Polymerase spiral reaction
•Download as PPTX, PDF•
0 likes•527 views
Polymerase Spiral Reaction is a isothermal nucleic acid amplification assay commonly known as PSR.
Recommended
More Related Content
What's hot
What's hot (20)
Similar to Polymerase spiral reaction
Similar to Polymerase spiral reaction (20)
Recently uploaded
Recently uploaded (20)
Polymerase spiral reaction
- 1. 4/14/2021 1 POLYMERASE SPIRAL REACTION: upcoming SIMPLE RAPID test for disease diagnosis Dr. Vinod Kumar Singh Department of Vet. Microbiology C.O.V.Sc. & A.H., DUVASU, Mathura
- 2. “Problems: third world and developing Nations face” 4/14/2021 2
- 3. 4/14/2021 3 Culprits….. Bacteria Viruses Fungi Protista Worms
- 4. 4/14/2021 4 Quality laboratory testing is crucial Need of the hour is to promote rational, cost-effective diagnostic methods Control and eradication of disease…. ..starts with diagnosis Each year in sub-Saharan Africa, ∼12 million people die…… Animals too….. Infectious diseases-HIV infection, malaria, and tuberculosis….. endemic, epidemic and pandemic HS, FMD, PPR, CSF, BT, CD, Parvo, Trypanosomiasis…. Other…TB, JD, Brucellosis…
- 5. 4/14/2021 5 Ideal Diagnostic test WHO recommends that an IDEAL DIAGNOSTIC TEST suitable for developing, underdeveloped and undeveloped countries should be “ASSURED” ☻ Affordable ☻ Sensitive ☻ Specific ☻ User-friendly ☻ Robust and rapid ☻ Equipment free ☻Deliverable to the end user
- 6. Easy-to-Use Affordable Unspecific clinical signs Low specificity Low sensitivity 4/14/2021 6 Common Diagnostic Methods Laboratory Methods Field Methods Clinical signs/symptoms Smear CMT RBPT TB/JD skin test In-vitro culture Ag and Ab detection ELISA Agglutination tests Precipitation tests Molecular tests PCR DNA Hybridization High specificity High sensitivity Complicated Expensive Time consuming
- 7. 4/14/2021 7 Cont.. Limitation of available diagnostics Either less sensitive, cumbersome or require highly sophisticated instruments User friendly and cost effective diagnostics with higher sensitivity and specificity are the NEED OF THE PRESENT HOUR Isothermal amplification methods promising field for development of pen-side diagnostics
- 8. 4/14/2021 8 Isothermal amplification Assays • Includes NASBA, HDA, MDA, RPA, RCA, LAMP, CPA and PSR • Most require multiple enzymes (three or more) and rigorous optimization • But..... RCA, LAMP , CPA and PSR can be efficiently performed at a constant temperature using one enzyme • However.... RCA method can only amplify circular DNA • LAMP require initial denaturation for the satisfactory results • PSR is novel and unique
- 9. 4/14/2021 9 Polymerase Spiral Reaction (Liu et al., 2015)
- 11. 4/14/2021 11 What it require..?? Primers (PSR-FP and PRS-RP) Bst polymerase enzyme Bacillus stearothermophilus strand displacement activity Optimum temperature (55- 65ºC) greater tolerance to inhibitors (Kaneko et al. 2007; Francois et al. 2011; Soleimani et al.2013) dNTPs Instrument Betaine (N,N,N-trimethylglycine) Reduce base stacking destabilize the DNA helix facilitate strand separation MgSO4 forms magnesium pyrophosphate Buffer
- 12. 4/14/2021 12 Primer Design Forward Primer (F) 5'- acgattcgtacatagaagtatag-GTTTGATCGTCAGGGATGG- Backward Primer (B) 5'- gatatgaagatacatgcttagca-GCATAAGTCGCAATCCCCG F B N Nr As simple as PCR primers de
- 13. 4/14/2021 13 5'- AACGGTTTGATCGTCAGGGATGGCGG………CGGCGGGGATTGCGACTTATGC CAAT-3' 3'- TTGCCAAACTAGCAGTCCCTACCGCC……….GCCGCCCCTAACGCTGAATACG GTTA- 5' Forward Primer (F) 5'- acgattcgtacatagaagtatag-GTTTGATCGTCAGGGATGG- Backward Primer (B) 5'- gatatgaagatacatgcttagca-GCATAAGTCGCAATCCCCG F Fc Bc B F B N Nr Principle/Mechanism of PSR
- 14. 4/14/2021 14 Principle/Mechanism of PSR GCCCCTAACGCTGAATACG acgatt 5'- AACGGTTTGATCGTCAGGGATGGCGG………CGGCGGGGATTGCGACTTATGC CAAT-3' + 3'- TTGCCAAACTAGCAGTCCCTACCGCC……….GCCGCCCCTAACGCTGAATACG GTTA- 5‘ acgatt - GTTTGATCGTCAGGGATGG ……>>………...CGGGGATTGCGACTTATGCCAAT -3' 3'- TTGCCAAACTAGCAGTCCCTACC……..<<……..
- 15. 4/14/2021 15 Principle/Mechanism of PSR 5' acgatt GTTTGATCGTCAGGGATGG 3'- TTGCCAAACTAGCAGTCCCTACC………..…….GCCCCTAACGCTGAATACG acgatt-5' + 5’- acgattGTTTGATCGTCAGGGATGG……………...CGGGGATTGCGACTTATGCCA AT-3‘ GCCCCTAACGCTGAATACG acgatt -5' 5' acgatt GTTTGATCGTCAGGGATGG…………..CGGGGATTGCGACTTATGCtgctaa-3‘ + 3’-tgctaa CAAACTAGCAGTCCCTACC…..….…..GCCCCTAACGCTGAATACG acgatt -5' N F Bc Nc ..…>>……..CGGGGATTGCGACTTATGCtgcta a3‘ 3’-tgctaa CAAACTAGCAGTCCCTACC…..<<….…..
- 16. 4/14/2021 16
- 17. 4/14/2021 17 Work-Flow Primers Bst enzyme Betaine MgSO4 dNTPs Buffer NFW 60-65ºC 45-60 minutes Add DNA Template Sample Heat Lysis/NA Extraction Detection Amplification
- 18. 4/14/2021 18 Visual Detection Naked eye Turbidity Dye: SYBR green, HNB, etc. Fluorescent Dyes In closed tubes Gel electrophoresis Real time Detection Turbidity Fluorescent Dyes Interpretation
- 19. 4/14/2021 19 Turbidity (Magnesium pyrophosphate) (DNA)n-1+dNTP → (DNA)n + P2O74- P2O74- + 2Mg2+ → Mg2P2O7 ↓ PPT Naked Eye Real time detection Turbid meter Turbidity Detection
- 20. 4/14/2021 20 Calorimetric Detection S. No. Dye Positive Negative 1. SYBR green Green Orange 2. Calcein Green Orange 3. HNB Sky blue Violet 4. Propidum iodide Pink Deep red- orange
- 21. 4/14/2021 21 Fluorescence Detection Gel Ectrophoresis 2-3% agarose gel stained with EtBr or SYBR green Green fluorescence
- 22. 4/14/2021 22 Sensitivity of PSR Lane 1: 5.6x10-1 ng Lane 2: 5.6x10-2 ng Lane 3: 5.6x10-3 ng Lane 4:5.6x10-4 ng Lane 5: 5.6x10-5 ng Lane 6: 5.6x10-6 ng Lane 7: 5.6x10-7 ng 1 2 3 4 5 6 Conventional PCR PSR assay Real time-PCR Visual detection after addition of SYBR-I dye
- 24. 4/14/2021 24 Properties PCR PSR LAMP Denaturation Required Not required Only initial step Primers 2 2 6 Annealing- Extension 3 steps at different temp Isothermal (60-65C) Isothermal (60- 65C) Time required 2-3 hours 30-60 min 30-60 min Optimization Easy Easy Difficult Post amplification Needs AGE No need No need Sensitivity ng of DNA fg of DNA fg of DNA Instrument Needs sophisticated and costly instrument No need of expensive instruments No need of expensive instruments Template preparation Requires /Impurities hinder the amplification No or minimum processing No or minimum processing Move on PCR, Here’s come PSR
- 26. 4/14/2021 26 Detection limit of PSR was 6.9 pg/ml within 1 h, 10-fold higher than that of PCR (69.0 pg/ml) Fourteen non-C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100% effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing.
- 27. 4/14/2021 27
- 28. 4/14/2021 28 The detection limit of parvoviral DNA by PSR, real-time PCR, and LAMP was 5 9 10-6 ng, while PCR was able to detect up to as 5 9 10-5 ng of parvoviral DNA. Thus, a tenfold increase in sensitivity was observed with the newly developed PSR when compared with conventional PCR
- 29. Department of Veterinary Microbiology, DUVASU, Mathura 4/14/2021 29 two temperature step approach was employed: an initial denaturation step of 95 °C for 5 min The developed PSR technique is 100 fold more sensitive than conventional PCR and comparable to real-time PCR.
- 30. 4/14/2021 30
- 31. 4/14/2021 31 Future Perspectives Addition of internal set of primer can further increase the sensitivity Introduction of RE sites on primer Ft and Bt will aid in sequencing of the product and other molecular biology experiments Technique could also be applied in biosensor-based analytical instruments Can be coupled with LFA for multiplex diagnosis Has a great potential to be adopted in pen-side test
- 32. Department of Veterinary Microbiology, DUVASU, Mathura 4/14/2021 32
Editor's Notes
- Most of the developing and undeveloped countries are in Africa and Asia. Another common characterstic of the two regions is the prevalence of diseases. A lot of time, money and energy have been spent fighting diaseases rather than building the economy. The state organs will also use their resources to deal with disease outbreaks, common disease includes polio, malaria, yellow fever and HIV
- Lack of effective point of care diagnostic tests applicable in resource-poor endemic areas is a critical barrier to effective treatment and control of infectious diseases” (Njiru , 2012) “Diagnosis is important not only for the prescribing of effective drugs for appropriate patients in adequate doses but also for preventing the evolution of resistant microorganisms” (Mori and Notomi, 2009)
- The tests should be sensitive 2. Test should be specific 3. Reasonable cost so that the farming community may be benefited 4. Simple protocols to perform 5. Rapidly performed 6. Adopted to any sort of climatic variation 7. Instruments used should be low cost and easy available everywhere
- Nucleic acid sequence based amplification (NASBA) Helicase-dependent amplification (HDA) Multiple displacement amplification (MDA) Recombinase polymerase amplification (RPA)
- Solely developed by……Academy of Military Medical Sciences, Beijing, China First reported by Liu et al in 2015 of ……. PSR is a powerful innovative gene amplification technique emerging as a simple rapid diagnostic tool for early detection and identification of microbial diseases and amplification of genes The whole procedure is very simple and rapid which in the amplification can be completed in less than 1 hour under isothermal conditions by incubating the mixture of samples, primers, Bst polymerase with strand displacement activity and substrates all the in a single tube PSR provides high amplification efficiency, with DNA being amplified 109–1010 copies in 30–60 min at 65℃, isothermally No need for a step to denature double stranded into a single stranded form Amplification and detection of gene can be completed in a single step Because the efficacy of PCR amplification may be affected by the presence of a number of inhibitors of Taq polymerase enzyme in the serum such as EDTA, phenol, polyamines, polysaccharides and calcium alginate, DNA extraction is required before amplification It has been shown that PSR exhibits less sensitivity to inhibitory substances present in biological samples than PCR. This robustness of PSR against inhibitors can contribute to saving the time and cost required for sample processing steps advantage of amplifying the target DNA from partially processed and/or non-processed sample .This exclusion of DNA extraction step not only shortens the reaction time and result interpretation but also eliminates the chance of contamination . The amplification efficiency is extremely high Reduced total cost- not require special reagents or sophisticated equipments In this study, we describe a novel isothermal nucleic acid amplification method, named Polymerase Spiral Reaction (PSR). Only one pair of primers and one enzyme are needed to launch the PSR reaction, just like PCR. Besides, since the reaction is performed at a constant temperature, an energy intensive thermal cycler is not needed. Moreover, the positive results could be determined through a visual color change. The PSR method is appropriate for on-site and point of care testing.
- Bst enzyme considered as the “brain box” of the technique Bacillus stearothermophilus contains the 5´→3´ polymerase activity lacks 5´→3´ exonuclease activity exhibit greater tolerance to inhibitors typically found in diagnostic specimen (e,g blood, humic acid), which is an advantage as compared to PCR polymerase optimal temperature for Bst polymerase is between 55-65°C At temperatures above 70°C, enzyme activity is significantly decreased while at 80°C the enzyme is inactivated Cost Rs 4200 for 8000 units/ml Magnesium sulphate Magnesium sulphate which forms magnesium pyrophosphate during the course of the reaction which enables to visualize the result based on the turbidity formed. •Betaine (N,N,N-trimethylglycine) Betaine is used to reduce base stacking and to increase not only the overall rate of reaction but also target selectivity by significantly reducing amplification of irrelevant sequences. It also destabilize the DNA helix and negates the need for heat denaturation of the template. It is theorized that reaction temperatures of 65°C in conjunction with betaine are sufficient to facilitate strand separation; however, the exact mechanism is unknown Increased target selectivity with a significant reduction of irrelevent sequences
- The forward and reverse Tab primer sequences are reverse to each other at their 5’ end (Nr and N), whereas their 3’ end sequences are complementary to their respective target nucleic acid sequences. The uppercase 3’ sequences of the forward primer (F) and reverse primer (B) are complementary to the target blaNDM-1 gene sequence (position 32922–32941, 33115–33097, GenBank accession: 11027496). The lowercase 5’ sequence of the forward primer (Nr) is reverse to the lowercase 5’ sequence of the reverse primer (N). Nr and N sequences were abstracted from a botanic gene.
- When the temperature reaches 61–65 °C, the double-stranded structure of template DNA unlocks due to the presence of Betaine. F segment of the Ft primer anneals to one single-stranded DNA and extends the B segment of the Bt primer hybridizes to it (structure 3) and extends (structure 4). The double strands of structure 4 melts and forms a single chain (structure 5). Sequence Nr and N are reverse to each other, and sequence Nr and Nrc are complementary to each other. Thus, sequence N and Nrc are reverse and complementary to each other. Structure 5 would curl to structure 6. The 3’ end of Nrc would continue to extend and finally forms a spiral structure (structure 7). Similarly, the extension mechanism of another single-stranded chain in the right diagram is the same as the left diagram.
- With the time and temperature preset, gene amplification will occur, and the detection can be done by simultaneously monitoring the white turbidity caused by the existence of magnesium pyrophosphate, the amplification by-products
- In the DNA amplification process by DNA polymerase, pyrophosphate ions are produced as a by-product from the reaction substrate deoxyribonucleotide triphosphates (dNTPs). The calcein in the reaction mixture initially combines with manganous ion (Mn2+) so as to remain quenched. When the amplification reaction proceeds, manganous ion is deprived of calcein by the generated pyrophosphate ion (P2O7 4- ), which results in the emission of fluorescence. And the free calcein is apt to combine with magnesium ion (Mg2+) in the reaction mixture, so that it strengthens the fluorescence emission.
- combines the advantage of PCR in which only one pair of primers is needed and isothermal amplification techniques such as RCR and 3SR.