Recommended
More Related Content
What's hot
What's hot (17)
Similar to A Primer to Bioinformatics: Key Concepts and Tasks
Similar to A Primer to Bioinformatics: Key Concepts and Tasks (20)
Recently uploaded
Recently uploaded (20)
A Primer to Bioinformatics: Key Concepts and Tasks
- 1. A Primer to Bioinformatics ETHAN SUNG – DOCTOR’S SOCIETY – 29/9/17 1
- 2. Key Theory - What is DNA? DNA acts as the genetic code for the majority of living organisms Double helical structure in the nucleus Composed of four nucleotide bases (Adenine, Thymine, Guanine, Cytosine) Complimentary base pairing (AT, GC) Sections of DNA are called genes (variations are called alleles) Two strands run in opposite directions (Antiparallel) 2
- 3. Introduction to Bioinformatics Modern Biology and Medicine reliant on Genetics (therefore Bioinformatics) Using Computer Science [and sometimes Statistics] to solve Biological Problems Sequenced the Human Genome in 1990-2003 (although technically still going) Average collection of all bases in human DNA Helps diagnosis of Genetic Diseases, identification of why they exist and how to fix them FASTA format is used to denote nucleotide sequences 3
- 4. Key Theory - The Central Dogma Three bases in DNA is called a codon and codes for a particular amino acid (20 different kinds) It is universal, degenerate and non-overlapping Enzyme RNA polymerase copies template strand (5’) Creates single stranded messenger RNA (mRNA) to send this message to ribosomes, similar to coding strand (3’) RNA is single stranded, has Uracil instead of Thymine Use transfer RNA (tRNA) to bring amino acids and create a protein 4
- 5. Task 1 – Convert DNA to mRNA (transcription) Scenario: a patient is suspected of having sickle cell due to symptoms of episodes of pain and frequent fatigue Sickle cell disease causes RBC to morph into unusually long shapes Sufferers are prone to anaemia due to insufficient oxygen carrying Has a genetic cause of a single nucleotide (HBB gene on Chr.11) Result should be “AUUGCCGUCUGAAGAGGACUCCUCAGU CUACGUGGU” 5
- 6. Key Theory - Basis of Genetic Mutations Mutations (SNP) are a change in the base sequence Caused by natural misreads or mutagenic agents (radiation & chemicals) INDELS – insertion/deletion of bases Substitutions – one type of base is changed for another (A to T) Others include changes in chromosome numbers (i.e. non-disjunction in Down’s syndrome), translocation and inversion Can have beneficial effects (increasing diversity) or detrimental (genetic disease) 6
- 7. Task 2 – Evaluate for Single Nucleotide Polymorphism Single Nucleotide Polymorphisms can be detected by comparing with the reference sequence Only those homozygous will display sickle cell symptoms – why? SC is evolutionary advantageous against malaria Found predominantly in African, Arabian and Indian origins What type of SNP have you detected? 7
- 8. Key Theory – Restriction Endonucleas es Enzymes that cut DNA sequences at specific palindromic recognition sites Make incisions at the sugar-phosphate backbone of each strand separately Derive from bacteria and archaea as an immune system against viruses Can cut at “blunt ends” (i.e. Smal) or “sticky ends” (i.e. EcoRI) 8
- 9. Task 3 – Identifying Tandem Repeats Scenario – a patient has a relative who was recently diagnosed with Huntington’s disease, we need to identify whether they are at risk Causes movement disorders such as involuntary jerking motions, cognitive disorders such as difficulty processing words and new information Defective gene with excessive tandem repeats codes for a faulty protein which gradually degenerates the brain HD gene has a section of trinucleotide repeats (CAG), coding for a polyglutamine tract, above 36 repeats means Huntingdon’s will probably manifest Uses EcoP15I restriction endonuclease, which cuts at blunt ends 9