respectively; bold letters indicate an
overlap with conserved amino acids of the DHA1 or DHA3
family.
induced expression of bc3310 (Babu et al., 2011) and we
detected AgNO3-induced temporal expression of bc3310 by
qRT-PCR under our experimental settings (data not shown).
Therefore, although BC3310 seems to have a role in transport
of Ag+ and/or NO−3 it is not essential in conferring AgNO3
resistance under the conditions tested, but may be important
under specific circumstances. B. cereus ATCC 14579 contains
93 genes annotated as drug transporter which corresponds to
1.7% of the protein coding genes in the genome (Saidijam
et al., 2006, 2011; Ren et al., 2007). In comparison, B. subtilis
and E. coli display 32 and 37 genes encoding drug transport
proteins, respectively, which correspond to 0.8 and 0.9% of
the protein coding genes (Nishino and Yamaguchi, 2001; Ren
et al., 2004). Considering the high number of annotated
drug transporter genes in the genome of B. cereus, it is
possible that one or more transporters compensate for the
loss of BC3310, thereby concealing a potential effect of a gene
disruption.
The efflux of ethidium bromide by BC3310 is dependent
on a conserved aspartate residue, which could not be replaced
by another acidic or hydrophobic amino acid. This indicates
an important role of the aspartate residue at position 105
(D105) in the putative TMS 4. This residue is also conserved
in BC3310 orthologs. Even though this aspartate residue is
not reported to be one of the conserved residues, it falls
into the boundaries of motif B. The motif B sequence of
BC3310 and orthologs is W-x-x-L-R-x-x-x-G-x-G-D-x which

overlaps to a large degree with canonical motif B L-x-x-
x-R-x-x-q-G-x-g-a-a (bold letters indicate matching amino
acids, underlined letter is D105 in BC3310). Motif B contains
an absolutely conserved basic amino acid residue which is
proposed to play a role in proton transfer (Paulsen and
Skurray, 1993). This residue is also conserved in BC3310
(R98).
Sequence analyses classified BC3310 into the UMF-2 family
of the MFS which is distinct from the well characterized drug
efflux families DHA1 and DHA3 and consists of previously
uncharacterized proteins. We have thus described the first
functional data for a member of the UMF-2 family and
showed that it includes multidrug efflux proteins. Previously
transporters belonging to (at least) five of the 82 different
families have been implicated in multidrug efflux. Besides the
mentioned DHA1 and DHA3 families with 12 TMS-containing
transporters, multidrug efflux proteins have been described for
the Organic Cation Transporter family (2.A.1.19) (Koepsell,
2013). In addition, the DHA2 family is known to contain
multidrug efflux proteins with 14 TMS (Paulsen et al., 1996b)
and the gene encoding MdrA in Streptomyces coelicolor,
classified
into the Acriflavin Sensitivity family (2.A.1.36), is regulated by
a TetR repressor that recognizes multiple drugs (Hayashi et al.,
2013).
Interestingly, BC3310 and its orthologs contain an alternative
motif A′ consensus sequence E-r/k-P-L-x-r/k-x-G-x-r/k-P-x-I
between putative TMS 2 and 3. We propose that this consensus
sequence can be used as a marker to distinguish the UMF-
2 family from other MFS families. The presence of a second
motif A in BC3310 is likely due to the duplication of 6
TMS during the evolution of the 12-TMS MFS transporters
(Paulsen and Skurray, 1993). Similarly, motif G relates to a

duplication of motif C (antiporter motif) (Paulsen et al., 1996b).
Motif C is only conserved in exporters and not in importers
(Paulsen and Skurray, 1993). This motif is also found with
a high similarity (including the functionally important GP
dipeptide; De Jesus et al., 2005) in BC3310 and orthologs
which is in line with the efflux function of BC3310. Little
similarity to MFS motif D2 is observed in the sequence
alignment of BC3310 orthologs. As reported previously, motif
D2 does not appear to be highly conserved in recently
investigated 12-TMS MFS transporters and a function has
not yet been assigned (Paulsen et al., 1996b; Kapoor et al.,
2009).
The gene encoding the BC3310 transporter is highly
conserved in the genomes of the B. cereus group members
indicating that bc3310 belongs to the core genome of the
B. cereus group. Comparison of the bc3310 genomic region
of B. cereus ATCC 14579 with the equivalent regions of
selected B. cereus group members, B. cereus ATCC 10987,
B. cereus ATCC 10876, B. anthracis Ames Ancestor A2084,
B. thuringiensis sv. kurstaki YBT-1520, and B. mycoides ATCC
6462 showed the same gene organization. The different species
of the B. cereus group inhabit many different niches and
display a high number of efflux transporter genes in the
genome compared to other bacteria which could account
for the different lifestyles (Saidijam et al., 2006, 2011). Thus,
genes conserved in the genomes of the B. cereus group might
play a role in the fundamental maintenance of physiological
functions. Preliminary phenotypic microarray data using
BIOLOG, however, did not reveal significant differences
between B. cereus ATCC 14579 wild type and �bc3310
mutant. Condition-dependent transcriptome analyses of
the bc3310 ortholog, yfkF, in B. subtilis revealed relatively
constant transcriptional activity across the conditions
investigated (Nicolas et al., 2012). The highest level of gene
expression was observed in cells within stationary (OD600 ∼2)

or transition (OD600 ∼1.4) growth phases in LB medium or
LB medium supplemented with glucose as well as on LB agar.
Ethanol stress conditions revealed the lowest expression of this
gene. Furthermore yfkF is predicted to be under the control
of the housekeeping sigma factor SigA (Nicolas et al., 2012).
Transcription of genes encoding multidrug transporters with a
major role in protecting the cell against toxic compounds is
generally activated by transcription factors that recognize toxic
compounds or stress signals, such as AcrR, SoxS, MarR, and
Rob
in the case of AcrAB of E. coli (Ma et al., 1996; Sulavik et al.,
2001;
Randall and Woodward, 2002; Rosenberg et al., 2003). This fact
and the minor intrinsic susceptibility against toxic compounds
in
the B. cereus �bc3310 deletion mutant indicate that BC3310 is
not a potent multidrug transporter with a main role in protecting
the cell against toxic xenobiotics. It rather hints to an ancient
and
maybe general function in the normal physiology of the B.
cereus
group of bacteria. To further elucidate the role of this
transporter
the inactivation of other efflux proteins might be required.

Taken together, we have performed the first phylogenetic and
functional characterization of a member of the UMF-2. The
amino acid sequence of BC3310 comprises known motifs of the
12-TMS MFS transporters with a modified motif A′ between
TMS 2 and TMS 3. BC3310 is a multidrug transporter with
confirmed predominant α-helical structure. It confers resistance
to ethidium bromide, SDS, and silver nitrate when expressed in
E. coli. The export of ethidium bromide is energy dependent
and requires a conserved aspartate residue in TMS 4. The
deletion of bc3310 in B. cereus resulted in increased
susceptibility
to ethidium bromide under the conditions tested. The high
conservation of bc3310 within the B. cereus group genomes
indicates that it is part of the core genome. We hypothesize
that the intrinsic role of BC3310 is not as a typical multidrug
transporter, but rather as an important component in the normal
physiology of the bacteria, under conditions that still remain to
be identified.
Acknowledgments
This research was funded by the Norwegian Research Council
(FUGE II Program, Project ID 183421). Collaborations
between AK, JK, and AB are funded by the Deutscher
Akademischer Austauschdienst Project ID 54564495 (DAAD)
and the Norwegian Research Council. Financial support for
this research in the PJFH laboratory was provided by grant
agreement N◦ HEALTH-F4-2007-201924, European Drug
Initiative for Channels and Transporters (EDICT) and by
European Membrane Protein Consortium contract LSGH-CT-
2004-504601 (EMeP). Consortium Collaborations between the
three laboratories (AK, PH, IP) are funded by the EU BacMT,
EDICT, and ATENS initiatives. We thank Ewa Jaroszewicz
for valuable technical assistance, as well as Prof. Kern and
Sabine Schuster for providing the opportunity and help during

fluorescence measurements.
References
Ash, C., Farrow, J. A., Dorsch, M., Stackebrandt, E., and
Collins, M. D. (1991).
Comparative analysis of Bacillus anthracis, Bacillus cereus, and
related species
on the basis of reverse transcriptase sequencing of 16S rRNA.
Int. J. Syst.
Bacteriol. 41, 343–346.
Babu, M. M., Sridhar, J., and Gunasekaran, P. (2011). Global
transcriptome
analysis of Bacillus cereus ATCC 14579 in response to silver
nitrate stress. J.
Nanobiotechnol. 9, 49. doi: 10.1186/1477-3155-9-49
Bannam, T. L., Johanesen, P. A., Salvado, C. L., Pidot, S. J.,
Farrow, K. A.,
and Rood, J. I. (2004). The Clostridium perfringens TetA(P)
efflux protein
contains a functional variant of the Motif A region found in
major facilitator
superfamily transport proteins.Microbiology 150, 127–134. doi:
10.1099/mic.0.2
6614-0
Berg, G., Eberl, L., and Hartmann, A. (2005). The rhizosphere
as a reservoir for
opportunistic human pathogenic bacteria. Environ. Microbiol. 7,
1673–1685.
doi: 10.1111/j.1462-2920.2005.00891.x
Bottone, E. J. (2010). Bacillus cereus, a volatile human
pathogen. Clin. Microbiol.

Rev. 23, 382–398. doi: 10.1128/CMR.00073-09
Callegan, M. C., Booth, M. C., Jett, B. D., and Gilmore, M. S.
(1999). Pathogenesis
of gram-positive bacterial endophthalmitis. Infect. Immun. 67,
3348–3356.
Callegan, M. C., Cochran, D. C., Kane, S. T., Ramadan, R. T.,
Chodosh, J.,
Mclean, C., et al. (2006). Virulence factor profiles and
antimicrobial
susceptibilities of ocular Bacillus isolates. Curr. Eye Res. 31,
693–702. doi:
10.1080/02713680600850963
Centers for Disease Control and Prevention (2005) Outbreak of
cutaneous Bacillus
cereus infections among cadets in a university military
program–Georgia,
August 2004.MMWRMorb. Mortal. Wkly. Rep. 54, 1233–1235.
Dang, S., Sun, L., Huang, Y., Lu, F., Liu, Y., Gong, H., et al.
(2010). Structure of
a fucose transporter in an outward-open conformation. Nature
467, 734–738.
doi: 10.1038/nature09406
De Jesus, M., Jin, J., Guffanti, A. A., and Krulwich, T. A.
(2005). Importance
of the GP dipeptide of the antiporter motif and other membrane-
embedded
proline and glycine residues in tetracycline efflux protein
Tet(L). Biochemistry
44, 12896–12904. doi: 10.1021/bi050762c

Edgar, R., and Bibi, E. (1997). MdfA, an Escherichia coli
multidrug resistance
protein with an extraordinarily broad spectrum of drug
recognition. J. Bacteriol.
179, 2274–2280.
Griffith, J. K., Baker, M. E., Rouch, D. A., Page, M. G.,
Skurray, R. A.,
Paulsen, I. T., et al. (1992). Membrane transport proteins:
implications of
sequence comparisons. Curr. Opin. Cell Biol. 4, 684–695. doi:
10.1016/0955-
0674(92)90090-Y
Guinebretiere, M. H., Auger, S., Galleron, N., Contzen, M., De
Sarrau, B.,
De Buyser, M. L., et al. (2013). Bacillus cytotoxicus sp. nov. is
a novel
thermotolerant species of the Bacillus cereusGroup occasionally
associated with
food poisoning. Int. J. Syst. Evol. Microbiol. 63, 31–40. doi:
10.1099/ijs.0.03
0627-0
Hassan, K. A., Liu, Q., Henderson, P. J., and Paulsen, I. T.
(2015). Homologs
of the Acinetobacter baumannii AceI transporter represent a
new family of
bacterial multidrug efflux systems. MBio 6:e01982-14. doi:
10.1128/mBio.0
1982-14
Hayashi, T., Tanaka, Y., Sakai, N., Okada, U., Yao, M.,
Watanabe, N., et al. (2013).
SCO4008, a putative TetR transcriptional repressor from
Streptomyces coelicolor

A3(2), regulates transcription of sco4007 by multidrug
recognition. J. Mol. Biol.
425, 3289–3300. doi: 10.1016/j.jmb.2013.06.013
Henderson, P. J. F., and Maiden, M. C. J. (1987). Sugars,
antibiotics, microbes and
men. Trends Genet. 3, 62–64. doi: 10.1016/0168-
9525(87)90174-0
Janes, B. K., and Stibitz, S. (2006). Routine markerless gene
replacement in Bacillus
anthracis. Infect. Immun. 74, 1949–1953. doi:
10.1128/IAI.74.3.1949-1953.2006
Jensen, G. B., Hansen, B. M., Eilenberg, J., and Mahillon, J.
(2003). The hidden
lifestyles of Bacillus cereus and relatives. Environ. Microbiol.
5, 631–640. doi:
10.1046/j.1462-2920.2003.00461.x
Kapoor, K., Rehan, M., Kaushiki, A., Pasrija, R., Lynn, A. M.,
and Prasad, R. (2009).
Rational mutational analysis of a multidrug MFS transporter
CaMdr1p of
Candida albicans by employing amembrane environment based
computational
approach. PLoS Comput. Biol. 5:e1000624. doi:
10.1371/journal.pcbi.1000624
Frontiers in Microbiology | www.frontiersin.org 10 October
2015 | Volume 6 | Article 1063

Kervick, G. N., Flynn, H. W. Jr., Alfonso, E., and Miller, D.
(1990). Antibiotic
therapy for Bacillus species infections. Am. J. Ophthalmol. 110,
683–687. doi:
10.1016/S0002-9394(14)77068-0
Kim, J. B., Jeong, H. R., Park, Y. B., Kim, J. M., and Oh, D. H.
(2010). Food
poisoning associated with emetic-type of Bacillus cereus in
Korea. Foodborne
Pathog. Dis. 7, 555–563. doi: 10.1089/fpd.2009.0443
Kiyomizu, K., Yagi, T., Yoshida, H., Minami, R., Tanimura, A.,
Karasuno, T., et al.
(2008). Fulminant septicemia of Bacillus cereus resistant to
carbapenem in a
patient with biphenotypic acute leukemia. J. Infect. Chemother.
14, 361–367.
doi: 10.1007/s10156-008-0627-y
Koepsell, H. (2013). The SLC22 family with transporters of
organic
cations, anions and zwitterions. Mol. Aspects Med. 34, 413–
435. doi:
10.1016/j.mam.2012.10.010
Kolsto, A. B., Tourasse, N. J., and Okstad, O. A. (2009).What
sets Bacillus anthracis
apart from other Bacillus species? Annu. Rev. Microbiol. 63,
451–476. doi:
10.1146/annurev.micro.091208.073255
Li, M. Z., and Elledge, S. J. (2007). Harnessing homologous

recombination in
vitro to generate recombinant DNA via SLIC. Nat. Methods 4,
251–256. doi:
10.1038/nmeth1010
Ma, D., Alberti, M., Lynch, C., Nikaido, H., and Hearst, J. E.
(1996). The local
repressor AcrR plays a modulating role in the regulation of
acrAB genes
of Escherichia coli by global stress signals. Mol. Microbiol. 19,
101–112. doi:
10.1046/j.1365-2958.1996.357881.x
Markowitz, V. M., Chen, I. M., Palaniappan, K., Chu, K., Szeto,
E., Grechkin, Y.,
et al. (2012). IMG: the integrated microbial genomes database
and comparative
analysis system. Nucleic Acids Res. 40, D115–D122. doi:
10.1093/nar/gk
r1044
Martinez, M. F., Haines, T., Waller, M., Tingey, D., and
Gomez, W.
(2007). Probable occupational endophthalmitis from Bacillus
cereus.
Arch. Environ. Occup. Health 62, 157–160. doi:
10.3200/AEOH.62.3.1
57-160
Matsuda, S., Kirishima, T., Okamoto, N., Hisano, Y., Takai, K.,
Motoyoshi, T.,
et al. (2014). Bacillus cereus septicemia and necrotizing
fasciitis in a patient
with liver cirrhosis: a case report. Nihon Shokakibyo Gakkai
Zasshi 111,
2013–2020.

Melo, A. L., Soccol, V. T., and Soccol, C. R. (2014). Bacillus
thuringiensis:
mechanism of action, resistance, and new applications: a
review. Crit. Rev.
Biotechnol. 1–10. doi: 10.3109/07388551.2014.960793 [Epub
ahead of print].
Mock, M., and Fouet, A. (2001). Anthrax. Annu. Rev.
Microbiol. 55, 647–671. doi:
10.1146/annurev.micro.55.1.647
Nicolas, P., Mader, U., Dervyn, E., Rochat, T., Leduc, A.,
Pigeonneau, N.,
et al. (2012). Condition-dependent transcriptome reveals high-
level
regulatory architecture in Bacillus subtilis. Science 335, 1103–
1106. doi:
10.1126/science.1206848
Nishino, K., and Yamaguchi, A. (2001). Analysis of a complete
library of putative
drug transporter genes in Escherichia coli. J. Bacteriol. 183,
5803–5812. doi:
10.1128/JB.183.20.5803-5812.2001
Pao, S. S., Paulsen, I. T., and Saier, M. H. Jr. (1998). Major
facilitator superfamily.
Microbiol. Mol. Biol. Rev. 62, 1–34.
Paulsen, I. T., Brown, M. H., Littlejohn, T. G., Mitchell, B. A.,
and Skurray, R. A.
(1996a). Multidrug resistance proteins QacA and QacB from
Staphylococcus
aureus: membrane topology and identification of residues
involved in

substrate specificity. Proc. Natl. Acad. Sci. U.S.A. 93, 3630–
3635. doi:
10.1073/pnas.93.8.3630
Paulsen, I. T., Brown, M. H., and Skurray, R. A. (1996b).
Proton-dependent
multidrug efflux systems.Microbiol. Rev. 60, 575–608.
Paulsen, I. T., and Skurray, R. A. (1993). Topology, structure
and evolution of
two families of proteins involved in antibiotic and antiseptic
resistance in
eukaryotes and prokaryotes–an analysis. Gene 124, 1–11. doi:
10.1016/0378-
1119(93)90755-R
Poole, K. (2007). Efflux pumps as antimicrobial resistance
mechanisms. Ann. Med.
39, 162–176. doi: 10.1080/07853890701195262
Randall, L. P., and Woodward, M. J. (2002). The multiple
antibiotic
resistance (mar) locus and its significance. Res. Vet. Sci. 72,
87–93. doi:
10.1053/rvsc.2001.0537
Reddy, V. S., Shlykov, M. A., Castillo, R., Sun, E. I., and Saier,
M. H. Jr. (2012).
The major facilitator superfamily (MFS) revisited. FEBS J. 279,
2022–2035. doi:
10.1111/j.1742-4658.2012.08588.x
Ren, Q., Chen, K., and Paulsen, I. T. (2007). TransportDB: a
comprehensive
database resource for cytoplasmic membrane transport systems
and

outer membrane channels. Nucleic Acids Res. 35, D274–D279.
doi:
10.1093/nar/gkl925
Ren, Q., Kang, K. H., and Paulsen, I. T. (2004). TransportDB: a
relational database
of cellular membrane transport systems.Nucleic Acids Res. 32,
D284–D288. doi:
10.1093/nar/gkh016
Ren, Q., and Paulsen, I. T. (2007). Large-scale comparative
genomic analyses of
cytoplasmic membrane transport systems in prokaryotes. J. Mol.
Microbiol.
Biotechnol. 12, 165–179. doi: 10.1159/000099639
Ronquist, F., Teslenko, M., Van Der Mark, P., Ayres, D. L.,
Darling, A.,
Hohna, S., et al. (2012). MrBayes 3.2: efficient Bayesian
phylogenetic inference
and model choice across a large model space. Syst. Biol. 61,
539–542. doi:
10.1093/sysbio/sys029
Rosenberg, E. Y., Bertenthal, D., Nilles, M. L., Bertrand, K. P.,
and Nikaido, H.
(2003). Bile salts and fatty acids induce the expression of
Escherichia coli
AcrAB multidrug efflux pump through their interaction with
Rob regulatory
protein. Mol. Microbiol. 48, 1609–1619. doi: 10.1046/j.1365-
2958.2003.0
3531.x
Saidijam, M., Benedetti, G., Ren, Q., Xu, Z., Hoyle, C. J.,
Palmer, S. L., et al. (2006).

Microbial drug efflux proteins of the major facilitator
superfamily. Curr. Drug
Targets 7, 793–811. doi: 10.2174/138945006777709575
Saidijam, M., Bettaney, K. E., Leng, D., Ma, P., Xu, Z., Keen,
J. N., et al. (2011).
The MFS efflux proteins of gram-positive and gram-negative
bacteria. Adv.
Enzymol. Relat. Areas Mol. Biol. 77, 147–166.
Saier, M. H. Jr., Beatty, J. T., Goffeau, A., Harley, K. T.,
Heijne,W. H., Huang, S. C.,
et al. (1999). The major facilitator superfamily. J. Mol.
Microbiol. Biotechnol. 1,
257–279.
Saier, M. H. Jr., Reddy, V. S., Tamang, D. G., and Vastermark,
A. (2014). The
transporter classification database. Nucleic Acids Res. 42,
D251–D258. doi:
10.1093/nar/gkt1097
Sambrook, J., and Russell, D. W. (2001).Molecular Cloning: A
Laboratory Manual.
Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sanderson, N. M., Qi, D., Steel, A., and Henderson, P. J.
(1998). Effect of the D32N
and N300F mutations on the activity of the bacterial sugar
transport protein,
GalP. Biochem. Soc. Trans. 26, S306. doi: 10.1042/bst026s306
Sasahara, T., Hayashi, S., Morisawa, Y., Sakihama, T.,
Yoshimura, A., and Hirai, Y.
(2011). Bacillus cereus bacteremia outbreak due to
contaminated hospital

linens. Eur. J. Clin. Microbiol. Infect. Dis. 30, 219–226. doi:
10.1007/s10096-010-
1072-2
Savini, V., Favaro, M., Fontana, C., Catavitello, C., Balbinot,
A., Talia, M., et al.
(2009). Bacillus cereus heteroresistance to carbapenems in a
cancer patient.
J. Hosp. Infect. 71, 288–290. doi: 10.1016/j.jhin.2008.11.002
Simm, R., Voros, A., Ekman, J. V., Sodring, M., Nes, I.,
Kroeger, J. K., et al.
(2012). BC4707 is a major facilitator superfamily multidrug
resistance transport
protein from Bacillus cereus implicated in fluoroquinolone
tolerance. PLoS ONE
7:e36720. doi: 10.1371/journal.pone.0036720
Steen, M. K., Bruno-Murtha, L. A., Chaux, G., Lazar, H.,
Bernard, S., and Sulis, C.
(1992).Bacillus cereus endocarditis: report of a case and
review.Clin. Infect. Dis.
14, 945–946. doi: 10.1093/clinids/14.4.945
Stevens,M. P., Elam, K., and Bearman, G. (2012). Meningitis
due to Bacillus cereus:
a case report and review of the literature. Can. J. Infect. Dis.
Med. Microbiol. 23,
e16–e19.
Sulavik, M. C., Houseweart, C., Cramer, C., Jiwani, N.,
Murgolo, N., Greene, J.,
et al. (2001). Antibiotic susceptibility profiles of Escherichia
coli strains lacking
multidrug efflux pump genes. Antimicrob. Agents Chemother.
45, 1126–1136.

doi: 10.1128/AAC.45.4.1126-1136.2001
Sun, J., Deng, Z., and Yan, A. (2014). Bacterial multidrug
efflux
pumps: mechanisms, physiology and pharmacological
exploitations.
Biochem. Biophys. Res. Commun. 453, 254–267. doi:
10.1016/j.bbrc.201
4.05.090
Szakonyi, G., Leng, D., Ma, P., Bettaney, K. E., Saidijam, M.,
Ward, A., et al. (2007).
A genomic strategy for cloning, expressing and purifying efflux
proteins of the
major facilitator superfamily. J. Antimicrob. Chemother. 59,
1265–1270. doi:
10.1093/jac/dkm036
Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar,
S. (2013). MEGA6:
molecular evolutionary genetics analysis version 6.0. Mol. Biol.
Evol. 30, 2725–
2729. doi: 10.1093/molbev/mst197
Tusnady, G. E., and Simon, I. (2001). The HMMTOP
transmembrane

topology prediction server. Bioinformatics 17, 849–850. doi:
10.1093/bioinformatics/17.9.849
Uchino, Y., Iriyama, N., Matsumoto, K., Hirabayashi, Y.,
Miura, K., Kurita, D., et al.
(2012). A case series of Bacillus cereus septicemia in patients
with hematological
disease. Intern. Med. 51, 2733–2738. doi:
10.2169/internalmedicine.51.7258
Voros, A., Simm, R., Kroeger, J. K., and Kolsto, A. B. (2013).
Gene transcription
from the linear plasmid pBClin15 leads to cell lysis and
extracellular DNA-
dependent aggregation ofBacillus cereusATCC14579 in
response to quinolone-
induced stress.Microbiology 159, 2283–2293. doi:
10.1099/mic.0.069674-0
Wallace, B. A., Lees, J. G., Orry, A. J., Lobley, A., and Janes,
R. W. (2003). Analyses
of circular dichroism spectra of membrane proteins. Protein Sci.
12, 875–884.
doi: 10.1110/ps.0229603
Ward, A., Sanderson, N. M., O’reilly, J., Rutherford, N. G.,
Poolman, B.,
and Henderson, P. J. F. (2000). “The amplified expression,
identification,
purification, assay and properties of histidine-tagged bacterial
membrane
transport proteins,” in Membrane Transport – A Practical
Approach, ed. S. A.
Baldwin (Oxford: Blackwell Press), 141–166.

Conflict of Interest Statement: The authors declare that the
research was
conducted in the absence of any commercial or financial
relationships that could
be construed as a potential conflict of interest.
Copyright © 2015 Kroeger, Hassan, Vörös, Simm, Saidijam,
Bettaney, Bechthold,
Paulsen, Henderson and Kolstø. This is an open-access article
distributed under the
terms of the Creative Commons Attribution License (CC BY).
The use, distribution or
reproduction in other forums is permitted, provided the original
author(s) or licensor
are credited and that the original publication in this journal is
cited, in accordance
with accepted academic practice. No use, distribution or
reproduction is permitted
which does not comply with these terms.
http://www.frontiersin.org/Microbiology/archiveBacillus cereus
efflux protein BC3310 – a multidrug transporter of the unknown
major facilitator family, UMF-2IntroductionMaterials and
MethodsBioinformatics AnalysesConstruction of B. cereus
bc3310 Deletion MutantEscherichia coli BC3310 Expression
ConstructsMIC TestsEthidium Bromide Accumulation

AssayHeterologous Expression of BC3310 and Its Mutants with
(His)6-tag and Western BlotPurification of the BC3310 Protein
by Affinity ChromatographyCircular Dichroism
MeasurementResultsBC3310 is Conserved in the B. cereus
GroupB. cereus bc3310 is More Susceptible to Ethidium
Bromide Compared to the Wild TypeExpression of BC3310
Protein in E. coliEthidium Bromide Efflux of BC3310 is
Disrupted by CCCPMutation of the Conserved Aspartic Acid
Residue (D105) Abolishes Ethidium Bromide EffluxBC3310
Belongs to the UMF-2 Family of the MFSTransport Proteins
within the UMF-2 Family Contain a Variant of the MFS
Signature Motif ADiscussionAcknowledgmentsReferences
mge_a4_study_q1.pdf
Geophys. Res. Lett. 16, 703 (1989).
71. D. Kley et al., in Global and Regional Environmen-
tal Atmospheric Chemistry: Proceedings of the
International Conference on Global and Regional
Environmental Atmospheric Chemistry (Depart-
ment of Energy Conference 890525, 1989, avail-
able from the National Technical Information Ser-
vice, Springfield, VA), p. 9.
72. D. Rind, R. Suozzo, N. K. Balanchandran, M. J.
Prather, J. Atmos. Sci. 47, 475 (1990).
73. K. B. Hogan, J. S. Hoffman, A. M. Thompson,
Nature 354, 181 (1991); A. M. Thompson, K. B.
Hogan, J. S. Hoffman, Atmos. Environ., in press.
74. C. S. Atherton and J. E. Penner, J. Geophys. Res.
95,14027 (1990).

75. I. S. A. lsaksen, T. Bemtsen, S. Solberg, in Ozone in
the Atmosphere, R. D. Bojkov and P. Fabian, Eds.
(A. Deepak, Hampton, VA, 1989), pp. 576-579.
76. M. J. Prather, Ed., "An assessment model for
atmospheric composition" (NASA Conf. Publ.
3023, NASA, Washington, DC, 1989).
77. S. Madronich and C. Granier, Geophys. Res. Lett.
19, 465 (1992).
78. A. M. Thompson, J. Geophys. Res. 89, 1341
(1984); S. Madronich, ibid. 92, 9740 (1987).
79. S. A. Penkett and K. A. Brice, ibid. 319, 655
(1986).
80. J. A. Logan, J. Geophys. Res. 90,10463 (1985).
An update for the North American data is in J. A.
Logan, in Tropospheric Ozone, I. S. A. lsaksen,
Ed. (North Atlantic Treaty Organization Advanced
Study Institutes, Reidel, Dordrecht, Holland,
1988), pp. 327-344.
81. Locations of sites: Barrow (710N, 157W; Mauna
Loa (19.5°N, 156W); Samoa (140S, 171°W); South
Pole (90°S, 0). See (36); S. J. Oltmans and W. D.
Komhyr, J. Geophys. Res. 91, 5229 (1986).
82. K. M. Valentin, thesis, Johannes-Gutenburg Uni-
versity, Mainz (1990).
83. P. J. Crutzen and P. H. Zimmermann, Tellus Ser. B
43, 136 (1991).

84. The following people have been generous with
reports of recent work: C. Bruhl, J. Fishman, I. S. A.
lsaksen, M. Kanakidou, M. A. K. Khalil, K. Law, Y.
Lu, A. Neftel, J. Pinto, M. Prather, and R. Prinn. M.
Kanakidou, J. Logan, and W. Stockwell made
helpful comments on the manuscript. Some of the
model comparisons (Tables 1 and 2) grew out of
the United Nations Environmental Programme-
World Meteorological Organization Ozone Assess-
ment Group Workshop (London, June 1991) and a
North Atlantic Treaty Organization Advanced Re-
search Workshop on Methane (Mt. Hood, Oregon,
October 1991). My research on oxidizing changes
is supported by NASA Programs in Earth Observ-
ing Systems and Troposphenc Chemistry and by
the U.S. Environmental Protection Agency.
Molecular Epidemiology of HIV
Transmission in a Dental Practice
Chin-Yih Ou, Carol A. Ciesielski, Gerald Myers,
Claudiu 1. Bandea, Chi-Cheng Luo, Bette T. M. Korber,
James 1. Mullins, Gerald Schochetman, Ruth L. Berkelman,
A. Nikki Economou, John J. Witte, Lawrence J. Furman,
Glen A. Satten, Kersti A. Macinnes, James W. Curran,
Harold W. Jaffe, Laboratory Investigation Group,*
Epidemiologic Investigation Groupt
Human immunodeficiency virus type 1 (HIV-1) transmission
from infected patients to
health-care workers has been well documented, but transmission
from an infected health-
care worker to a patient has not been reported. After

identification of an acquired immu-
nodeficiency syndrome (AIDS) patient who had no known risk
factors for HIV infection but
who had undergone an invasive procedure performed by a
dentist with AIDS, six other
patients of this dentist were found to be HIV-infected.
Molecular biologic studies were
conducted to complement the epidemiologic investigation.
Portions of the HIV proviral
envelope gene from each of the seven patients, the dentist, and
35 HIV-infected persons
from the local geographic area were amplified by polymerase
chain reaction and se-
quenced. Three separate comparative genetic analyses-genetic
distance measure-
ments, phylogenetic tree analysis, and amino acid signature
pattern analysis-showed that
the viruses from the dentist and five dental patients were
closely related. These data,
togetherwith the epidemiologic investigation, indicated
thatthese patients became infected
with HIV while receiving care from a dentist with AIDS.
Epidemiologic Investigation
In July 1990, we reported that a young
woman with AIDS (patient A) had most
likely acquired her HIV-1 infection while
undergoing invasive dental procedures by a
Florida dentist with AIDS (4). Following
publication of the report, the dentist pub-
licly requested that his former patients be
tested for HIV infection. Among approxi-
mately 1100 persons whose blood was tested
by the Florida Department of Health and
Rehabilitative Services (HRS), two pa-

tients (patients B and C) were found to be
HIV-positive. An additional infected pa-
tient (patient D) was ascertained by HRS
through cross matching a list of the dentist's
former patients with the Florida AIDS case
registry. Two other patients of the dentist
(patients E and G) contacted the Centers
for Disease Control (CDC) to report that
they were HIV-infected. A former sex part-
ner named by patient E was found to be
HIV-infected and had also been a patient of
the dentist (patient F). Characteristics of
these seven infected patients and the den-
tist are included in Table 1.
Patient D had previously been reported
Lcreasingly, molecular biologic tech-
niques have been used to study the epide-
miology of infectious diseases. For viral
infections of humans, techniques to analyze
viral genetic sequence information, such as
oligonucleotide fingerprinting of RNA ge-
nomes with ribonuclease, mapping ofDNA
genomes with restriction endonucleases,
and genomic sequencing, have been used to
study viral transmissions from person to
person, within communities, and between
countries (1). Requisite to such studies is
the existence of viral genetic variation; the
greater the variation, the greater the power
of the methods to distinguish strains of the
virus. For a virus with substantial genomic
variation, identification of strains with a
high degree of genetic relatedness may im-

ply an epidemiologic linkage between per-
sons infected with these strains.
The human immunodeficiency virus
(HIV) has a high mutation rate (2, 3), such
that HIVs from different individuals are found
to be genetically distinct (3). In this article,
we describe the use of genomic sequencing to
investigate a cluster of HIV infections in a
Florida dental practice. The high degree of
genetic relatedness observed among the HIV
strains from a dentist with acquired immuno-
deficiency syndrome (AIDS) and five of his
infected patients supports the epidemiologic
investigation that indicated that these pa-
tients became infected with HIV while receiv-
ing dental care.
SCIENCE * VOL. 256 * 22 MAY 1992
C.-Y. Ou, C. A. Ciesielski, C. I. Bandea, C.-C. Luo, G.
Schochetman, R. L. Berkelman, G. A. Satten, J. W.
Curran, and H. W. Jaffe are in Division of HIV/AIDS,
National Center for Infectious Diseases, Centers for
Disease Control, Atlanta, GA 30333. G. Myers, B. T. M.
Korber, and K. A. Maclnnes are in the Theoretical
Division, Los Alamos National Laboratory, Los
Alamos, NM 87545. J. I. Mullins is in the Department of
Microbiology and Immunology, Stanford University
School of Medicine, Stanford, CA 94305. A. N. Econ-
omou and J. J. Wifte are in the Florida Department of
Health and Rehabilitative Services, Tallahassee, FL
32399. L. J. Furman is in the Division of Oral Health,
National Center for Prevention Services, Centers for
Disease Control, Atlanta, GA 30333.
*J. Moore, Y. Villamarzo, and C. Schable, Division of

HIV/AIDS and E. G. Shpaer, Department of Microbiol-
ogy and Immunology, Stanford University School of
Medicine.
tT. Liberti and S. Lieb, Florida Department of Health
and Rehabilitative Services (HRS); R. Scott, J. Howell,
R. Dumbaugh, A. Lasch, Florida HRS District 9; B.
Kroesen and L. Ryan, Martin County Public Health
Unit, Florida HRS; K. Bell, V. Munn, D. Marianos, and
B. Gooch, Centers for Disease Control.
1165
mcmmcmoRmgmmmmmmgmRRQmmmmn
ummnnmmmopmummRRmmqgommnmmcmomcmmmoomcgmmn
gmmcmm wwwwwwwwwwwl mmmomom
o
n
O
ct
ob
er
2
0,
2
01
0
w
w
w

.s
ci
en
ce
m
ag
.o
rg
D
ow
nl
oa
de
d
fr
om
http://www.sciencemag.org
to HRS as having behavioral risks for HIV
infection. To establish any risk factors for
exposure to HIV for the remaining six
patients, follow-up investigations were con-
ducted (5). These investigations included
interviews with the patients and their fam-

ilies and friends; review of medical, dental,
and health department records; interviews
with health-care providers; and testing of
the patients' sex partners for HIV infection.
Interviews and medical records established
that patient F also had behavioral risk
factors for HIV infection. The other five
patients (patients A, B, C, E, and G)
denied injecting drug use since 1978 and
had no history of transfusion or receipt of
blood products; the two male patients (pa-
tients C and G) denied having had sex with
men. The possibility that patient C had
engaged in high-risk behaviors was raised
during the epidemiologic investigation;
however, behavioral exposures to HIV
could not be documented.
Only one of the known sex partners of
these five patients tested positive for HIV
infection. This person (patient F) had been
an infrequent sex partner of patient E from
1987 until the fall of 1988. Patient E was
first tested for HIV infection in October
1988 and was seropositive; patient F had
been tested in October and December 1988
and was seronegative. In September 1989,
approximately 1 year after his last sexual
contact with patient E and his last reported
dental visit, patient F had an illness com-
patible with an acute retroviral infection;
he first tested positive for HIV in December
1990. Thus, patients E and F appeared to
have contracted their HIV infections from
different sources.

The dentist was diagnosed with symp-
tomatic HIV infection in late 1986 and
with AIDS in September 1987, when a
biopsy of his palate showed Kaposi's sarco-
ma and his CD4+ lymphocyte count was
less than 200 per microliter. He continued
to practice general dentistry for approxi-
mately 2 years after he was diagnosed with
AIDS. During this 2-year period, each of
the five patients without confirmed expo-
sures to HIV made multiple visits to the
dental office for invasive procedures, in-
cluding extractions or root canal therapy.
HIV Genetic Variafion
Because the epidemiologic findings suggest-
ed that transmission may have occurred in
the dental practice, we conducted a labora-
tory investigation to determine whether
there was evidence of genetic similarity
among the viruses infecting the dentist and
his patients. HIV is known to undergo
genetic change or variation during its life
cycle resulting in a myriad of related viral
progenies (commonly called quasi-species)
1166
(6). Several factors, including duration of
infection (7), host immune pressure (8),
disease stage (9), and therapy (10), may
contribute to the degree and rate of HIV
genetic variation. HIV strains from persons
with a known common infection link, for
example, sex partners (1 1), mothers and

their infants (11, 12), blood donors and
recipients (13), and hemophilic men re-
ceiving common lots of contaminated
blood products (2, 14), have been shown to
exhibit a closer genetic relatedness than
HIV strains from persons without a direct
transmission link. Thus, we used the degree
of genetic similarity, in combination with
epidemiologic information, to evaluate pos-
sible HIV transmission linkage.
Analysis of HIV-1 genetic variation in-
volves comparison of multiple sequences
covering a region of the viral genome.
Among the structural genes of HIV, the
envelope gene (env) exhibits the highest
degree of genetic diversity. The distribution
of genetic diversity in env is not uniform as
evidenced by the presence of interspersed
conserved (C) and variable (V) domains in
the extemal glycoprotein gp120. We fo-
cused most of our analyses on the C2 and
V3 domains because (i) these domains con-
tain nucleotide sequences with sufficient
variability to distinguish between strains, a
feature essential for establishing HIV trans-
mission linkage, (ii) C2-V3 sequences have
been used in previous studies of epidemio-
logically linked infections (2, 11, 12, 14),
and (iii) the HIV Sequence Database (3)
contains a relative abundance of C2-V3
sequences for comparative purposes.
Blood specimens from the dentist, pa-
tients A through G, and 35 local HIV-
seropositive persons (local controls or LCs)

were collected between March 1990 and
April 1991. Local control specimens were
collected from two HIV clinics located
within 90 miles of the dental practice. Of
the 35 LCs, 7 did not have symptoms
related to their HIV infection, 11 were
symptomatic but had not developed AIDS,
and 17 had AIDS.
DNA fiagments of approximately 680
base pairs containing the C2, V3, V4, C3,
and V5 domains of the gpl20 gene were
amplified by a two-step polymerase chain
reaction (PCR) procedure (15, 16) on DNA
from peripheral blood mononuclear cells
(PBMCs) of the dentist and the seven pa-
tients. The resulting amplified DNA prod-
ucts were sequenced directly or cloned into
an M13 vector and sequenced (15). Care
was taken to prevent DNA carryover during
the PCR procedure (15, 17), a problem that
has been previously reported (18, 19). We
also took measures to facilitate the manage-
ment and identification of the source of
specimens (15). The initial results were ver-
ified by repeating the PCR amplification
procedure with a second vial ofPBMCs from
either the first blood collection (the dentist
and patients D and E) or a second blood
collection (patients A, B, C, F, and G);
products from the second round of amplifi-
cation were sequenced directly (15). In ad-
dition, HIV sequences from patients A and
B and one LC were independently verified
by another laboratory (20).

The Dental Group
To assess the genetic relatedness between
the HIV strains infecting the dentist and
his seven patients, multiple C2-V3 se-
quences (Table 1) as well as V4-C3-V5
Table 1. Dental cohort clinical information and HIV nucleotide
variation in the C2-V3 domain of the
envelope gene.
Known M13 Intraperson Interperson variationt (%)
Person Sex risk Clinical status* clones variationt
factor (no.) (%) To dentist To 30 LCst
Dentist M Yes AIDS 6 3.3 (0.8-5.4) 11.0 (5.8-16.0)
Patient A F No AIDS 6 2.0 (0.0-4.5) 3.4 (0.8-6.2) 10.9 (5.4-
14.8)
Patient B F No Asymptomatic 12 1.9 (0.4-3.7) 4.4 (2.1-7.0) 11.2
(6.2-16.5)
(CD4 = 222/LI)
Patient C M No§ Asymptomatic 5 1.2 (0.4-1.6) 3.4 (2.1-4.9)
11.1 (7.0-15.6)
(CD4 = <50/il)
Patient E F No Asymptomatic 6 2.1 (0.4-3.7) 3.4 (1.2-6.6) 10.8
(5.8-14.8)
(CD4 = 567/Jl)
Patient G M No Asymptomatic 5 2.8 (1.6-3.7) 4.9 (2.9-7.0) 11.8
(6.2-16.9)
(CD4 = 400/4LI)

Patient D M Yes AIDS 5 7.5 (0.0-9.9) 13.6 (11.5-15.6) 13.1
(7.8-17.3)
Patient F M Yes Asymptomatic 6 3.0 (0.8-5.8) 10.7 (8.2-13.6)
11.9 (7.0-17.3)
(CD4 = 253/ul)
*Clinical status at the time of specimen collection. CD4 is the
CD4+ lymphocyte count tSequence alignment
over 243 nucleotide positions in C2-V3 was obtained with the
program PIMA (37) follwed by manual refinement
with MASE (3). Subsequently, all M13 clone sequences were
compared to each other and to direct sequences
(15) of PCR-amplified products using the SIMILARITY
function of MASE. Only single nucleotide differences are
scored; gaps were not scored. The average percentages of
differences are shown with the range of values in
parentheses. tSequences from five of the LCs were shorter than
243 nucleotides and were not included in this
analysis. §Possible risk factors for HIV infection were
suggested but not documented.
a
o
n
O
ct
ob
er
2
0,

2
01
0
w
w
w
.s
ci
en
ce
m
ag
.o
rg
D
ow
nl
oa
de
d
fr
om

sequences from the dentist and the seven
dental patients were compared. Five to 12
C2-V3 sequences (containing a portion of
the C2 and all of the V3 region) and several
V4-C3-V5 sequences from independent
M13 clones were obtained from each of the
seven dental patients. We defined the av-
erage or genetic distance between the virus-
es of one individual and those of another
individual or set of individuals as the aver-
age percentage of sequence divergence (ex-
cluding positions with gaps) of all available
pairs of C2-V3 nucleotide sequences. Ge-
netic distances between the viruses of the
dentist and the patients (21), as well as the
ranges of differences, are shown in Table 1.
For the patients A, B, C, E, and G, the
average distance to the dentist's viruses
clustered in the range of 3.4 to 4.9%,
distances comparable to those reported for
known epidemiologically linked infections
(2, 11, 12). In contrast, viruses present in
patients D and F were more distantly relat-
ed to those of the dentist, 13.6% and
10.7%, respectively. These latter distances
are typical of equivalently measured dis-
tances for viruses taken from epidemiologi-
cally unlinked infections and are consistent
with the epidemiologic finding that patients
D and F engaged in high-risk behaviors that
could have resulted in their HIV infections.
These and other laboratory results (Fig. 1
and Table 2), in conjunction with the

epidemiologic findings, led to the decision
to exclude patients D and F from the cluster
of linked infectiops in the statistical analy-
ses presented belqw.
When the percentages of sequence di-
vergence for viral sequences from the same
person were calculated, the averages found
in the viruses of the dentist and each of the
patients A, B, C, E, and G were low (0.0 to
5.4%). These data are consistent with pre-
vious reports of intraperson genetic varia-
tion (2, 3, 6), indicating that none of the
five patients was infected with HIV from
more than one source.
Although no case of a stable form of
HIV has been reported (3), the existence of
a predominant HIV-1 variant in this part of
Florida could not be presumptively ruled
out. The existence of such a variant could
potentially explain the finding of highly
related HIV sequences among patients A,
B, C, E, and G, independent of their
contact with the dentist. Therefore, we
determined the HIV C2-V3 sequences of
the 35 HIV-seropositive LCs to examine
the extent of genetic variation in the local
geographic area. The sequences for 33 of
the LCs were determined directly from the
amplified products (15), which permitted
the determination of the most common
residue at each position (11, 22). In addi-
tion, the C2-V3 sequences from 7 of the 35
LCs, including the two for which direct

sequences were not available, were deter-
mined from their respective M13 clones.
Thirty of the 35 C2-V3 sequences (both
direct and clone) from the LCs were longer
than 243 nucleotides and were included in
the genetic distance comparison (Table 1).
In calculating the genetic distances in Ta-
ble 1, we used direct sequences only when
clone sequences were not available. The
five other LCs were not included because of
their slightly shorter nucleotide sequence
lengths.
As shown in Table 1, average distances
between the viruses of dental patients A, B,
C, E, and G and those of the LCs ranged
from 10.8 to 11.8%. These distances are in
accord with the average interpatient dis-
tance found among the 30 LCs, namely
12.0%o. In addition, the average distances
between the dentist's viruses and those of
the 30 LCs is 11.0%, whereas the average
distance between the dentist's viruses and
those of patients A, B, C, E, and G is 4.0%.
The possibility that the HIV sequences
in patients A, B, C, E, and G were closer in
their genetic distance to the dentist's virus-
es than to the LC's viruses as a result of
chance alone was tested using the Wil-
coxon rank-sum statistic. The test statistic
was significant (P = 6 x 10-6), suggesting
that this cluster of related viruses in the
dentist and patients A, B, C, E, and G is
not due to chance (23). This cluster cannot

be explained by the existence of a stable
viral variant within the geographic area.
Other data from the V4-C3-V5 region are
consistent with our analysis of the C2-V3
region sequence relationships.
Phylogenetic Tree Analysis
The pairwise distance measurements report-
ed in Table 1 do not provide information
about either the relationship of the viruses
from the infected dental patients to each
other or the viral genetic distances from the
patients to individual LCs. Furthermore,
these measurements do not delineate the
proximal source of the viruses infecting the
individual dental patients. To more closely
examine the full range of relationships be-
tween the viruses of the dentist, the pa-
tients, and the LCs, we subjected the C2-
V3 nucleotide sequence data set to phylo-
genetic tree analyses. These cluster analyses
were intended to be both "exploratory"
and, within the limitations of the sequence
lengths, "statistical" (24).
A representative tree comprising the
dental group and select LC sequences is
B
Patient A-y
Patient C-x
Patient C-y
Patient G-x
Patient G-y

Patient A-x
Patient B-x
Patient B-y
Patient E-x
Patient E-y
- ratient -y FIg. 1. Phylogenetic tree analy-
.................................... g .Pylg ntctreaay
LC2-x sis comparing HIV-1 envV3 re-
LC3-x gion coding sequences fromLC3-x the dentist, the dental
patients A
LC2-y through G, and select local con-
Patient F-x trols LC2, LC3, LC9, and LC35.
Patient F-y The two most divergent clone
LC Consensus Sequence sequences from each person
LC9 (designated x and y for each
LC35 person), with the exception of
LC3-y LC9 and LC35, for whom only
PatientD-x 4% I
direct PCR sequencing prod-Patient D-x L....J ucts were
available, have been
Patient D-y included. The LC sequences in-
cluded were those found by
pairwise distance measurement (Table 1) and signature pattern
analysis (Table 2) to be the closest
control sequences to the dental group sequences, which are

enclosed by a box in (A). An LC
consensus sequence has also been included, and the tree was
rooted upon the African sample ELI.
The PAUP parsimony algorithm was used to analyze 279
aligned sites (25), of which 146 sites were
varied. When the dentist's viral sequences were withdrawn from
the analysis, or required to cluster
with the LC consensus sequence (25), the dental clade remained
otherwise unaffected, as shown
in (B). Vertical distances are for clarity only; the lengths of the
horizontal branches are proportional
to the single base changes and can be read as percentage
differences with the scale bar.
.VMMLMMM
1167
o
n
O
ct
ob
er
2
0,
2
01
0

w
w
w
.s
ci
en
ce
m
ag
.o
rg
D
ow
nl
oa
de
d
fr
om
Table 2. Frequencies of amino acids that define a signature
pattern in the dentist's viruses.

Frequencies
Reference set*
E T E S T A I Q
Reference set 0.63 0.81 0.69 0.59 0.69 0.66 0.72 0.56
Florida LCs 0.67 0.67 0.63 0.75 0.42 0.60 0.84 0.45
Dentist's viruses 0 0 0 0 0 0 0 0
A, B, C, E, G viruses 0 0 0 0 0 0.20 0 0
D and F viruses 0.55 1.0 0.73 0.91 0 0.45 0.82 0.82
Dentist's signaturet
A A G A E V H
Reference set 0.06 0.13 0.06 0.16 0.25 0.06 0.25 0.16
Florida LCs 0.15 0.23 0.04 0.15 0.58 0.06 0.14 0.28
Dentist's viruses 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0
A, B, C, E, G viruses 1.0 0.94 0.97 1.0 1.0 0.69 1.0 1.0
D and Fviruses 0.36 0 0 0.09 1.0 0 0 0
*Thirty-two distinct V3 region sequences available from the
HIV Sequence Database (3). Those positions at which
the dentist's viruses differed from that amino acid found in 50%
or more of the reference set sequences constitute
the dentist's signature pattem. Eight noncontiguous amino acids
were objectively identified (see Fig. 2 for
positions involved). tThe dentist's signature pattern is found by
definition in all six cloned sequences of the
dentist's viruses. Signature pattems were also determined for
patients A, B, C, E, and G. Signature similarity:
dentist, 6 clones with 8/8 amino acids identical with signature
pattern; patient A, 6 clones with 8/8; patient B, 11
clones with 8/8 and 1 clone with 7/8; patient C, 4 clones with
8/8 and 1 clone with 7/8; patient E, 4 clones with 8/8
and 2 clones with 7/8; patient G, 5 clones with 8/8; patient D, 4

clones with 2/8 and 1 clone with 1/8; and patient
F, 1 clone with 2/8 and 5 clones with 1/8.
shown in Fig. 1. A parsimony algorithm was
used to generate this tree (25). Due to the
large number of LCs, not all clone sequences
available in this study could be satisfactorily
represented in a single tree. Therefore, we
focused the analysis on trees constituted
from the two most divergent sequences
(when available) from each of the samples
and included only those LC sequences that
by distance measurement (Table 1) or signa-
ture pattern analysis (Table 2) were found to
be most closely related to the dental group
sequences. In addition, a consensus se-
quence derived from all of the LC sequences
(LC consensus sequence) was included.
Many equally parsimonious trees were found;
however, the monophyletic nest containing
the sequences of the dentist and of patients
A, B, C, E, and G was common to all of the
most parsimonious trees. This nest, indicat-
ed by the boxed area in Fig. lA, will be
referred to as the dental clade.
Other trees were constructed by (i) using
consensus sequences; (ii) rearranging the
order in which sequences were presented to
the computer program; (iii) including all
LC sequences, other U.S.-derived se-
quences, and V4-C3-V5 sequences; (iv)
using only nucleotides representing the first
and second base positions in codons; (v)
removing 64 noninformative sites (of the
total 146 varied sites) (26); and (vi) succes-

sively removing and reintroducing the pa-
tient and LC sequences. All of the most
parsimonious trees generated in these dif-
ferent ways retained the dental clade shown
in Fig. 1; the viral sequences from patients
A, B, C, E, and G invariably nested with
the dentist's viral sequences. When the
dentist's viral sequences were removed from
the analysis, or required to cluster with the
1168
LC consensus sequence in a 'user-defined"
tree (25), the remaining portion of the
dental clade remained intact (Fig. 1B).
Thus, tree analyses were consistent with
the genetic distance analysis summarized in
Table 1, and the tree analyses defined a
strong linkage among the sequences from
patients A, B, C, E, and G, independent of
the presence or absence of the dentist's viral
sequences. However, tree analyses could
not specify the order, that is, the direction,
of transmission within the dental group.
It is prudent with cluster analyses in-
volving a relatively small number of phylo-
genetically informative sites to subject the
cluster analyses to statistical bootstrap anal-
ysis (27). In each of 100 iterations of the
bootstrap analysis, nucleotide sites were
randomly selected (with replacement) from
the 146 sites that had been used as the basis
for construction of the phylogenetic tree
shown in Fig. lA. A new tree was then
constructed for each iteration. By this pro-

cedure, the monophyletic grouping of the
dental sequences was observed in 79 of 100
replicates (26). The value 79 of 100 should
not be construed as a P value for a statistical
test of the hypothesis that the dental clade
forms a monophyletic nest; results of such
tests (for instance, the genetic distance
analyses that use rank-sum statistics and the
signature pattem analysis) are presented
below. Instead, the results should be inter-
preted as an indication of how often we
would conclude, from randomly selected
nucleotide sites, that the dental clade was a
distinct cluster. This procedure provides
some measure of the power of the tree
analysis, although exact interpretation of
results from bootstrap analysis of parsimony
trees is a subject of controversy (28).
Signature Pattern Analyses
Early in the course of this investigation, we
noted the shared occurrence of a unique
amino acid pattem in some clones of the
dentist's and patient A's viruses (4). Al-
though this particular pattem was not ob-
served in all of the clones from these two
individuals, nor in sequences from the oth-
er dental patients, it encouraged us to
undertake a third measure of genetic simi-
larity based upon phylogenetically informa-
tive characters. This approach will be re-
ferred to as amino acid signature pattem
analysis.
A unique signature pattem of eight res-

idues was detected within the 120-amino
acid C2-V3 region of the dentist's viruses by
comparing an alignment of his viral amino
acid sequences to an alignment of a refer-
ence set consisting of 26 North American,
5 Haitian, and 1 European HIV-1 se-
quences (29). The resulting pattem consist-
ed of all sites in which all six clones from
the dentist differed from what is found in
over 50% of sequences in the reference set
(Table 2 and marked with asterisks in Fig.
2; although consensus sequences are shown
for illustrative purposes, every available
clone sequence was used in this analysis).
The dentist's signature pattem consisted of
the following eight noncontiguous amino
acids: A, I, A, G, A, E, V, and H. In
contrast, the most common amino acids at
these sites in the reference set were E, T, E,
S, T, A, I, and Q, which occurred with
frequencies ranging from 0.56 to 0.81. No
sequence in the reference set contained
more than four of the dentist's signature
amino acids; most contained two or fewer.
We then inspected the viral sequences
of the dental patients and the LCs for the
presence of the dentist's signature pattem.
No clone sequence from patients A, B, C,
E, and G possessed fewer than seven of the
eight signature amino acids (Table 2). As
with the reference set of 32 sequences, most
LC sequences showed two or fewer of the
signature amino acids. In computing the
statistical significance of these findings, we
used the sequences from those individual

clones for each of the patients A, B, C, E,
and G that agreed least with the dentist's
signature. For the seven LC cases in which
there were multiple clones, we used the
clone sequence that agreed best with the
dentist's signature. This biased the outcome
toward the hypothesis that the viruses of
the dental patients and the LCs were equal-
ly similar to the dentist's viruses. Even so,
the Wilcoxon rank-sum test (P = 8 x
10-6) shows the five patients' viruses have
significantly better agreement with the den-
tist's signature pattern than do the 28 LC
viruses for which agreement at all eight
signature amino acid sites could be assessed
Group
c9MRmRmnNRQNRRgmmpQRR;QnnR
unmRNnpngnumnmnunpvogmgoRgmgovNNMRNmovgnpmNRo
nEggggR
o
n
O
ct
ob
er
2
0,

2
01
0
w
w
w
.s
ci
en
ce
m
ag
.o
rg
D
ow
nl
oa
de
d
fr
om

(30). This finding corroborated the genetic
distance analysis (Table 1) and phylogenet-
ic tree analyses (Fig. 1). Furthermore, the
viruses from patients D and F are again
distinct from the viruses infecting the other
five patients; they possessed no more than
two signature amino acids.
Both the genetic distance and signature
pattem analyses identified a few LCs that
were close to, but distinct from, the dental
cluster. LC35 and LC9 had C2-V3 nucleo-
tide sequences that were closest to those of
the dentist by genetic distance analysis,
averaging 6.7% (range 5.8 to 7.8%) and
6.9% (range 5.8 to 8.2%), respectively.
The sequences from these two LCs pos-
sessed four of the eight amino acids in the
dentist's signature pattem (Fig. 1). The
maximum number of the dentist's signature
amino acids, five, found in any of the LC
sequences occurred in one clone sequence
from LC3. However, this clone had an
average distance of 9.8% from the dentist's
clone sequences, and the other five clones
from LC3 all contained only two signature
amino acids. By phylogenetic analyses,
these LC sequences did not appear to be
part of the dental clade (Fig. 1).
We next addressed the question of
whether two of the measures of genetic
similarity (genetic distance and amino acid
signature pattem analysis) were truly differ-

ent measures or were merely restatements of
the same measures. If the information con-
tained in these two measures overlapped,
we could expect to see a high degree of
correlation between them. However, Ken-
dall's Tb (31), a measure of correlation
computed from the 28 LCs for which both
measures were available, was -0.07 (95%
confidence interval from -0.37 to 0.24; a
value of 0 indicates a lack of correlation).
Therefore, we conclude that the analyses of
average distance and signature pattem are
separate assessments of genetic similarity.
With the discovery that phylogenetic
information is found in amino acid signa-
ture patterns, we also examined the signa-
ture patterns belonging to the dental pa-
tients' viruses. With the same reference set
and criteria employed in the definition of
the dentist's signature, unique signatures for
each of the dental patients' sets of viruses
were determined with the following results:
(i) patients A, B, and E have identical or
nearly identical signatures to that of the
dentist and (ii) patients C and G have
larger signatures, 15 and 14 residues, re-
spectively (A, I, G, V, A, D, R, E, V, V,
I, T, H, P, and V and A, I, A, G, A, D, V,
Y, E, V, V, I, H, and V). Nevertheless, the
signature from patient C's viruses is closer
to the dentist's viral sequences than to any
other sequences. The signature from pa-
tient G agrees best with a viral sequence
from patient C but next best to a dentist

Conclusion
In summary, seven HIV-infected patients
were identified in the practice of a dentist
with AIDS. Of these seven patients, five
had no identified risk for HIV infection and
had invasive procedures performed by the
dentist. These five patients were infected
with HIV strains that had nucleotide se-
quences and amino acid signature patterns
that were closely related to those of the
dentist's viruses. In addition, the HIV se-
quences of the dentist and these five pa-
tients were distinct from those found in the
two dental patients with known behavioral
risks for HIV infection and in 35 other
HIV-infected persons residing in the same
viral sequence. No LC sequences or refer-
ence set sequences were found to match as
many as 50% of the amino acids in the
signatures from patients A, B, C, E, and G.
Although the dentist was the most likely
source of the infection for the five patients,
all the patients were not necessarily infected
with each of the dentist's HIV variants. This
is evident upon inspection of the deduced
amino acid sequences, which demonstrate
two C2-V3 subtypes for the dentist (Dent-I
and Dent-Il in Fig. 2). Both the dentist's
subtypes are also present in patient A's viral
sequences (Pt-A-I and Pt-A-II). However,
sequences closer to Dent-I were found in
patients B and E, and sequences closer to
Dent-II were found in patients C and G.

Dent-I
Dent-II
Pt-A-I
Pt-A-II
Pt-B
Pt-c
Pt-E
Pt-6
Pt-D
Pt-F
LC1
LC2
LC3
LC4
LCS
LC6
LC7
LC8
LC9
LC1O
LCll
LC12
LC3
LCM4
LC1S
LC16
LC17
LC18
LC19
LC20
I C21
LC22
LC23

LC24
LC25
LC26
LC27
LC28
LC29
LC30
LC31
LU2
LC33
LC34
LC35
Fig. 2. Comparison among V3 region amino acid sequences
from 43 HIV-infected persons from
Florida. For the purpose of this figure only, consensus
sequences are shown. Because two distinct
sequence subtypes were present in the dentist and patient A, two
consensus sequences are shown
for the dentist (Dent-I and Dent-Il) and patient A (Pt-A-I and
Pt-A-Il). Sequences from the C2-V3
clone (n = 72) and direct (n = 41) sequences have been
deposited with GenBank (accession
numbers M90847 to M90906; M90914 to M90966). Sequences
from the V4-C3-V5 region have also
been deposited with GenBank (accession numbers M91084 to
M91 115; M91 121 to M91 149; and
M91 153 to M91 156). The reference sequence is Dent-I from
the dentist. Residues identical to Dent-I
are shown as a dash. Regions not sequenced are left blank. The
sequence stretch corresponding
to the V3 loop is indicated. Other symbols are ?, no consensus
amino acid at the position indicated;
*, noncontiguous amino acids of the dentist's signature pattern
(Table 2); *, a gap to maintain

alignment of the amino acids; and $, a stop codon. Single-letter
abbreviations for the amino acid
residues are: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H,
His; I, lie; K, Lys; L, Leu; M, Met; N,
Asn; P, Pro; Q, Gin; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and
Y, Tyr.
V3 loop ------------
LAEEMISAYTNIIIINAVI QIRPNFMHSPRFArEIIGDIR_AI
KHIPTZI II.NxTGGDEIVGNGEFFYC
-------- ---- ---- Y---R--- -Y--V----E----------KL-A-----V-.--.T --
---V--
______ ____________ --_-- ---- -_~~~~--K -?.-----------
------------------K--?-?-?--S------ ---K--------- -.----Q------ -.------
---------------------------------------dU---E--K----- -.---- ----
-E----------------------------------------Y-DR------------
---------------------- ---- -P----K----------K----L-U?--D--K-I-6--
K---?-.--V--EQHF
-----E------T---KE---I--------I------T---D----- - ----L-S----
---------S------N------K--N-T---- ---- -TS-P----K----------T-N-----
K--F---?-.--V------
------S------T----E-+---------- S-V-T--Q-- ---------L-S-K-----K---
.--V-KP---K-
------E--E---T--F-T-------S---K-D-------L-E----I-K-----.--Y--
-------------N---T----K------------- ??------------T------N-A-S-E--
K-IAF--.---YKV--
-----K----ES---T--- KE--T-- ------S-N-V-T-V-Q-VR------ GV-

?K^---K--R.--VKP---- --Ef
-------E--N---TT-----------------S----------T--D------------TL--D--
-K-I-R----K.S--V-K---------TT--------T--
----------T--- ---------- D--------Y--- K----------I.TV-Y-------PV--
L
------E----T---IKE -----S------ D----- --K-1---K-E-.-Y----------
-T----1- --- S---A--- -- ----------I-S- 1F -.T-TYAFQ-
-I-L------T---E--V------------------ K-RI-K--.N-----R-----T--------
G6--- D----T--T----K--------S----S-T-----T---YV-----------T--
DK-1-RK--G-ETK---EP----TT------ -TI
-----D----V-T------E^-V----------R-----------T----------A--KIVV-
.Y--------
------E------T------E-I-----------S-P-----------D------L-AT----K-I-
---------
--T---E-L-----T------I[EP- -- ---- ---- -- - 0------ ----Y-STF-----
E-A---EL---.
ET--------------I---- -v
N------VE----- ----------T------E------K-E--6-IS----K-TT-TLV
D------T-----V-----------RS-T- D----- ----------E-
-----E--N---T-L-----LS-K--RS---------- D---------0---K-I-I--_---
TT--A--K--------
------E-IS----T-----E--V------ ---PS--A ----------T-1-----E-----.T-
-V- R----
-----D--S---RT----E--V--------SRR-S------T-REG -------------fE-
ES--ICaI-E-G-K- .--V---------------
- ----E--T ----- S-----K-------------L--TA----KLI-D------.--V------
---T--T-----
----T-----T-- -----T--D--------T--E-K-IA----V--NT--V-------------
-----
----E--T--T---KDP--------------S-----------D- -A-----I-DIC-V---.-
--V------------T---------

mge_a4_study_q4.pdfORIGINAL RESEARCHpublished 12 Octobe.docx

mge_a4_study_q4.pdfORIGINAL RESEARCHpublished 12 Octobe.docx

Recommended

Recommended

More Related Content

Similar to mge_a4_study_q4.pdfORIGINAL RESEARCHpublished 12 Octobe.docx

Similar to mge_a4_study_q4.pdfORIGINAL RESEARCHpublished 12 Octobe.docx (20)

More from buffydtesurina

More from buffydtesurina (20)

Recently uploaded

Recently uploaded (20)

mge_a4_study_q4.pdfORIGINAL RESEARCHpublished 12 Octobe.docx