SlideShare a Scribd company logo
1 of 23
Sheet1FABRIC AND LINING COSTS PER YARDPOLY
JERSEY$ 1.50POLY WITH SPANDEX$ 1.80RAYON
JERSEY$ 1.30RAY JER WITH SPAN$ 1.80DENIM$
3.80CHIFFON$ 2.40NOVELTY FAB$ 4.20PRINTED
POLY/SPAN$ 2.80PRINTED RAY SPAN$ 2.50PRINTED
CHIFFON$ 3.40LINING$ 1.10ZIPPER$ 0.75BUTTONS$
0.25ELASTIC$ 0.50
BHS105A Biochemistry1 Assessment Brief
FINAL.Docx Page 1 of 7
ASSESSMENT BRIEF
Subject Code and Title BHS105 Biochemistry 1
Assessment Written report
Individual/Group Individual
Length 1500 words +/- 10%
Learning Outcomes
a) Discuss and interpret the relationship between the
structure and function of biomolecules.
b) Identify and explain the basic properties and
reactions of amines, aldehydes, carboxylic acids,
esters, and amides.
c) Describe the structure and function of
carbohydrates, proteins, amino acids, enzymes
and lipids.
d) By examining the literature, explain the structure
and function of nucleic acids and their roles in the
genetic code and protein synthesis.
e) By examining the literature, discuss genetic
expression, regulation and mutations including
mechanisms of DNA organisation and replication,
RNA synthesis, processing and metabolism.
f) Explain the structure of the biological membrane
and discuss the associated forms of transportation
g) Discuss the role of the cell membrane and
cytoskeleton in relationship to metabolic
processes including protein synthesis, intercellular
communication and hormonal regulation
Submission By 11:55pm AEST/AEDT Sunday of Week 10
Weighting 40%
Total Marks 100 marks
Context:
BHS105A Biochemistry1 Assessment Brief
FINAL.Docx Page 2 of 7
This assessment focuses on developing your understanding of
key concepts in Biochemistry related to
health science. You will develop a range of skills as you
research the various topics, including:
knowledge, understanding and research. You will be able to
exhibit your knowledge by applying the
principles and concepts in Biochemistry.
Instructions:
Length: PART A 250 words +/- 10%, PART B 850 words +/-
10%, PART C 400 words +/- 10%
Word count must be adhered to – otherwise penalties may
apply. Note that headings, in-text citations
and reference list are not included in the word limit.
This is a report to be written adhering to academic style. When
writing the report, label each section
as Part A, B and C and address the required questions. Label
each question with the appropriate
question number. You may include the question in your report,
but this will not form a part of the
word count. Please familiarize yourself with academic style
writing prior to writing this report.
The report should be submitted in a Word, 12 font (Arial or
Times New Roman) and 1.5 spacing
document. Reports should be submitted through the assessment
submission link on the class
Blackboard page. It is the student’s responsibility to ensure
reports are uploaded by the due date.
Information relating to each part of this assessment is as
follows:
PART A
scientific questions.
- 10%, each question is worth 4 marks
PART B
fic
information in an academic style
essay. Please refer to the assessment overview document for
guidelines.
- 10%
Referencing
-text
citations and a reference list
following the APA referencing style should be included. The
APA referencing guide can be
located in the Academic Writing Guide.
include journals, books, reputable
websites or videos. This part is worth 5 marks.
PART C
knowledge.
- 10%
Please refer to the marking rubric to ensure you address all the
assessment criteria
BHS105A Biochemistry1 Assessment Brief
FINAL.Docx Page 3 of 7
PART A – Reasoning 250 words +/- 10%
1. Pyrimidine plays a vital role in the efficient functioning of
the body. Discuss the chemical
classification and significance of pyrimidine relating to the
human body. (4 marks)
2. The boiling points of ethanol and ethanal are 78.37°C and
20.2°C respectively. Explain the
reason for this variation in the boiling points of these two
compounds with similar molecular
weights. Discuss intermolecular attractions between the
molecules to support your answer.
(4 marks)
3. Stearic acid and oleic acid are both long chain carboxylic
acids with 18 carbon atoms.
However, there is a large difference in the melting points of
these fatty acids. Stearic acid
(18:0) melts at 70°C and oleic acid (18:1) melts at 16°C.
Explain why there is such a large
difference in the melting points of these fatty acids. (4
marks)
4. Assume that you are a chemist trying to prepare butyl
ethanoate, a flavouring agent used
in the manufacture of ice-cream and candy. Identify the
functional group in butyl ethanoate.
State the name of the reaction and the reactants that can be used
to synthesize this
compound. (4 marks)
PART B – Essay 850 words +/- 10%
Carbohydrates, proteins and lipids play a vital role in the
efficient functioning of the human
body. Discuss the major functions of carbohydrates, proteins
and lipids with an emphasis on
their role in maintaining the structure of cell membrane. (40
marks)
PART C – Application 400 words +/- 10%
1. The antibacterial activity of penicillin is related to the
inhibition of a key bacterial enzyme.
Explain this mechanism of enzyme inhibition. (5 marks)
2. Sequence 1 and sequence 2 are short sequences of DNA with
a message. To decipher the
message, you will need to first transcribe and then translate the
sequences. Using the single
letter code of each amino acid obtained upon translating the
sequence, crack the message
contained. Please note that there are only 20 amino acids.
Therefore, you may need to insert
any/all of the letters B, J, O, U, X, Z to complete the message.
(5 marks)
DNA Sequence 1: 3'-
TAAAATCAGCTCTAGACGGTACTCTACTAGTCATGGTCCA
TG- 5'
DNA Sequence 2: 3'-
CGGGGGCGGTAGTCCTCAACCTAGTGGGTGTGG- 5'
BHS105A Biochemistry1 Assessment Brief
FINAL.Docx Page 4 of 7
3. A part of the DNA sequence of normal hemoglobin and sickle
cell hemoglobin are shown
below. Using your knowledge of transcription and translation,
determine the mRNA and
amino acid sequence for both normal and sickle cell
haemoglobin DNA.
Normal hemoglobin DNA C A C G T G G A C T G A G
G A C T C C T C T T C
Sickle cell hemoglobin DNA C A C G T G G A C T G A G
G A C A C C T C T T C
Comment on the difference between the amino acid sequences
obtained and state if this
difference would affect the role of haemoglobin as an oxygen
carrying protein. (5 marks)
4. State whether the following compounds are present in DNA
or RNA or both.
(5 marks)
a) Guanine
b) Adenine
c) Thymine
d) Cytosine
e) 2-deoxy-D-ribose
f) D-ribose
g) Uracil
5. A part of the aminoacid sequence in Cytochrome-C protein
from 6 different species is given
in the table. Rank the organisms from 1 to 5 according to the
similarity of the organism to
human: based on the similarity between the cytochrome C
aminoacid sequences, 1 being the
closest to human. It is largely agreed that the greater the
number of amino acid (or
nucleotide) differences between a given pair of organisms, the
further apart they are in
evolution. On the other hand, if two organisms show very few
differences, they are likely to
be closely related. With the given information in the table and
your ranking of organisms, do
you think this ranking gives definite information on how further
apart the organisms are in
evolution? Why/why not? (5 marks)
Human DVEKGKKIFIM
Silkworm moth NAENGKKIFVQ
Chicken DIEKGKKIFVQ
Rhesus monkey DVEKGKKIFIM
Bullfrog DVEKGKKIFVQ
Tuna DVAKGKKTFVQ
BHS105A Biochemistry1 Assessment Brief
FINAL.Docx Page 5 of 7
6. Complete the following questions using the given double
stranded DNA (14 marks)
Double stranded DNA:
5' - ATGTACGCTACTTGA - 3'
3' - TACATGCGATGAACT -5'
a) Identify the coding strand and the template strand in the
given double stranded DNA.
b) Determine the sequence of mRNA obtained from the
transcription of the DNA strand.
c) Determine the anticodons of tRNA required to translate the
mRNA codons.
d) Using the genetic code, identify the sequence of amino acids
obtained upon translation
of the mRNA.
NOTE: Please refer to Bettelheim, F.A., Brown, W.H.,
Campbell, M.K., & Farell, S.O. (2013).
Introduction to General, Organic, and Biochemistry (11th ed.).
USA: Brookes/Cole, Cengage
Learning for the genetic code and single letter code of amino
acids.
BHS105A Biochemistry1 Assessment brief FINAL.docx
Page 6 of 7
Assessment Attributes
Fail
(0-49%)
Pass
(50-64%)
Credit
(65-74)
Distinction
(75-84%)
High Distinction
(85-100%)
Grade Description A Fail grade will be awarded if a student is
unable to
demonstrate satisfactory academic performance in
the subject or has failed to complete the required
assessment points. Use of the academic referencing
system is not evident.
Pass is awarded for work
showing a satisfactory
achievement of all learning
outcomes and an adequate
understanding of theory and
application of skills. Use of the
academic referencing system is
evident.
Credit is awarded for work
showing a more than
satisfactory achievement of all
learning outcomes and a more
than adequate understanding
of theory and application of
skills. Competent use of the
recommended academic
referencing system.
Distinction is awarded for
work of superior quality
in achieving all learning
outcomes and a superior
integration and
understanding of theory
and application of skills.
Evidence of in-depth
relevant research,
reading, analysis and
evaluation is
demonstrated. The
recommended academic
referencing system is
used consistently and
accurately with minimal
errors.
High Distinction is awarded
for outstanding quality in
achieving all learning
outcomes together with
outstanding integration and
understanding of theory and
application of skills. Evidence
of in-depth relevant research,
reading, analysis, original and
creative thought is
demonstrated. The
recommended academic
referencing system is used
consistently and accurately at
all times.
PART A
16 marks
0 - 8 8.1– 10 10.1 – 12 12.1– 14 14.1 – 16
Knowledge and
understanding
Limited understanding of required concepts and
knowledge. Shows inadequate knowledge of topics to
meet learning outcomes.
Basic understanding of required
concepts and knowledge.
Shows adequate knowledge to
meet the learning outcomes.
Thorough knowledge and
understanding of required
concepts. Demonstrates
capacity to explain and apply
relevant concepts to meet
learning outcomes.
Highly developed
knowledge and
understanding of required
concepts. Well
demonstrated capacity to
explain and apply relevant
concepts.
Sophisticated knowledge and
understanding of required
concepts. Demonstrates an
excellent capacity to explain
and apply relevant concepts
to meet learning outcomes.
PART B
40 marks
0 – 20 20.1 – 25 25.1 – 30 30.1 – 35 35.1 – 40
0 –1.25 1.3-1.5 1.6-1.75 1.8-2 2.1 – 2.5
Introduction Introduction not very clear or evident. Limited
introduction present.
Introduction provides
background information on the
topic, but does not provide an
outline.
Introduction provides
background information on the
topic. A brief outline is
described.
Introduction provides
background information
on the topic. A clear
outline is described.
Introduction provides a
concise background to the
chosen topic; engages and
orients the reader creating
strong interest.
0 –1.25 1.3-1.5 1.6-1.75 1.8-2 2.1 – 2.5
Conclusion Conclusion not evident. Limited conclusion
present.
Minimal discussion regarding
essay content.
Conclusion is evident and
briefly covers most content
discussed in the essay.
Conclusion is well
structured, reviews
majority of relevant
points. No new material is
introduced in conclusion.
The concluding statement is
concise, well-structured and
briefly reviews all relevant
points and provides a strong
parting statement. No new
BHS105A Biochemistry1 Assessment brief FINAL.docx
Page 7 of 7
material is introduced in
conclusion.
5 marks 0 –2.5 2.6-3 3.1-3.5 3.6-4.3 4.4 – 5
Use of academic and
discipline conventions
Poorly written not adhering to academic style writing,
with errors in spelling and grammar. Chemical
equations/symbols are not presented in the correct
format.
Adequately written adhering to
academic style writing. Some
spelling and grammatical errors.
Some information is not always
explicit or well written. Some
chemical equations/symbols are
not presented in the correct
format.
Well written adhering to
academic style writing. Almost
no spelling and grammatical
errors. Almost all information is
explicit and well written.
Almost all chemical
equations/symbols are
presented in the correct format.
Very well written
adhering to academic
style writing. No spelling
or grammatical mistakes.
All information is explicit
and very well written. All
chemical
equations/symbols are
presented in the correct
format.
Expertly written adhering to
academic style writing.
demonstrating use of high
quality language and written
expression. All chemical
symbols/equations are
presented in the correct
format.
30 marks 0 – 15 15.1 – 19 19.1– 22 22.1 – 25 25.1 – 30
Knowledge and
understanding
Limited understanding of required concepts and
knowledge. Shows inadequate knowledge of topics to
meet learning outcomes.
Basic understanding of required
concepts and knowledge.
Shows adequate knowledge to
meet the learning outcomes.
Thorough knowledge and
understanding of required
concepts. Demonstrates
capacity to explain and apply
relevant concepts to meet
learning outcomes.
Highly developed
knowledge and
understanding of required
concepts. Well
demonstrated capacity to
explain and apply relevant
concepts.
Sophisticated knowledge and
understanding of required
concepts. Demonstrates an
excellent capacity to explain
and apply relevant concepts
to meet learning outcomes.
5 marks 0 –2.5 2.6-3 3.1-3.5 3.6-4.3 4.4 – 5
Referencing
(Part A and Part B)
Minimal or no attempt made at referencing and use of
appropriate APA style guidelines.
Attempt made at referencing
using appropriate APA style
guidelines but not adequate.
Good referencing using
appropriate APA style
guidelines but with some
inconsistencies.
Very good referencing
using appropriate APA
style guidelines with no
mistakes.
Excellent referencing, of a
variety of high quality sources
with appropriate APA style
guidelines with no mistakes.
PART C
39 marks
0 – 19.5 19.6 – 25 25.1 – 30 30.1 – 35 35.1 – 39
Knowledge and
understanding
Limited understanding of required concepts and
knowledge. Shows inadequate knowledge of topics to
meet learning outcomes.
Basic understanding of required
concepts and knowledge.
Shows adequate knowledge to
meet the learning outcomes.
Thorough knowledge and
understanding of required
concepts. Demonstrates
capacity to explain and apply
relevant concepts to meet
learning outcomes.
Highly developed
knowledge and
understanding of required
concepts. Well
demonstrated capacity to
explain and apply relevant
concepts.
Sophisticated knowledge and
understanding of required
concepts. Demonstrates an
excellent capacity to explain
and apply relevant concepts
to meet learning outcomes.
Sheet1ESTIMATED YARDAGES:TANK TOP0.50SS T-
SHIRT0.603/4 SLV, LNG SLV T-SHIRT0.853/4 SLV, LNG
SLV BLOUSE1.00SHORT SLIM SKIRT0.80LONG SLIM
SKIRT1.20MIDI SLIM SKIRT0.90A LINE SHORT
SKIRT1.40A LINE LONG SKIRT1.65SHORT SLIM
DRESS1.00LONG SLIM DRESS1.40MIDI SLIM DRESS1.20A
LINE SHORT DRESS2.00A LINE LONG
DRESS2.50JACKET3.50PANTS-WIDE LEG1.85PANTS -
SLIM1.40SHORTS1.00
Sheet1COST SHEET:YDGCOST PER
YDDESCRIPTIONTOTAL FAB 1$ - 0FAB 2$ - 0LINING$
- 0TOTAL FAB$ - 0TRIM 1$ - 0TRIM 2$ - 0OTHER$ -
0HANGARS, BAGS, TAGS$ 0.50TOTAL TRIM$
0.50CUTTING$ 1.00LABOR$ 6.50LOAD$ 1.00TOTAL
LABOR$ 8.50TOTAL COSTSELLING PRICE$ - 0RETAIL
PRICE$ - 0

More Related Content

Similar to Sheet1FABRIC AND LINING COSTS PER YARDPOLY JERSEY$ 1.50POLY WITH.docx

2015 bioinformatics protein_structure_wimvancriekinge
2015 bioinformatics protein_structure_wimvancriekinge2015 bioinformatics protein_structure_wimvancriekinge
2015 bioinformatics protein_structure_wimvancriekingeProf. Wim Van Criekinge
 
Ap03 sg biology_26426
Ap03 sg biology_26426Ap03 sg biology_26426
Ap03 sg biology_26426sbarkanic
 
Proteomics a search tool for vaccines
Proteomics a search tool for vaccinesProteomics a search tool for vaccines
Proteomics a search tool for vaccinesLawrence Okoror
 
Biochemistry and Cell biology-Final-Eng.doc
Biochemistry and Cell biology-Final-Eng.docBiochemistry and Cell biology-Final-Eng.doc
Biochemistry and Cell biology-Final-Eng.doctuannguyen010700
 
Chemistry hl human biochemistry option self study guide
Chemistry hl human biochemistry option self study guideChemistry hl human biochemistry option self study guide
Chemistry hl human biochemistry option self study guidetwhite25
 
Bio110 practice problems chap3 part4
Bio110 practice problems chap3 part4Bio110 practice problems chap3 part4
Bio110 practice problems chap3 part4Evan Lau
 
Essential Biology 3.5 Transcription & Translation (Core)
Essential Biology 3.5 Transcription & Translation (Core)Essential Biology 3.5 Transcription & Translation (Core)
Essential Biology 3.5 Transcription & Translation (Core)Stephen Taylor
 
ASSIGNMENT 08SC160 Basic BiologyDirections Be sure to save a.docx
ASSIGNMENT 08SC160 Basic BiologyDirections  Be sure to save a.docxASSIGNMENT 08SC160 Basic BiologyDirections  Be sure to save a.docx
ASSIGNMENT 08SC160 Basic BiologyDirections Be sure to save a.docxfredharris32
 
Essential Biology 04.1 Chromosomes, Genes, Alleles, Mutations
Essential Biology 04.1   Chromosomes, Genes, Alleles, MutationsEssential Biology 04.1   Chromosomes, Genes, Alleles, Mutations
Essential Biology 04.1 Chromosomes, Genes, Alleles, MutationsStephen Taylor
 
1PhylogeneticAnalysisHomeworkassignmentThisa.docx
1PhylogeneticAnalysisHomeworkassignmentThisa.docx1PhylogeneticAnalysisHomeworkassignmentThisa.docx
1PhylogeneticAnalysisHomeworkassignmentThisa.docxfelicidaddinwoodie
 
ONCAMPUS MARK SCHEME for UFP Skills for Bus CSR EssayCorporate Soc.docx
ONCAMPUS MARK SCHEME for UFP Skills for Bus CSR EssayCorporate Soc.docxONCAMPUS MARK SCHEME for UFP Skills for Bus CSR EssayCorporate Soc.docx
ONCAMPUS MARK SCHEME for UFP Skills for Bus CSR EssayCorporate Soc.docxcherishwinsland
 
Essential Biology 10.3 Polygenic Inhertance (AHL)
Essential Biology 10.3 Polygenic Inhertance (AHL)Essential Biology 10.3 Polygenic Inhertance (AHL)
Essential Biology 10.3 Polygenic Inhertance (AHL)Stephen Taylor
 
Main Exam Applied biochemistry final year
Main Exam Applied biochemistry final yearMain Exam Applied biochemistry final year
Main Exam Applied biochemistry final yearmarwaahmad357
 
Life sciences p1 feb march 2013 version 1 eng
Life sciences p1 feb march 2013 version 1 engLife sciences p1 feb march 2013 version 1 eng
Life sciences p1 feb march 2013 version 1 engElizabeth Sweatman
 
ENV 420 Entire Course NEW
ENV 420 Entire Course NEWENV 420 Entire Course NEW
ENV 420 Entire Course NEWshyamuopeight
 
Life sciences gr 12 exam guide 2014 eng
Life sciences gr 12 exam guide 2014 engLife sciences gr 12 exam guide 2014 eng
Life sciences gr 12 exam guide 2014 engElizabeth Sweatman
 
Computation and System Biology Assignment Help
Computation and System Biology Assignment HelpComputation and System Biology Assignment Help
Computation and System Biology Assignment HelpNursing Assignment Help
 
CINF 51: Analyzing success rates of supposedly 'easy' reactions
CINF 51: Analyzing success rates of supposedly 'easy' reactionsCINF 51: Analyzing success rates of supposedly 'easy' reactions
CINF 51: Analyzing success rates of supposedly 'easy' reactionsNextMove Software
 
5090 biology example_candidate_responses_booklet_2014 (1)
5090 biology example_candidate_responses_booklet_2014 (1)5090 biology example_candidate_responses_booklet_2014 (1)
5090 biology example_candidate_responses_booklet_2014 (1)Balakrishnan Marappan
 

Similar to Sheet1FABRIC AND LINING COSTS PER YARDPOLY JERSEY$ 1.50POLY WITH.docx (20)

2015 bioinformatics protein_structure_wimvancriekinge
2015 bioinformatics protein_structure_wimvancriekinge2015 bioinformatics protein_structure_wimvancriekinge
2015 bioinformatics protein_structure_wimvancriekinge
 
Ap03 sg biology_26426
Ap03 sg biology_26426Ap03 sg biology_26426
Ap03 sg biology_26426
 
Proteomics a search tool for vaccines
Proteomics a search tool for vaccinesProteomics a search tool for vaccines
Proteomics a search tool for vaccines
 
Biochemistry and Cell biology-Final-Eng.doc
Biochemistry and Cell biology-Final-Eng.docBiochemistry and Cell biology-Final-Eng.doc
Biochemistry and Cell biology-Final-Eng.doc
 
Chemistry hl human biochemistry option self study guide
Chemistry hl human biochemistry option self study guideChemistry hl human biochemistry option self study guide
Chemistry hl human biochemistry option self study guide
 
Bio110 practice problems chap3 part4
Bio110 practice problems chap3 part4Bio110 practice problems chap3 part4
Bio110 practice problems chap3 part4
 
Essential Biology 3.5 Transcription & Translation (Core)
Essential Biology 3.5 Transcription & Translation (Core)Essential Biology 3.5 Transcription & Translation (Core)
Essential Biology 3.5 Transcription & Translation (Core)
 
ASSIGNMENT 08SC160 Basic BiologyDirections Be sure to save a.docx
ASSIGNMENT 08SC160 Basic BiologyDirections  Be sure to save a.docxASSIGNMENT 08SC160 Basic BiologyDirections  Be sure to save a.docx
ASSIGNMENT 08SC160 Basic BiologyDirections Be sure to save a.docx
 
Essential Biology 04.1 Chromosomes, Genes, Alleles, Mutations
Essential Biology 04.1   Chromosomes, Genes, Alleles, MutationsEssential Biology 04.1   Chromosomes, Genes, Alleles, Mutations
Essential Biology 04.1 Chromosomes, Genes, Alleles, Mutations
 
1PhylogeneticAnalysisHomeworkassignmentThisa.docx
1PhylogeneticAnalysisHomeworkassignmentThisa.docx1PhylogeneticAnalysisHomeworkassignmentThisa.docx
1PhylogeneticAnalysisHomeworkassignmentThisa.docx
 
ONCAMPUS MARK SCHEME for UFP Skills for Bus CSR EssayCorporate Soc.docx
ONCAMPUS MARK SCHEME for UFP Skills for Bus CSR EssayCorporate Soc.docxONCAMPUS MARK SCHEME for UFP Skills for Bus CSR EssayCorporate Soc.docx
ONCAMPUS MARK SCHEME for UFP Skills for Bus CSR EssayCorporate Soc.docx
 
Essential Biology 10.3 Polygenic Inhertance (AHL)
Essential Biology 10.3 Polygenic Inhertance (AHL)Essential Biology 10.3 Polygenic Inhertance (AHL)
Essential Biology 10.3 Polygenic Inhertance (AHL)
 
Main Exam Applied biochemistry final year
Main Exam Applied biochemistry final yearMain Exam Applied biochemistry final year
Main Exam Applied biochemistry final year
 
2 (1)
2 (1)2 (1)
2 (1)
 
Life sciences p1 feb march 2013 version 1 eng
Life sciences p1 feb march 2013 version 1 engLife sciences p1 feb march 2013 version 1 eng
Life sciences p1 feb march 2013 version 1 eng
 
ENV 420 Entire Course NEW
ENV 420 Entire Course NEWENV 420 Entire Course NEW
ENV 420 Entire Course NEW
 
Life sciences gr 12 exam guide 2014 eng
Life sciences gr 12 exam guide 2014 engLife sciences gr 12 exam guide 2014 eng
Life sciences gr 12 exam guide 2014 eng
 
Computation and System Biology Assignment Help
Computation and System Biology Assignment HelpComputation and System Biology Assignment Help
Computation and System Biology Assignment Help
 
CINF 51: Analyzing success rates of supposedly 'easy' reactions
CINF 51: Analyzing success rates of supposedly 'easy' reactionsCINF 51: Analyzing success rates of supposedly 'easy' reactions
CINF 51: Analyzing success rates of supposedly 'easy' reactions
 
5090 biology example_candidate_responses_booklet_2014 (1)
5090 biology example_candidate_responses_booklet_2014 (1)5090 biology example_candidate_responses_booklet_2014 (1)
5090 biology example_candidate_responses_booklet_2014 (1)
 

More from bjohn46

Sheet1Rate your skills using the following scaleChapter 1 You Ma.docx
Sheet1Rate your skills using the following scaleChapter 1 You Ma.docxSheet1Rate your skills using the following scaleChapter 1 You Ma.docx
Sheet1Rate your skills using the following scaleChapter 1 You Ma.docxbjohn46
 
Sheet1Quarter Sales PersonRegionQuarterly Sales31-MarSmithEast$750.docx
Sheet1Quarter Sales PersonRegionQuarterly Sales31-MarSmithEast$750.docxSheet1Quarter Sales PersonRegionQuarterly Sales31-MarSmithEast$750.docx
Sheet1Quarter Sales PersonRegionQuarterly Sales31-MarSmithEast$750.docxbjohn46
 
Sheet1project codeproject nameEmployeesQB280001Account Management .docx
Sheet1project codeproject nameEmployeesQB280001Account Management .docxSheet1project codeproject nameEmployeesQB280001Account Management .docx
Sheet1project codeproject nameEmployeesQB280001Account Management .docxbjohn46
 
Sheet1Quantity (miles of pipeline)Total CostTotal Fixed CostTotal .docx
Sheet1Quantity (miles of pipeline)Total CostTotal Fixed CostTotal .docxSheet1Quantity (miles of pipeline)Total CostTotal Fixed CostTotal .docx
Sheet1Quantity (miles of pipeline)Total CostTotal Fixed CostTotal .docxbjohn46
 
Sheet1Pro Forma Income StatementYear 1Year 2Year 3Year 4Year 5Visi.docx
Sheet1Pro Forma Income StatementYear 1Year 2Year 3Year 4Year 5Visi.docxSheet1Pro Forma Income StatementYear 1Year 2Year 3Year 4Year 5Visi.docx
Sheet1Pro Forma Income StatementYear 1Year 2Year 3Year 4Year 5Visi.docxbjohn46
 
Sheet1PMGT 576 Assignment Rubric – Unit 8 Assignment20Is the Lean .docx
Sheet1PMGT 576 Assignment Rubric – Unit 8 Assignment20Is the Lean .docxSheet1PMGT 576 Assignment Rubric – Unit 8 Assignment20Is the Lean .docx
Sheet1PMGT 576 Assignment Rubric – Unit 8 Assignment20Is the Lean .docxbjohn46
 
Sheet1Presentation by Tony StudentSlide NumberSlide TitleSlide Tex.docx
Sheet1Presentation by Tony StudentSlide NumberSlide TitleSlide Tex.docxSheet1Presentation by Tony StudentSlide NumberSlide TitleSlide Tex.docx
Sheet1Presentation by Tony StudentSlide NumberSlide TitleSlide Tex.docxbjohn46
 
Sheet1Pretax IncomeYang, Ziyun make sure to add back income t.docx
Sheet1Pretax IncomeYang, Ziyun make sure to add back income t.docxSheet1Pretax IncomeYang, Ziyun make sure to add back income t.docx
Sheet1Pretax IncomeYang, Ziyun make sure to add back income t.docxbjohn46
 
Sheet1PMGT 576 Assignment Rubric – Unit 7 Assignment20Are all of t.docx
Sheet1PMGT 576 Assignment Rubric – Unit 7 Assignment20Are all of t.docxSheet1PMGT 576 Assignment Rubric – Unit 7 Assignment20Are all of t.docx
Sheet1PMGT 576 Assignment Rubric – Unit 7 Assignment20Are all of t.docxbjohn46
 
Sheet1Plan APlan BPro Forma Income Statement AccountsEBIT700100013.docx
Sheet1Plan APlan BPro Forma Income Statement AccountsEBIT700100013.docxSheet1Plan APlan BPro Forma Income Statement AccountsEBIT700100013.docx
Sheet1Plan APlan BPro Forma Income Statement AccountsEBIT700100013.docxbjohn46
 
Sheet1Phase of Business Financal Management needsDebt FinancingEq.docx
Sheet1Phase of Business Financal Management needsDebt FinancingEq.docxSheet1Phase of Business Financal Management needsDebt FinancingEq.docx
Sheet1Phase of Business Financal Management needsDebt FinancingEq.docxbjohn46
 
Sheet1PeriodEngine Failures(a) 4-period moving average(b) weighted.docx
Sheet1PeriodEngine Failures(a) 4-period moving average(b) weighted.docxSheet1PeriodEngine Failures(a) 4-period moving average(b) weighted.docx
Sheet1PeriodEngine Failures(a) 4-period moving average(b) weighted.docxbjohn46
 
Sheet1Participant#Verbal Label Condition (Smashed or Hit)Age Condi.docx
Sheet1Participant#Verbal Label Condition (Smashed or Hit)Age Condi.docxSheet1Participant#Verbal Label Condition (Smashed or Hit)Age Condi.docx
Sheet1Participant#Verbal Label Condition (Smashed or Hit)Age Condi.docxbjohn46
 
Sheet1No.Strengths (3)Weaknesses (2)Recommendations (2)Evidence (u.docx
Sheet1No.Strengths (3)Weaknesses (2)Recommendations (2)Evidence (u.docxSheet1No.Strengths (3)Weaknesses (2)Recommendations (2)Evidence (u.docx
Sheet1No.Strengths (3)Weaknesses (2)Recommendations (2)Evidence (u.docxbjohn46
 
Sheet1Moisture content analysis final resultsGroupValue of m3 (g)A.docx
Sheet1Moisture content analysis final resultsGroupValue of m3 (g)A.docxSheet1Moisture content analysis final resultsGroupValue of m3 (g)A.docx
Sheet1Moisture content analysis final resultsGroupValue of m3 (g)A.docxbjohn46
 
Sheet1ManhattanBrooklynQueensThe BronxStaten IslandEducationMarita.docx
Sheet1ManhattanBrooklynQueensThe BronxStaten IslandEducationMarita.docxSheet1ManhattanBrooklynQueensThe BronxStaten IslandEducationMarita.docx
Sheet1ManhattanBrooklynQueensThe BronxStaten IslandEducationMarita.docxbjohn46
 
Sheet1Learning Solultions NameVersion NumberMediumTypeLessonSc.docx
Sheet1Learning Solultions NameVersion NumberMediumTypeLessonSc.docxSheet1Learning Solultions NameVersion NumberMediumTypeLessonSc.docx
Sheet1Learning Solultions NameVersion NumberMediumTypeLessonSc.docxbjohn46
 
Sheet1LMH10090H80M70L605040302010NumberRisk NameFull Risk CostRisk.docx
Sheet1LMH10090H80M70L605040302010NumberRisk NameFull Risk CostRisk.docxSheet1LMH10090H80M70L605040302010NumberRisk NameFull Risk CostRisk.docx
Sheet1LMH10090H80M70L605040302010NumberRisk NameFull Risk CostRisk.docxbjohn46
 
Sheet1Item Price# of ItemsTotal PriceCups$1.896$11.34Plates$1.506$.docx
Sheet1Item Price# of ItemsTotal PriceCups$1.896$11.34Plates$1.506$.docxSheet1Item Price# of ItemsTotal PriceCups$1.896$11.34Plates$1.506$.docx
Sheet1Item Price# of ItemsTotal PriceCups$1.896$11.34Plates$1.506$.docxbjohn46
 
Sheet1In_OutAustralian_CityInternational_CityAirlineRoutePort_Coun.docx
Sheet1In_OutAustralian_CityInternational_CityAirlineRoutePort_Coun.docxSheet1In_OutAustralian_CityInternational_CityAirlineRoutePort_Coun.docx
Sheet1In_OutAustralian_CityInternational_CityAirlineRoutePort_Coun.docxbjohn46
 

More from bjohn46 (20)

Sheet1Rate your skills using the following scaleChapter 1 You Ma.docx
Sheet1Rate your skills using the following scaleChapter 1 You Ma.docxSheet1Rate your skills using the following scaleChapter 1 You Ma.docx
Sheet1Rate your skills using the following scaleChapter 1 You Ma.docx
 
Sheet1Quarter Sales PersonRegionQuarterly Sales31-MarSmithEast$750.docx
Sheet1Quarter Sales PersonRegionQuarterly Sales31-MarSmithEast$750.docxSheet1Quarter Sales PersonRegionQuarterly Sales31-MarSmithEast$750.docx
Sheet1Quarter Sales PersonRegionQuarterly Sales31-MarSmithEast$750.docx
 
Sheet1project codeproject nameEmployeesQB280001Account Management .docx
Sheet1project codeproject nameEmployeesQB280001Account Management .docxSheet1project codeproject nameEmployeesQB280001Account Management .docx
Sheet1project codeproject nameEmployeesQB280001Account Management .docx
 
Sheet1Quantity (miles of pipeline)Total CostTotal Fixed CostTotal .docx
Sheet1Quantity (miles of pipeline)Total CostTotal Fixed CostTotal .docxSheet1Quantity (miles of pipeline)Total CostTotal Fixed CostTotal .docx
Sheet1Quantity (miles of pipeline)Total CostTotal Fixed CostTotal .docx
 
Sheet1Pro Forma Income StatementYear 1Year 2Year 3Year 4Year 5Visi.docx
Sheet1Pro Forma Income StatementYear 1Year 2Year 3Year 4Year 5Visi.docxSheet1Pro Forma Income StatementYear 1Year 2Year 3Year 4Year 5Visi.docx
Sheet1Pro Forma Income StatementYear 1Year 2Year 3Year 4Year 5Visi.docx
 
Sheet1PMGT 576 Assignment Rubric – Unit 8 Assignment20Is the Lean .docx
Sheet1PMGT 576 Assignment Rubric – Unit 8 Assignment20Is the Lean .docxSheet1PMGT 576 Assignment Rubric – Unit 8 Assignment20Is the Lean .docx
Sheet1PMGT 576 Assignment Rubric – Unit 8 Assignment20Is the Lean .docx
 
Sheet1Presentation by Tony StudentSlide NumberSlide TitleSlide Tex.docx
Sheet1Presentation by Tony StudentSlide NumberSlide TitleSlide Tex.docxSheet1Presentation by Tony StudentSlide NumberSlide TitleSlide Tex.docx
Sheet1Presentation by Tony StudentSlide NumberSlide TitleSlide Tex.docx
 
Sheet1Pretax IncomeYang, Ziyun make sure to add back income t.docx
Sheet1Pretax IncomeYang, Ziyun make sure to add back income t.docxSheet1Pretax IncomeYang, Ziyun make sure to add back income t.docx
Sheet1Pretax IncomeYang, Ziyun make sure to add back income t.docx
 
Sheet1PMGT 576 Assignment Rubric – Unit 7 Assignment20Are all of t.docx
Sheet1PMGT 576 Assignment Rubric – Unit 7 Assignment20Are all of t.docxSheet1PMGT 576 Assignment Rubric – Unit 7 Assignment20Are all of t.docx
Sheet1PMGT 576 Assignment Rubric – Unit 7 Assignment20Are all of t.docx
 
Sheet1Plan APlan BPro Forma Income Statement AccountsEBIT700100013.docx
Sheet1Plan APlan BPro Forma Income Statement AccountsEBIT700100013.docxSheet1Plan APlan BPro Forma Income Statement AccountsEBIT700100013.docx
Sheet1Plan APlan BPro Forma Income Statement AccountsEBIT700100013.docx
 
Sheet1Phase of Business Financal Management needsDebt FinancingEq.docx
Sheet1Phase of Business Financal Management needsDebt FinancingEq.docxSheet1Phase of Business Financal Management needsDebt FinancingEq.docx
Sheet1Phase of Business Financal Management needsDebt FinancingEq.docx
 
Sheet1PeriodEngine Failures(a) 4-period moving average(b) weighted.docx
Sheet1PeriodEngine Failures(a) 4-period moving average(b) weighted.docxSheet1PeriodEngine Failures(a) 4-period moving average(b) weighted.docx
Sheet1PeriodEngine Failures(a) 4-period moving average(b) weighted.docx
 
Sheet1Participant#Verbal Label Condition (Smashed or Hit)Age Condi.docx
Sheet1Participant#Verbal Label Condition (Smashed or Hit)Age Condi.docxSheet1Participant#Verbal Label Condition (Smashed or Hit)Age Condi.docx
Sheet1Participant#Verbal Label Condition (Smashed or Hit)Age Condi.docx
 
Sheet1No.Strengths (3)Weaknesses (2)Recommendations (2)Evidence (u.docx
Sheet1No.Strengths (3)Weaknesses (2)Recommendations (2)Evidence (u.docxSheet1No.Strengths (3)Weaknesses (2)Recommendations (2)Evidence (u.docx
Sheet1No.Strengths (3)Weaknesses (2)Recommendations (2)Evidence (u.docx
 
Sheet1Moisture content analysis final resultsGroupValue of m3 (g)A.docx
Sheet1Moisture content analysis final resultsGroupValue of m3 (g)A.docxSheet1Moisture content analysis final resultsGroupValue of m3 (g)A.docx
Sheet1Moisture content analysis final resultsGroupValue of m3 (g)A.docx
 
Sheet1ManhattanBrooklynQueensThe BronxStaten IslandEducationMarita.docx
Sheet1ManhattanBrooklynQueensThe BronxStaten IslandEducationMarita.docxSheet1ManhattanBrooklynQueensThe BronxStaten IslandEducationMarita.docx
Sheet1ManhattanBrooklynQueensThe BronxStaten IslandEducationMarita.docx
 
Sheet1Learning Solultions NameVersion NumberMediumTypeLessonSc.docx
Sheet1Learning Solultions NameVersion NumberMediumTypeLessonSc.docxSheet1Learning Solultions NameVersion NumberMediumTypeLessonSc.docx
Sheet1Learning Solultions NameVersion NumberMediumTypeLessonSc.docx
 
Sheet1LMH10090H80M70L605040302010NumberRisk NameFull Risk CostRisk.docx
Sheet1LMH10090H80M70L605040302010NumberRisk NameFull Risk CostRisk.docxSheet1LMH10090H80M70L605040302010NumberRisk NameFull Risk CostRisk.docx
Sheet1LMH10090H80M70L605040302010NumberRisk NameFull Risk CostRisk.docx
 
Sheet1Item Price# of ItemsTotal PriceCups$1.896$11.34Plates$1.506$.docx
Sheet1Item Price# of ItemsTotal PriceCups$1.896$11.34Plates$1.506$.docxSheet1Item Price# of ItemsTotal PriceCups$1.896$11.34Plates$1.506$.docx
Sheet1Item Price# of ItemsTotal PriceCups$1.896$11.34Plates$1.506$.docx
 
Sheet1In_OutAustralian_CityInternational_CityAirlineRoutePort_Coun.docx
Sheet1In_OutAustralian_CityInternational_CityAirlineRoutePort_Coun.docxSheet1In_OutAustralian_CityInternational_CityAirlineRoutePort_Coun.docx
Sheet1In_OutAustralian_CityInternational_CityAirlineRoutePort_Coun.docx
 

Recently uploaded

ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptx
ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptxECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptx
ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptxiammrhaywood
 
How to do quick user assign in kanban in Odoo 17 ERP
How to do quick user assign in kanban in Odoo 17 ERPHow to do quick user assign in kanban in Odoo 17 ERP
How to do quick user assign in kanban in Odoo 17 ERPCeline George
 
Alper Gobel In Media Res Media Component
Alper Gobel In Media Res Media ComponentAlper Gobel In Media Res Media Component
Alper Gobel In Media Res Media ComponentInMediaRes1
 
Hierarchy of management that covers different levels of management
Hierarchy of management that covers different levels of managementHierarchy of management that covers different levels of management
Hierarchy of management that covers different levels of managementmkooblal
 
Solving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptxSolving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptxOH TEIK BIN
 
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️9953056974 Low Rate Call Girls In Saket, Delhi NCR
 
Romantic Opera MUSIC FOR GRADE NINE pptx
Romantic Opera MUSIC FOR GRADE NINE pptxRomantic Opera MUSIC FOR GRADE NINE pptx
Romantic Opera MUSIC FOR GRADE NINE pptxsqpmdrvczh
 
Procuring digital preservation CAN be quick and painless with our new dynamic...
Procuring digital preservation CAN be quick and painless with our new dynamic...Procuring digital preservation CAN be quick and painless with our new dynamic...
Procuring digital preservation CAN be quick and painless with our new dynamic...Jisc
 
Planning a health career 4th Quarter.pptx
Planning a health career 4th Quarter.pptxPlanning a health career 4th Quarter.pptx
Planning a health career 4th Quarter.pptxLigayaBacuel1
 
How to Configure Email Server in Odoo 17
How to Configure Email Server in Odoo 17How to Configure Email Server in Odoo 17
How to Configure Email Server in Odoo 17Celine George
 
Influencing policy (training slides from Fast Track Impact)
Influencing policy (training slides from Fast Track Impact)Influencing policy (training slides from Fast Track Impact)
Influencing policy (training slides from Fast Track Impact)Mark Reed
 
Judging the Relevance and worth of ideas part 2.pptx
Judging the Relevance  and worth of ideas part 2.pptxJudging the Relevance  and worth of ideas part 2.pptx
Judging the Relevance and worth of ideas part 2.pptxSherlyMaeNeri
 
What is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERPWhat is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERPCeline George
 
ENGLISH6-Q4-W3.pptxqurter our high choom
ENGLISH6-Q4-W3.pptxqurter our high choomENGLISH6-Q4-W3.pptxqurter our high choom
ENGLISH6-Q4-W3.pptxqurter our high choomnelietumpap1
 
ROOT CAUSE ANALYSIS PowerPoint Presentation
ROOT CAUSE ANALYSIS PowerPoint PresentationROOT CAUSE ANALYSIS PowerPoint Presentation
ROOT CAUSE ANALYSIS PowerPoint PresentationAadityaSharma884161
 
Atmosphere science 7 quarter 4 .........
Atmosphere science 7 quarter 4 .........Atmosphere science 7 quarter 4 .........
Atmosphere science 7 quarter 4 .........LeaCamillePacle
 
ACC 2024 Chronicles. Cardiology. Exam.pdf
ACC 2024 Chronicles. Cardiology. Exam.pdfACC 2024 Chronicles. Cardiology. Exam.pdf
ACC 2024 Chronicles. Cardiology. Exam.pdfSpandanaRallapalli
 
Keynote by Prof. Wurzer at Nordex about IP-design
Keynote by Prof. Wurzer at Nordex about IP-designKeynote by Prof. Wurzer at Nordex about IP-design
Keynote by Prof. Wurzer at Nordex about IP-designMIPLM
 
Introduction to ArtificiaI Intelligence in Higher Education
Introduction to ArtificiaI Intelligence in Higher EducationIntroduction to ArtificiaI Intelligence in Higher Education
Introduction to ArtificiaI Intelligence in Higher Educationpboyjonauth
 

Recently uploaded (20)

ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptx
ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptxECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptx
ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptx
 
How to do quick user assign in kanban in Odoo 17 ERP
How to do quick user assign in kanban in Odoo 17 ERPHow to do quick user assign in kanban in Odoo 17 ERP
How to do quick user assign in kanban in Odoo 17 ERP
 
Alper Gobel In Media Res Media Component
Alper Gobel In Media Res Media ComponentAlper Gobel In Media Res Media Component
Alper Gobel In Media Res Media Component
 
Hierarchy of management that covers different levels of management
Hierarchy of management that covers different levels of managementHierarchy of management that covers different levels of management
Hierarchy of management that covers different levels of management
 
Solving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptxSolving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptx
 
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
 
Romantic Opera MUSIC FOR GRADE NINE pptx
Romantic Opera MUSIC FOR GRADE NINE pptxRomantic Opera MUSIC FOR GRADE NINE pptx
Romantic Opera MUSIC FOR GRADE NINE pptx
 
Procuring digital preservation CAN be quick and painless with our new dynamic...
Procuring digital preservation CAN be quick and painless with our new dynamic...Procuring digital preservation CAN be quick and painless with our new dynamic...
Procuring digital preservation CAN be quick and painless with our new dynamic...
 
Planning a health career 4th Quarter.pptx
Planning a health career 4th Quarter.pptxPlanning a health career 4th Quarter.pptx
Planning a health career 4th Quarter.pptx
 
How to Configure Email Server in Odoo 17
How to Configure Email Server in Odoo 17How to Configure Email Server in Odoo 17
How to Configure Email Server in Odoo 17
 
Influencing policy (training slides from Fast Track Impact)
Influencing policy (training slides from Fast Track Impact)Influencing policy (training slides from Fast Track Impact)
Influencing policy (training slides from Fast Track Impact)
 
Judging the Relevance and worth of ideas part 2.pptx
Judging the Relevance  and worth of ideas part 2.pptxJudging the Relevance  and worth of ideas part 2.pptx
Judging the Relevance and worth of ideas part 2.pptx
 
What is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERPWhat is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERP
 
ENGLISH6-Q4-W3.pptxqurter our high choom
ENGLISH6-Q4-W3.pptxqurter our high choomENGLISH6-Q4-W3.pptxqurter our high choom
ENGLISH6-Q4-W3.pptxqurter our high choom
 
ROOT CAUSE ANALYSIS PowerPoint Presentation
ROOT CAUSE ANALYSIS PowerPoint PresentationROOT CAUSE ANALYSIS PowerPoint Presentation
ROOT CAUSE ANALYSIS PowerPoint Presentation
 
Atmosphere science 7 quarter 4 .........
Atmosphere science 7 quarter 4 .........Atmosphere science 7 quarter 4 .........
Atmosphere science 7 quarter 4 .........
 
ACC 2024 Chronicles. Cardiology. Exam.pdf
ACC 2024 Chronicles. Cardiology. Exam.pdfACC 2024 Chronicles. Cardiology. Exam.pdf
ACC 2024 Chronicles. Cardiology. Exam.pdf
 
Raw materials used in Herbal Cosmetics.pptx
Raw materials used in Herbal Cosmetics.pptxRaw materials used in Herbal Cosmetics.pptx
Raw materials used in Herbal Cosmetics.pptx
 
Keynote by Prof. Wurzer at Nordex about IP-design
Keynote by Prof. Wurzer at Nordex about IP-designKeynote by Prof. Wurzer at Nordex about IP-design
Keynote by Prof. Wurzer at Nordex about IP-design
 
Introduction to ArtificiaI Intelligence in Higher Education
Introduction to ArtificiaI Intelligence in Higher EducationIntroduction to ArtificiaI Intelligence in Higher Education
Introduction to ArtificiaI Intelligence in Higher Education
 

Sheet1FABRIC AND LINING COSTS PER YARDPOLY JERSEY$ 1.50POLY WITH.docx

  • 1. Sheet1FABRIC AND LINING COSTS PER YARDPOLY JERSEY$ 1.50POLY WITH SPANDEX$ 1.80RAYON JERSEY$ 1.30RAY JER WITH SPAN$ 1.80DENIM$ 3.80CHIFFON$ 2.40NOVELTY FAB$ 4.20PRINTED POLY/SPAN$ 2.80PRINTED RAY SPAN$ 2.50PRINTED CHIFFON$ 3.40LINING$ 1.10ZIPPER$ 0.75BUTTONS$ 0.25ELASTIC$ 0.50 BHS105A Biochemistry1 Assessment Brief FINAL.Docx Page 1 of 7 ASSESSMENT BRIEF Subject Code and Title BHS105 Biochemistry 1 Assessment Written report Individual/Group Individual Length 1500 words +/- 10% Learning Outcomes a) Discuss and interpret the relationship between the structure and function of biomolecules. b) Identify and explain the basic properties and reactions of amines, aldehydes, carboxylic acids,
  • 2. esters, and amides. c) Describe the structure and function of carbohydrates, proteins, amino acids, enzymes and lipids. d) By examining the literature, explain the structure and function of nucleic acids and their roles in the genetic code and protein synthesis. e) By examining the literature, discuss genetic expression, regulation and mutations including mechanisms of DNA organisation and replication, RNA synthesis, processing and metabolism. f) Explain the structure of the biological membrane and discuss the associated forms of transportation g) Discuss the role of the cell membrane and cytoskeleton in relationship to metabolic processes including protein synthesis, intercellular communication and hormonal regulation Submission By 11:55pm AEST/AEDT Sunday of Week 10
  • 3. Weighting 40% Total Marks 100 marks Context: BHS105A Biochemistry1 Assessment Brief FINAL.Docx Page 2 of 7 This assessment focuses on developing your understanding of key concepts in Biochemistry related to health science. You will develop a range of skills as you research the various topics, including: knowledge, understanding and research. You will be able to exhibit your knowledge by applying the principles and concepts in Biochemistry. Instructions: Length: PART A 250 words +/- 10%, PART B 850 words +/- 10%, PART C 400 words +/- 10% Word count must be adhered to – otherwise penalties may apply. Note that headings, in-text citations and reference list are not included in the word limit.
  • 4. This is a report to be written adhering to academic style. When writing the report, label each section as Part A, B and C and address the required questions. Label each question with the appropriate question number. You may include the question in your report, but this will not form a part of the word count. Please familiarize yourself with academic style writing prior to writing this report. The report should be submitted in a Word, 12 font (Arial or Times New Roman) and 1.5 spacing document. Reports should be submitted through the assessment submission link on the class Blackboard page. It is the student’s responsibility to ensure reports are uploaded by the due date. Information relating to each part of this assessment is as follows: PART A scientific questions. - 10%, each question is worth 4 marks PART B
  • 5. fic information in an academic style essay. Please refer to the assessment overview document for guidelines. - 10% Referencing -text citations and a reference list following the APA referencing style should be included. The APA referencing guide can be located in the Academic Writing Guide. include journals, books, reputable websites or videos. This part is worth 5 marks. PART C knowledge. - 10% Please refer to the marking rubric to ensure you address all the
  • 6. assessment criteria BHS105A Biochemistry1 Assessment Brief FINAL.Docx Page 3 of 7 PART A – Reasoning 250 words +/- 10% 1. Pyrimidine plays a vital role in the efficient functioning of the body. Discuss the chemical classification and significance of pyrimidine relating to the human body. (4 marks) 2. The boiling points of ethanol and ethanal are 78.37°C and 20.2°C respectively. Explain the reason for this variation in the boiling points of these two compounds with similar molecular weights. Discuss intermolecular attractions between the molecules to support your answer. (4 marks) 3. Stearic acid and oleic acid are both long chain carboxylic acids with 18 carbon atoms. However, there is a large difference in the melting points of these fatty acids. Stearic acid
  • 7. (18:0) melts at 70°C and oleic acid (18:1) melts at 16°C. Explain why there is such a large difference in the melting points of these fatty acids. (4 marks) 4. Assume that you are a chemist trying to prepare butyl ethanoate, a flavouring agent used in the manufacture of ice-cream and candy. Identify the functional group in butyl ethanoate. State the name of the reaction and the reactants that can be used to synthesize this compound. (4 marks) PART B – Essay 850 words +/- 10% Carbohydrates, proteins and lipids play a vital role in the efficient functioning of the human body. Discuss the major functions of carbohydrates, proteins and lipids with an emphasis on their role in maintaining the structure of cell membrane. (40 marks) PART C – Application 400 words +/- 10% 1. The antibacterial activity of penicillin is related to the inhibition of a key bacterial enzyme. Explain this mechanism of enzyme inhibition. (5 marks)
  • 8. 2. Sequence 1 and sequence 2 are short sequences of DNA with a message. To decipher the message, you will need to first transcribe and then translate the sequences. Using the single letter code of each amino acid obtained upon translating the sequence, crack the message contained. Please note that there are only 20 amino acids. Therefore, you may need to insert any/all of the letters B, J, O, U, X, Z to complete the message. (5 marks) DNA Sequence 1: 3'- TAAAATCAGCTCTAGACGGTACTCTACTAGTCATGGTCCA TG- 5' DNA Sequence 2: 3'- CGGGGGCGGTAGTCCTCAACCTAGTGGGTGTGG- 5' BHS105A Biochemistry1 Assessment Brief FINAL.Docx Page 4 of 7 3. A part of the DNA sequence of normal hemoglobin and sickle cell hemoglobin are shown below. Using your knowledge of transcription and translation,
  • 9. determine the mRNA and amino acid sequence for both normal and sickle cell haemoglobin DNA. Normal hemoglobin DNA C A C G T G G A C T G A G G A C T C C T C T T C Sickle cell hemoglobin DNA C A C G T G G A C T G A G G A C A C C T C T T C Comment on the difference between the amino acid sequences obtained and state if this difference would affect the role of haemoglobin as an oxygen carrying protein. (5 marks) 4. State whether the following compounds are present in DNA or RNA or both. (5 marks) a) Guanine b) Adenine c) Thymine d) Cytosine e) 2-deoxy-D-ribose f) D-ribose g) Uracil
  • 10. 5. A part of the aminoacid sequence in Cytochrome-C protein from 6 different species is given in the table. Rank the organisms from 1 to 5 according to the similarity of the organism to human: based on the similarity between the cytochrome C aminoacid sequences, 1 being the closest to human. It is largely agreed that the greater the number of amino acid (or nucleotide) differences between a given pair of organisms, the further apart they are in evolution. On the other hand, if two organisms show very few differences, they are likely to be closely related. With the given information in the table and your ranking of organisms, do you think this ranking gives definite information on how further apart the organisms are in evolution? Why/why not? (5 marks) Human DVEKGKKIFIM
  • 11. Silkworm moth NAENGKKIFVQ Chicken DIEKGKKIFVQ Rhesus monkey DVEKGKKIFIM Bullfrog DVEKGKKIFVQ Tuna DVAKGKKTFVQ BHS105A Biochemistry1 Assessment Brief FINAL.Docx Page 5 of 7 6. Complete the following questions using the given double stranded DNA (14 marks) Double stranded DNA: 5' - ATGTACGCTACTTGA - 3' 3' - TACATGCGATGAACT -5' a) Identify the coding strand and the template strand in the given double stranded DNA. b) Determine the sequence of mRNA obtained from the transcription of the DNA strand.
  • 12. c) Determine the anticodons of tRNA required to translate the mRNA codons. d) Using the genetic code, identify the sequence of amino acids obtained upon translation of the mRNA. NOTE: Please refer to Bettelheim, F.A., Brown, W.H., Campbell, M.K., & Farell, S.O. (2013). Introduction to General, Organic, and Biochemistry (11th ed.). USA: Brookes/Cole, Cengage Learning for the genetic code and single letter code of amino acids. BHS105A Biochemistry1 Assessment brief FINAL.docx Page 6 of 7 Assessment Attributes Fail (0-49%) Pass (50-64%) Credit (65-74)
  • 13. Distinction (75-84%) High Distinction (85-100%) Grade Description A Fail grade will be awarded if a student is unable to demonstrate satisfactory academic performance in the subject or has failed to complete the required assessment points. Use of the academic referencing system is not evident. Pass is awarded for work showing a satisfactory achievement of all learning outcomes and an adequate understanding of theory and application of skills. Use of the academic referencing system is evident. Credit is awarded for work showing a more than satisfactory achievement of all learning outcomes and a more than adequate understanding of theory and application of skills. Competent use of the recommended academic referencing system. Distinction is awarded for work of superior quality in achieving all learning outcomes and a superior
  • 14. integration and understanding of theory and application of skills. Evidence of in-depth relevant research, reading, analysis and evaluation is demonstrated. The recommended academic referencing system is used consistently and accurately with minimal errors. High Distinction is awarded for outstanding quality in achieving all learning outcomes together with outstanding integration and understanding of theory and application of skills. Evidence of in-depth relevant research, reading, analysis, original and creative thought is demonstrated. The recommended academic referencing system is used consistently and accurately at all times. PART A 16 marks 0 - 8 8.1– 10 10.1 – 12 12.1– 14 14.1 – 16 Knowledge and
  • 15. understanding Limited understanding of required concepts and knowledge. Shows inadequate knowledge of topics to meet learning outcomes. Basic understanding of required concepts and knowledge. Shows adequate knowledge to meet the learning outcomes. Thorough knowledge and understanding of required concepts. Demonstrates capacity to explain and apply relevant concepts to meet learning outcomes. Highly developed knowledge and understanding of required concepts. Well demonstrated capacity to explain and apply relevant concepts. Sophisticated knowledge and understanding of required concepts. Demonstrates an excellent capacity to explain and apply relevant concepts to meet learning outcomes.
  • 16. PART B 40 marks 0 – 20 20.1 – 25 25.1 – 30 30.1 – 35 35.1 – 40 0 –1.25 1.3-1.5 1.6-1.75 1.8-2 2.1 – 2.5 Introduction Introduction not very clear or evident. Limited introduction present. Introduction provides background information on the topic, but does not provide an outline. Introduction provides background information on the topic. A brief outline is described. Introduction provides background information on the topic. A clear outline is described. Introduction provides a concise background to the chosen topic; engages and orients the reader creating strong interest. 0 –1.25 1.3-1.5 1.6-1.75 1.8-2 2.1 – 2.5 Conclusion Conclusion not evident. Limited conclusion present. Minimal discussion regarding
  • 17. essay content. Conclusion is evident and briefly covers most content discussed in the essay. Conclusion is well structured, reviews majority of relevant points. No new material is introduced in conclusion. The concluding statement is concise, well-structured and briefly reviews all relevant points and provides a strong parting statement. No new BHS105A Biochemistry1 Assessment brief FINAL.docx Page 7 of 7 material is introduced in conclusion. 5 marks 0 –2.5 2.6-3 3.1-3.5 3.6-4.3 4.4 – 5 Use of academic and discipline conventions
  • 18. Poorly written not adhering to academic style writing, with errors in spelling and grammar. Chemical equations/symbols are not presented in the correct format. Adequately written adhering to academic style writing. Some spelling and grammatical errors. Some information is not always explicit or well written. Some chemical equations/symbols are not presented in the correct format. Well written adhering to academic style writing. Almost no spelling and grammatical errors. Almost all information is explicit and well written. Almost all chemical equations/symbols are presented in the correct format. Very well written adhering to academic style writing. No spelling or grammatical mistakes. All information is explicit
  • 19. and very well written. All chemical equations/symbols are presented in the correct format. Expertly written adhering to academic style writing. demonstrating use of high quality language and written expression. All chemical symbols/equations are presented in the correct format. 30 marks 0 – 15 15.1 – 19 19.1– 22 22.1 – 25 25.1 – 30 Knowledge and understanding Limited understanding of required concepts and knowledge. Shows inadequate knowledge of topics to meet learning outcomes. Basic understanding of required concepts and knowledge. Shows adequate knowledge to
  • 20. meet the learning outcomes. Thorough knowledge and understanding of required concepts. Demonstrates capacity to explain and apply relevant concepts to meet learning outcomes. Highly developed knowledge and understanding of required concepts. Well demonstrated capacity to explain and apply relevant concepts. Sophisticated knowledge and understanding of required concepts. Demonstrates an excellent capacity to explain and apply relevant concepts to meet learning outcomes. 5 marks 0 –2.5 2.6-3 3.1-3.5 3.6-4.3 4.4 – 5 Referencing (Part A and Part B) Minimal or no attempt made at referencing and use of appropriate APA style guidelines. Attempt made at referencing using appropriate APA style
  • 21. guidelines but not adequate. Good referencing using appropriate APA style guidelines but with some inconsistencies. Very good referencing using appropriate APA style guidelines with no mistakes. Excellent referencing, of a variety of high quality sources with appropriate APA style guidelines with no mistakes. PART C 39 marks 0 – 19.5 19.6 – 25 25.1 – 30 30.1 – 35 35.1 – 39 Knowledge and understanding Limited understanding of required concepts and knowledge. Shows inadequate knowledge of topics to meet learning outcomes. Basic understanding of required concepts and knowledge. Shows adequate knowledge to
  • 22. meet the learning outcomes. Thorough knowledge and understanding of required concepts. Demonstrates capacity to explain and apply relevant concepts to meet learning outcomes. Highly developed knowledge and understanding of required concepts. Well demonstrated capacity to explain and apply relevant concepts. Sophisticated knowledge and understanding of required concepts. Demonstrates an excellent capacity to explain and apply relevant concepts to meet learning outcomes. Sheet1ESTIMATED YARDAGES:TANK TOP0.50SS T- SHIRT0.603/4 SLV, LNG SLV T-SHIRT0.853/4 SLV, LNG SLV BLOUSE1.00SHORT SLIM SKIRT0.80LONG SLIM SKIRT1.20MIDI SLIM SKIRT0.90A LINE SHORT SKIRT1.40A LINE LONG SKIRT1.65SHORT SLIM DRESS1.00LONG SLIM DRESS1.40MIDI SLIM DRESS1.20A LINE SHORT DRESS2.00A LINE LONG DRESS2.50JACKET3.50PANTS-WIDE LEG1.85PANTS -
  • 23. SLIM1.40SHORTS1.00 Sheet1COST SHEET:YDGCOST PER YDDESCRIPTIONTOTAL FAB 1$ - 0FAB 2$ - 0LINING$ - 0TOTAL FAB$ - 0TRIM 1$ - 0TRIM 2$ - 0OTHER$ - 0HANGARS, BAGS, TAGS$ 0.50TOTAL TRIM$ 0.50CUTTING$ 1.00LABOR$ 6.50LOAD$ 1.00TOTAL LABOR$ 8.50TOTAL COSTSELLING PRICE$ - 0RETAIL PRICE$ - 0