Submit Search
Upload
18lecturepresentation 160212184145
•
Download as PPT, PDF
•
0 likes
•
41 views
C
Cleophas Rwemera
Follow
Campbell Biology in Focus
Read less
Read more
Education
Report
Share
Report
Share
1 of 87
Download now
Recommended
Bioinformatics workshop presentation
Bioinformatics workshop presentation
SKUAST-Kashmir
OMICS tecnology
OMICS tecnology
trishaissar
Bioinformatics issues and challanges presentation at s p college
Bioinformatics issues and challanges presentation at s p college
SKUASTKashmir
Computational Genomics - Bioinformatics - IK
Computational Genomics - Bioinformatics - IK
Ilgın Kavaklıoğulları
Bioinformatics
Bioinformatics
Vidya Kalaivani Rajkumar
Human genome project
Human genome project
Sachin Ekatpure
Bioinformatics in present and its future
Bioinformatics in present and its future
হলুদ হিমু
The human genome project
The human genome project
Sahil Biswas
Recommended
Bioinformatics workshop presentation
Bioinformatics workshop presentation
SKUAST-Kashmir
OMICS tecnology
OMICS tecnology
trishaissar
Bioinformatics issues and challanges presentation at s p college
Bioinformatics issues and challanges presentation at s p college
SKUASTKashmir
Computational Genomics - Bioinformatics - IK
Computational Genomics - Bioinformatics - IK
Ilgın Kavaklıoğulları
Bioinformatics
Bioinformatics
Vidya Kalaivani Rajkumar
Human genome project
Human genome project
Sachin Ekatpure
Bioinformatics in present and its future
Bioinformatics in present and its future
হলুদ হিমু
The human genome project
The human genome project
Sahil Biswas
History and scope in bioinformatics
History and scope in bioinformatics
KAUSHAL SAHU
Genomics and proteomics by shreeman
Genomics and proteomics by shreeman
shreeman cs
Human genome project
Human genome project
mah neem mah
History and devolopment of bioinfomatics.ppt (1)
History and devolopment of bioinfomatics.ppt (1)
Madan Kumar Ca
DNA Technology
DNA Technology
mgsonline
MoM2010: Bioinformatics
MoM2010: Bioinformatics
Hend Al-Khalifa
Bioinformatics lecture 1
Bioinformatics lecture 1
Hamid Ur-Rahman
Introduction to Bioinformatics
Introduction to Bioinformatics
Asad Afridi
Omics biotechnology
Omics biotechnology
Romissaa ali Esmail/ faculty of dentistry/Al-Azhar university
Ethics And The Human Genome Project
Ethics And The Human Genome Project
Nadia Blanchard
Bioinformatics, its application main
Bioinformatics, its application main
KAUSHAL SAHU
Bioinformatics (Exam point of view)
Bioinformatics (Exam point of view)
Sijo A
Bioinformatics & its scope in biotech.
Bioinformatics & its scope in biotech.
Muhammad Hunan Faiz
Bioinformatics
Bioinformatics
KhanhNgoc LiLa
Bioinformatics introduction
Bioinformatics introduction
Biotech Online
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
The Hive
Genomics
Genomics
Megan Nicole
Genomics
Genomics
Komal Rajgire
21 lecture genome_and_evolution
21 lecture genome_and_evolution
veneethmathew
rheumatoid arthritis
rheumatoid arthritis
Ankit Bhardwaj
Human Genome Project
Human Genome Project
Peyman Ghoraishizadeh
Bioinformatics
Bioinformatics
Amna Jalil
More Related Content
What's hot
History and scope in bioinformatics
History and scope in bioinformatics
KAUSHAL SAHU
Genomics and proteomics by shreeman
Genomics and proteomics by shreeman
shreeman cs
Human genome project
Human genome project
mah neem mah
History and devolopment of bioinfomatics.ppt (1)
History and devolopment of bioinfomatics.ppt (1)
Madan Kumar Ca
DNA Technology
DNA Technology
mgsonline
MoM2010: Bioinformatics
MoM2010: Bioinformatics
Hend Al-Khalifa
Bioinformatics lecture 1
Bioinformatics lecture 1
Hamid Ur-Rahman
Introduction to Bioinformatics
Introduction to Bioinformatics
Asad Afridi
Omics biotechnology
Omics biotechnology
Romissaa ali Esmail/ faculty of dentistry/Al-Azhar university
Ethics And The Human Genome Project
Ethics And The Human Genome Project
Nadia Blanchard
Bioinformatics, its application main
Bioinformatics, its application main
KAUSHAL SAHU
Bioinformatics (Exam point of view)
Bioinformatics (Exam point of view)
Sijo A
Bioinformatics & its scope in biotech.
Bioinformatics & its scope in biotech.
Muhammad Hunan Faiz
Bioinformatics
Bioinformatics
KhanhNgoc LiLa
Bioinformatics introduction
Bioinformatics introduction
Biotech Online
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
The Hive
Genomics
Genomics
Megan Nicole
Genomics
Genomics
Komal Rajgire
What's hot
(18)
History and scope in bioinformatics
History and scope in bioinformatics
Genomics and proteomics by shreeman
Genomics and proteomics by shreeman
Human genome project
Human genome project
History and devolopment of bioinfomatics.ppt (1)
History and devolopment of bioinfomatics.ppt (1)
DNA Technology
DNA Technology
MoM2010: Bioinformatics
MoM2010: Bioinformatics
Bioinformatics lecture 1
Bioinformatics lecture 1
Introduction to Bioinformatics
Introduction to Bioinformatics
Omics biotechnology
Omics biotechnology
Ethics And The Human Genome Project
Ethics And The Human Genome Project
Bioinformatics, its application main
Bioinformatics, its application main
Bioinformatics (Exam point of view)
Bioinformatics (Exam point of view)
Bioinformatics & its scope in biotech.
Bioinformatics & its scope in biotech.
Bioinformatics
Bioinformatics
Bioinformatics introduction
Bioinformatics introduction
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
Personalized Medicine and the Omics Revolution by Professor Mike Snyder
Genomics
Genomics
Genomics
Genomics
Similar to 18lecturepresentation 160212184145
21 lecture genome_and_evolution
21 lecture genome_and_evolution
veneethmathew
rheumatoid arthritis
rheumatoid arthritis
Ankit Bhardwaj
Human Genome Project
Human Genome Project
Peyman Ghoraishizadeh
Bioinformatics
Bioinformatics
Amna Jalil
Genomics
Genomics
Pubudu Gokarella
Encode Project
Encode Project
Anarghya Hegde
Sophie F. summer Poster Final
Sophie F. summer Poster Final
Sophie Friedheim
An Introduction to Genomics
An Introduction to Genomics
Dr NEETHU ASOKAN
21 genomes and their evolution
21 genomes and their evolution
kindarspirit
Introducción a la bioinformatica
Introducción a la bioinformatica
Martín Arrieta
Comparative genomics and proteomics
Comparative genomics and proteomics
Nikhil Aggarwal
GENOMICS AND BIOINFORMATICS
GENOMICS AND BIOINFORMATICS
sandeshGM
Impact of the human genome project on medical advancement in India.
Impact of the human genome project on medical advancement in India.
University of Petroleum and Energy studies
apcp Deeksha Bhartiya
apcp Deeksha Bhartiya
Ravi Mehrotra MD,PhD, FRCPath, FAMS
Genome.ppt
Genome.ppt
AnandHarsh3
Genetics and genomic
Genetics and genomic
Tuğçe İlhan
genomics proteomics metbolomics.pptx
genomics proteomics metbolomics.pptx
Rajesh Yadav
Comparative genomics
Comparative genomics
Jajati Keshari Nayak
Whole Genome Sequencing .pptx
Whole Genome Sequencing .pptx
GyanchandSaini1
Bioinformatics relevance with biotechnology
Bioinformatics relevance with biotechnology
KAUSHAL SAHU
Similar to 18lecturepresentation 160212184145
(20)
21 lecture genome_and_evolution
21 lecture genome_and_evolution
rheumatoid arthritis
rheumatoid arthritis
Human Genome Project
Human Genome Project
Bioinformatics
Bioinformatics
Genomics
Genomics
Encode Project
Encode Project
Sophie F. summer Poster Final
Sophie F. summer Poster Final
An Introduction to Genomics
An Introduction to Genomics
21 genomes and their evolution
21 genomes and their evolution
Introducción a la bioinformatica
Introducción a la bioinformatica
Comparative genomics and proteomics
Comparative genomics and proteomics
GENOMICS AND BIOINFORMATICS
GENOMICS AND BIOINFORMATICS
Impact of the human genome project on medical advancement in India.
Impact of the human genome project on medical advancement in India.
apcp Deeksha Bhartiya
apcp Deeksha Bhartiya
Genome.ppt
Genome.ppt
Genetics and genomic
Genetics and genomic
genomics proteomics metbolomics.pptx
genomics proteomics metbolomics.pptx
Comparative genomics
Comparative genomics
Whole Genome Sequencing .pptx
Whole Genome Sequencing .pptx
Bioinformatics relevance with biotechnology
Bioinformatics relevance with biotechnology
More from Cleophas Rwemera
Chapter003 150907175411-lva1-app6891
Chapter003 150907175411-lva1-app6891
Cleophas Rwemera
Chapter002 150831173907-lva1-app6892
Chapter002 150831173907-lva1-app6892
Cleophas Rwemera
Chapter001 150823230128-lva1-app6892
Chapter001 150823230128-lva1-app6892
Cleophas Rwemera
Chapter25 cancer-140105085413-phpapp01
Chapter25 cancer-140105085413-phpapp01
Cleophas Rwemera
Chapter24 immunology-140105101108-phpapp02
Chapter24 immunology-140105101108-phpapp02
Cleophas Rwemera
Chapter23 nervecells-140105100942-phpapp02
Chapter23 nervecells-140105100942-phpapp02
Cleophas Rwemera
Chapter22 themolecularcellbiologyofdevelopment-140105100412-phpapp02
Chapter22 themolecularcellbiologyofdevelopment-140105100412-phpapp02
Cleophas Rwemera
Chapter21 cellbirthlineageanddeath-140105095914-phpapp02
Chapter21 cellbirthlineageanddeath-140105095914-phpapp02
Cleophas Rwemera
Chapter20 regulatingtheeukaryoticcellcycle-140105095738-phpapp01
Chapter20 regulatingtheeukaryoticcellcycle-140105095738-phpapp01
Cleophas Rwemera
Chapter19 integratingcellsintotissues-140105095535-phpapp02
Chapter19 integratingcellsintotissues-140105095535-phpapp02
Cleophas Rwemera
Chapter18 cellorganizationandmovementiimicrotubulesandintermediatefilaments-1...
Chapter18 cellorganizationandmovementiimicrotubulesandintermediatefilaments-1...
Cleophas Rwemera
Chapter17 cellorganizationandmovementimicrofilaments-140105094810-phpapp02
Chapter17 cellorganizationandmovementimicrofilaments-140105094810-phpapp02
Cleophas Rwemera
Chapter16 cellsignalingiisignalingpathwaysthatcontrolgeneactivity-14010509451...
Chapter16 cellsignalingiisignalingpathwaysthatcontrolgeneactivity-14010509451...
Cleophas Rwemera
Chapter15 cellsignalingisignaltransductionandshort-termcellularresponses-1401...
Chapter15 cellsignalingisignaltransductionandshort-termcellularresponses-1401...
Cleophas Rwemera
Chapter14 vesiculartrafficsecretionandendocytosis-140105094215-phpapp01
Chapter14 vesiculartrafficsecretionandendocytosis-140105094215-phpapp01
Cleophas Rwemera
Chapter13 movingproteinsintomembranesandorganelles-140105094005-phpapp01
Chapter13 movingproteinsintomembranesandorganelles-140105094005-phpapp01
Cleophas Rwemera
Chapter12 cellularenergetics-140105093734-phpapp01
Chapter12 cellularenergetics-140105093734-phpapp01
Cleophas Rwemera
Chapter11 transmembranetransportofionsandsmallmolecules-140105092904-phpapp02
Chapter11 transmembranetransportofionsandsmallmolecules-140105092904-phpapp02
Cleophas Rwemera
Chapter10 biomembranestructure-140105093829-phpapp02
Chapter10 biomembranestructure-140105093829-phpapp02
Cleophas Rwemera
Chapter9 visualizingfractionatingandculturingcells-140105092245-phpapp01
Chapter9 visualizingfractionatingandculturingcells-140105092245-phpapp01
Cleophas Rwemera
More from Cleophas Rwemera
(20)
Chapter003 150907175411-lva1-app6891
Chapter003 150907175411-lva1-app6891
Chapter002 150831173907-lva1-app6892
Chapter002 150831173907-lva1-app6892
Chapter001 150823230128-lva1-app6892
Chapter001 150823230128-lva1-app6892
Chapter25 cancer-140105085413-phpapp01
Chapter25 cancer-140105085413-phpapp01
Chapter24 immunology-140105101108-phpapp02
Chapter24 immunology-140105101108-phpapp02
Chapter23 nervecells-140105100942-phpapp02
Chapter23 nervecells-140105100942-phpapp02
Chapter22 themolecularcellbiologyofdevelopment-140105100412-phpapp02
Chapter22 themolecularcellbiologyofdevelopment-140105100412-phpapp02
Chapter21 cellbirthlineageanddeath-140105095914-phpapp02
Chapter21 cellbirthlineageanddeath-140105095914-phpapp02
Chapter20 regulatingtheeukaryoticcellcycle-140105095738-phpapp01
Chapter20 regulatingtheeukaryoticcellcycle-140105095738-phpapp01
Chapter19 integratingcellsintotissues-140105095535-phpapp02
Chapter19 integratingcellsintotissues-140105095535-phpapp02
Chapter18 cellorganizationandmovementiimicrotubulesandintermediatefilaments-1...
Chapter18 cellorganizationandmovementiimicrotubulesandintermediatefilaments-1...
Chapter17 cellorganizationandmovementimicrofilaments-140105094810-phpapp02
Chapter17 cellorganizationandmovementimicrofilaments-140105094810-phpapp02
Chapter16 cellsignalingiisignalingpathwaysthatcontrolgeneactivity-14010509451...
Chapter16 cellsignalingiisignalingpathwaysthatcontrolgeneactivity-14010509451...
Chapter15 cellsignalingisignaltransductionandshort-termcellularresponses-1401...
Chapter15 cellsignalingisignaltransductionandshort-termcellularresponses-1401...
Chapter14 vesiculartrafficsecretionandendocytosis-140105094215-phpapp01
Chapter14 vesiculartrafficsecretionandendocytosis-140105094215-phpapp01
Chapter13 movingproteinsintomembranesandorganelles-140105094005-phpapp01
Chapter13 movingproteinsintomembranesandorganelles-140105094005-phpapp01
Chapter12 cellularenergetics-140105093734-phpapp01
Chapter12 cellularenergetics-140105093734-phpapp01
Chapter11 transmembranetransportofionsandsmallmolecules-140105092904-phpapp02
Chapter11 transmembranetransportofionsandsmallmolecules-140105092904-phpapp02
Chapter10 biomembranestructure-140105093829-phpapp02
Chapter10 biomembranestructure-140105093829-phpapp02
Chapter9 visualizingfractionatingandculturingcells-140105092245-phpapp01
Chapter9 visualizingfractionatingandculturingcells-140105092245-phpapp01
Recently uploaded
Capitol Tech U Doctoral Presentation - April 2024.pptx
Capitol Tech U Doctoral Presentation - April 2024.pptx
CapitolTechU
Introduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptx
pboyjonauth
Biting mechanism of poisonous snakes.pdf
Biting mechanism of poisonous snakes.pdf
adityarao40181
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdf
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdf
Sumit Tiwari
Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝
9953056974 Low Rate Call Girls In Saket, Delhi NCR
Proudly South Africa powerpoint Thorisha.pptx
Proudly South Africa powerpoint Thorisha.pptx
thorishapillay1
How to Configure Email Server in Odoo 17
How to Configure Email Server in Odoo 17
Celine George
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
9953056974 Low Rate Call Girls In Saket, Delhi NCR
Meghan Sutherland In Media Res Media Component
Meghan Sutherland In Media Res Media Component
InMediaRes1
Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...
jaredbarbolino94
ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptx
ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptx
iammrhaywood
Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17
Celine George
DATA STRUCTURE AND ALGORITHM for beginners
DATA STRUCTURE AND ALGORITHM for beginners
Sabitha Banu
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17
Celine George
Alper Gobel In Media Res Media Component
Alper Gobel In Media Res Media Component
InMediaRes1
भारत-रोम व्यापार.pptx, Indo-Roman Trade,
भारत-रोम व्यापार.pptx, Indo-Roman Trade,
Virag Sontakke
History Class XII Ch. 3 Kinship, Caste and Class (1).pptx
History Class XII Ch. 3 Kinship, Caste and Class (1).pptx
socialsciencegdgrohi
TataKelola dan KamSiber Kecerdasan Buatan v022.pdf
TataKelola dan KamSiber Kecerdasan Buatan v022.pdf
Sarwono Sutikno, Dr.Eng.,CISA,CISSP,CISM,CSX-F
Crayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon A
UnboundStockton
internship ppt on smartinternz platform as salesforce developer
internship ppt on smartinternz platform as salesforce developer
unnathinaik
Recently uploaded
(20)
Capitol Tech U Doctoral Presentation - April 2024.pptx
Capitol Tech U Doctoral Presentation - April 2024.pptx
Introduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptx
Biting mechanism of poisonous snakes.pdf
Biting mechanism of poisonous snakes.pdf
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdf
Enzyme, Pharmaceutical Aids, Miscellaneous Last Part of Chapter no 5th.pdf
Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝
Proudly South Africa powerpoint Thorisha.pptx
Proudly South Africa powerpoint Thorisha.pptx
How to Configure Email Server in Odoo 17
How to Configure Email Server in Odoo 17
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
Meghan Sutherland In Media Res Media Component
Meghan Sutherland In Media Res Media Component
Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...
ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptx
ECONOMIC CONTEXT - PAPER 1 Q3: NEWSPAPERS.pptx
Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17
DATA STRUCTURE AND ALGORITHM for beginners
DATA STRUCTURE AND ALGORITHM for beginners
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17
Alper Gobel In Media Res Media Component
Alper Gobel In Media Res Media Component
भारत-रोम व्यापार.pptx, Indo-Roman Trade,
भारत-रोम व्यापार.pptx, Indo-Roman Trade,
History Class XII Ch. 3 Kinship, Caste and Class (1).pptx
History Class XII Ch. 3 Kinship, Caste and Class (1).pptx
TataKelola dan KamSiber Kecerdasan Buatan v022.pdf
TataKelola dan KamSiber Kecerdasan Buatan v022.pdf
Crayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon A
internship ppt on smartinternz platform as salesforce developer
internship ppt on smartinternz platform as salesforce developer
18lecturepresentation 160212184145
1.
CAMPBELL BIOLOGY IN
FOCUS © 2014 Pearson Education, Inc. Urry • Cain • Wasserman • Minorsky • Jackson • Reece Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge 18 Genomes and Their Evolution
2.
© 2014 Pearson
Education, Inc. Overview: Reading the Leaves from the Tree of Life Complete genome sequences exist for a human, chimpanzee, E. coli and numerous other prokaryotes, corn, fruit fly, house mouse, orangutan, and others Comparisons of genomes among organisms provide information about the evolutionary history of genes and taxonomic groups
3.
© 2014 Pearson
Education, Inc. Genomics is the study of whole sets of genes and their interactions Bioinformatics is the application of computational methods to the storage and analysis of biological data
4.
© 2014 Pearson
Education, Inc. Figure 18.1
5.
© 2014 Pearson
Education, Inc. Concept 18.1: The Human Genome Project fostered development of faster, less expensive sequencing techniques The Human Genome Project officially began in 1990, and the sequencing was largely completed by 2003 Even with automation, the sequencing of all 3 billion base pairs in a haploid set presented a formidable challenge A major thrust of the Human Genome Project was the development of technology for faster sequencing
6.
© 2014 Pearson
Education, Inc. Figure 18.2-1 Cut the DNA into overlapping fragments short enough for sequencing. Clone the fragments in plasmid or other vectors. 2 1
7.
© 2014 Pearson
Education, Inc. Figure 18.2-2 Cut the DNA into overlapping fragments short enough for sequencing. Clone the fragments in plasmid or other vectors. Sequence each fragment. 2 1 3 CGCCATCAGT AGTCCGCTATACGA ACGATACTGGT
8.
© 2014 Pearson
Education, Inc. Figure 18.2-3 Cut the DNA into overlapping fragments short enough for sequencing. Order the sequences into one overall sequence with computer software. Clone the fragments in plasmid or other vectors. Sequence each fragment. CGCCATCAGT CGCCATCAGT AGTCCGCTATACGA AGTCCGCTATACGA ACGATACTGGT ACGATACTGGT …CGCCATCAGTCCGCTATACGATACTGGT… 2 1 3 4
9.
© 2014 Pearson
Education, Inc. The whole-genome shotgun approach was developed by J. Craig Venter and colleagues This approach starts with cloning and sequencing random DNA fragments Powerful computer programs are used to assemble the resulting short overlapping sequences into a single continuous sequence
10.
© 2014 Pearson
Education, Inc. The whole-genome shotgun approach is widely used today Newer sequencing techniques, called sequencing by synthesis, have resulted in massive increases in speed and decreases in cost of sequencing entire genomes These sensitive techniques allow direct sequencing of fragments without a cloning step
11.
© 2014 Pearson
Education, Inc. The new sequencing techniques have facilitated an approach called metagenomics In this approach, DNA from a group of species in an environmental sample is collected and sequenced Computer software sorts out the partial sequences and assembles them into their specific genomes
12.
© 2014 Pearson
Education, Inc. Concept 18.2: Scientists use bioinformatics to analyze genomes and their functions The Human Genome Project established databases and refined analytical software to make data available on the Internet This has accelerated progress in DNA sequence analysis
13.
© 2014 Pearson
Education, Inc. Centralized Resources for Analyzing Genome Sequences Bioinformatics resources are provided by a number of sources National Library of Medicine and the National Institutes of Health (NIH) created the National Center for Biotechnology Information (NCBI) European Molecular Biology Laboratory DNA Data Bank of Japan BGI in Shenzhen, China
14.
© 2014 Pearson
Education, Inc. GenBank, the NCBI database of sequences, doubles its data approximately every 18 months Software is available that allows online visitors to search GenBank for matches to A specific DNA sequence A predicted protein sequence Common stretches of amino acids in a protein The NCBI website also provides three-dimensional views of all protein structures that have been determined
15.
© 2014 Pearson
Education, Inc. Figure 18.3
16.
© 2014 Pearson
Education, Inc. Identifying the Functions of Protein-Coding Genes DNA sequence may vary more than the protein sequence does Scientists interested in proteins often compare the predicted amino acid sequence of a protein with that of other proteins Protein function can be deduced from sequence similarity or a combination of biochemical and functional studies
17.
© 2014 Pearson
Education, Inc. Understanding Genes and Gene Expression at the Systems Level Genomics is a rich source of insights into questions about gene organization, regulation of expression, growth and development, and evolution A project called ENCODE (Encyclopedia of DNA Elements) has yielded a wealth of information about protein-coding genes, genes for noncoding RNA, and sequences that regulate DNA replication, gene expression, and chromatin modification
18.
© 2014 Pearson
Education, Inc. Systems Biology Proteomics is the systematic study of the full protein sets (proteomes) encoded by genomes We must study when and where proteins are produced in an organism in order to understand the function of cells and organisms Systems biology aims to model the dynamic behavior of whole biological systems based on the study of interactions among the system’s parts
19.
© 2014 Pearson
Education, Inc. Application of Systems Biology to Medicine A systems biology approach has several medical applications The Cancer Genome Atlas project (completed in 2010) attempted to identify all the common mutations in three types of cancer by comparing gene sequences and expression in cancer versus normal cells This was so fruitful that it will be extended to ten other common cancers Silicon and glass “chips” have been produced that hold a microarray of most known human genes
20.
© 2014 Pearson
Education, Inc. Figure 18.4
21.
© 2014 Pearson
Education, Inc. Concept 18.3: Genomes vary in size, number of genes, and gene density By August of 2012, about 3,700 genomes had been completely sequenced, including 3,300 bacterial,160 archaeal, and 183 eukaryotic genomes Sequencing of over 7,500 genomes and about 340 metagenomes was in progress
22.
© 2014 Pearson
Education, Inc. Genome Size Genomes of most bacteria and archaea range from 1 to 6 million base pairs (Mb); genomes of eukaryotes are usually larger Most plants and animals have genomes greater than 100 Mb; humans have 3,000 Mb Within each domain there is no systematic relationship between genome size and phenotype
23.
© 2014 Pearson
Education, Inc. Table 18.1
24.
© 2014 Pearson
Education, Inc. Table 18.1a
25.
© 2014 Pearson
Education, Inc. Table 18.1b
26.
© 2014 Pearson
Education, Inc. Number of Genes Free-living bacteria and archaea have 1,500 to 7,500 genes Unicellular fungi have about 5,000 genes Multicellular eukaryotes can have up to at least 40,000 genes
27.
© 2014 Pearson
Education, Inc. Number of genes is not correlated to genome size For example, it is estimated that the nematode C. elegans has 100 Mb and 20,100 genes, while Drosophila has 165 Mb and 13,900 genes Vertebrate genomes can produce more than one polypeptide per gene because of alternative splicing of RNA transcripts
28.
© 2014 Pearson
Education, Inc. Gene Density and Noncoding DNA Humans and other mammals have the lowest gene density, or number of genes, in a given length of DNA Multicellular eukaryotes have many introns within genes and noncoding DNA between genes
29.
© 2014 Pearson
Education, Inc. Concept 18.4: Multicellular eukaryotes have much noncoding DNA and many multigene families The bulk of most eukaryotic genomes encodes neither proteins nor functional RNAs Sequencing of the human genome reveals that 98.5% does not code for proteins, rRNAs, or tRNAs About a quarter of the human genome codes for introns and gene-related regulatory sequences
30.
© 2014 Pearson
Education, Inc. Intergenic DNA is noncoding DNA found between genes Pseudogenes are former genes that have accumulated mutations and are now nonfunctional Repetitive DNA is present in multiple copies in the genome About three-fourths of repetitive DNA is made up of transposable elements and sequences related to them
31.
© 2014 Pearson
Education, Inc. Figure 18.5 Introns (∼20%) Regulatory sequences (5%) Exons (1.5%) L1 sequences (17%) Alu elements (10%) Simple sequence DNA (3%) Large-segments duplications (5–6%) Unique noncoding DNA (15%) Repetitive DNA that includes transposable elements and related sequences (44%) Repetitive DNA unrelated to transposable elements (14%)
32.
© 2014 Pearson
Education, Inc. Transposable Elements and Related Sequences The first evidence for mobile DNA segments came from geneticist Barbara McClintock’s breeding experiments with Indian corn McClintock identified changes in the color of corn kernels that made sense only if some genetic elements move from other genome locations into the genes for kernel color These transposable elements move from one site to another in a cell’s DNA; they are present in both prokaryotes and eukaryotes
33.
© 2014 Pearson
Education, Inc. Figure 18.6
34.
© 2014 Pearson
Education, Inc. Figure 18.6a
35.
© 2014 Pearson
Education, Inc. Figure 18.6b
36.
© 2014 Pearson
Education, Inc. Movement of Transposons and Retrotransposons Eukaryotic transposable elements are of two types Transposons, which move by a “cut and paste” method that sometimes leaves a copy behind Retrotransposons, which move by means of an RNA intermediate and always leave a copy behind
37.
© 2014 Pearson
Education, Inc. Figure 18.7 New copy of transposon Transposon is copied Transposon DNA of genome Mobile transposon Insertion
38.
© 2014 Pearson
Education, Inc. Figure 18.8 Retrotransposon New copy of retrotransposon Reverse transcriptase RNA Formation of a single-stranded RNA intermediate Insertion
39.
© 2014 Pearson
Education, Inc. Sequences Related to Transposable Elements Multiple copies of transposable elements and related sequences are scattered throughout eukaryotic genomes In primates, a large portion of transposable element– related DNA consists of a family of similar sequences called Alu elements Many Alu elements are transcribed into RNA molecules; however, their function, if any, is unknown
40.
© 2014 Pearson
Education, Inc. The human genome also contains many sequences of a type of retrotransposon called LINE-1 (L1) L1 sequences have a low rate of transposition and may help regulate gene expression
41.
© 2014 Pearson
Education, Inc. Other Repetitive DNA, Including Simple Sequence DNA About 14% of the human genome consists of repetitive DNA resulting from errors during replication or recombination About a third of this consists of duplication of long sequences of DNA from one location to another In contrast, simple sequence DNA contains many copies of tandemly repeated short sequences
42.
© 2014 Pearson
Education, Inc. A series of repeating units of 2 to 5 nucleotides is called a short tandem repeat (STR) The repeat number for STRs can vary among sites (within a genome) or individuals STR diversity can be used to identify a unique set of genetic markers for each individual, his or her genetic profile Forensic scientists can use STR analysis on DNA samples to identify victims of crime or natural disasters
43.
© 2014 Pearson
Education, Inc. Genes and Multigene Families Many eukaryotic genes are present in one copy per haploid set of chromosomes The rest occur in multigene families, collections of identical or very similar genes Some multigene families consist of identical DNA sequences, usually clustered tandemly, such as those that code for rRNA products
44.
© 2014 Pearson
Education, Inc. Figure 18.9 RNA transcripts Transcription unit DNA Nontranscribed spacer DNA rRNA 18S 28S 18S 5.8S 28S5.8S (a) Part of the ribosomal RNA gene family Heme β-Globin (aqua) α-Globin (purple) α-Globin gene family β-Globin gene family Chromosome 16 Chromosome 11 AdultFetusEmbryoEmbryo Fetus and adult (b) The human α-globin and β-globin gene families ζ ∋ ψζ ψα2 ψα1 α2 α1 ψθ Gγ Aγ ψβ δ β
45.
© 2014 Pearson
Education, Inc. Figure 18.9a RNA transcripts Transcription unit DNA Nontranscribed spacer DNA rRNA 18S 28S 18S 5.8S 28S5.8S (a) Part of the ribosomal RNA gene family
46.
© 2014 Pearson
Education, Inc. The classic examples of multigene families of nonidentical genes are two related families of genes that encode globins α-globins and β-globins are polypeptides of hemoglobin and are coded by genes on different human chromosomes and are expressed at different times in development
47.
© 2014 Pearson
Education, Inc. Figure 18.9b Heme β-Globin (aqua) α-Globin (purple) α-Globin gene family β-Globin gene family Chromosome 16 Chromosome 11 AdultFetusEmbryoEmbryo Fetus and adult (b) The human α-globin and β-globin gene families ζ ∋ ψζ ψα2 ψα1 α2 α1 ψθ Gγ ψβ δ βAγ
48.
© 2014 Pearson
Education, Inc. Figure 18.9c RNA transcripts Transcription unit DNA Nontranscribed spacer
49.
© 2014 Pearson
Education, Inc. Concept 18.5: Duplication, rearrangement, and mutation of DNA contribute to genome evolution The basis of change at the genomic level is mutation, which underlies much of genome evolution The earliest forms of life likely had the minimal number of genes necessary for survival and reproduction The size of genomes has increased over evolutionary time, with the extra genetic material providing raw material for gene diversification
50.
© 2014 Pearson
Education, Inc. Duplication of Entire Chromosome Sets Accidents in meiosis can lead to one or more extra sets of chromosomes, a condition known as polyploidy The genes in one or more of the extra sets can diverge by accumulating mutations; these variations may persist if the organism carrying them survives and reproduces
51.
© 2014 Pearson
Education, Inc. Alterations of Chromosome Structure Humans have 23 pairs of chromosomes, while chimpanzees have 24 pairs Following the divergence of humans and chimpanzees from a common ancestor, two ancestral chromosomes fused in the human line
52.
© 2014 Pearson
Education, Inc. Figure 18.10 12 Centromere-like sequences Telomere-like sequences Centromere sequences Telomere sequences Human chromosome 2 Chimpanzee chromosomes 13
53.
© 2014 Pearson
Education, Inc. Researchers have compared the DNA sequences of human chromosomes with those of the mouse Large blocks of genes from human chromosome 16 can be found on four mouse chromosomes This suggests that the blocks of genes have stayed together during evolution of mouse and human lineages
54.
© 2014 Pearson
Education, Inc. Figure 18.11 Human chromosome 16 Mouse chromosomes 7 8 16 17
55.
© 2014 Pearson
Education, Inc. Duplications and inversions result from mistakes during meiotic recombination The rate of duplications and inversions seems to have accelerated about 100 million years ago This coincides with the time that large dinosaurs went extinct and mammals diversified
56.
© 2014 Pearson
Education, Inc. Duplication and Divergence of Gene-Sized Regions of DNA Unequal crossing over during prophase I of meiosis can result in one chromosome with a deletion and another with a duplication of a particular region Transposable elements can provide sites for crossover between nonsister chromatids
57.
© 2014 Pearson
Education, Inc. Figure 18.12 Incorrect pairing of two homologs during meiosis Nonsister chromatids Transposable element Crossover point and Gene
58.
© 2014 Pearson
Education, Inc. Evolution of Genes with Related Functions: The Human Globin Genes The genes encoding the various globin proteins evolved from one common ancestral globin gene, which duplicated and diverged about 450–500 million years ago After the duplication events, differences between the genes in the globin family arose from the accumulation of mutations
59.
© 2014 Pearson
Education, Inc. Figure 18.13 Ancestral globin gene Further duplications and mutations Transposition to different chromosomes Mutation in both copies Duplication of ancestral gene Evolutionarytime α-Globin gene family on chromosome 16 β-Globin gene family on chromosome 11 ζ ∋ ψζ ψα2 ψα1 α2 α1 ψθ Gγ Aγ ψβ δ β ζ ∋ α α α β β βγ
60.
© 2014 Pearson
Education, Inc. Evolution of Genes with Novel Functions The copies of some duplicated genes have diverged so much in evolution that the functions of their encoded proteins are now very different The lysozyme and α-lactalbumin genes are good examples Lysozyme is an enzyme that helps protect animals against bacterial infection α-lactalbumin is a nonenzymatic protein that plays a role in milk production in mammals
61.
© 2014 Pearson
Education, Inc. Rearrangements of Parts of Genes: Exon Duplication and Exon Shuffling Proteins often consist of discrete structural and functional regions called domains, often encoded by different exons Errors in meiosis can result in an exon being duplicated on one chromosome and deleted from the homologous chromosome
62.
© 2014 Pearson
Education, Inc. Quite a few protein-coding genes have multiple copies of related exons, which presumably arose by duplication and divergence Exon shuffling is the occasional mixing and matching of different exons within a gene or between two different genes This process could lead to new proteins with novel combinations of functions
63.
© 2014 Pearson
Education, Inc. Figure 18.14 Epidermal growth factor gene with multiple EGF exons Fibronectin gene with multiple “finger” exons Plasminogen gene with a “kringle” exon Portions of ancestral genes Exon shuffling TPA gene as it exists today Exon shuffling Exon duplication EGF EGF EGF EGF F F F F F EGF K K K
64.
© 2014 Pearson
Education, Inc. How Transposable Elements Contribute to Genome Evolution Multiple copies of similar transposable elements may facilitate recombination, or crossing over, between different chromosomes Insertion of transposable elements within a protein- coding sequence may block protein production Insertion of transposable elements within a regulatory sequence may increase or decrease protein production
65.
© 2014 Pearson
Education, Inc. Transposable elements may carry a gene or groups of genes to a new position In a similar process, an exon from one gene could be inserted into another by a mechanism similar to exon shuffling These sorts of changes are usually detrimental but may on occasion prove advantageous to an organism
66.
© 2014 Pearson
Education, Inc. Concept 18.6: Comparing genome sequences provides clues to evolution and development Genome sequencing and data collection have advanced rapidly in the last 25 years Comparative studies of genomes Reveal much about the evolutionary history of life Help clarify mechanisms that generated the great diversity of present-day life-forms
67.
© 2014 Pearson
Education, Inc. Comparing Genomes Genome comparisons of closely related species help us understand recent evolutionary events Genome comparisons of distantly related species help us understand ancient evolutionary events Evolutionary relationships among species can be represented by a tree-shaped diagram
68.
© 2014 Pearson
Education, Inc. Figure 18.15 Most recent common ancestor of all living things Bacteria Eukarya Archaea Chimpanzee Human Mouse Billions of years ago Millions of years ago 70 60 50 40 4 3 2 1 0 30 20 10 0
69.
© 2014 Pearson
Education, Inc. Comparing Distantly Related Species Highly conserved genes have remained similar over time These help clarify relationships among species that diverged from each other long ago Bacteria, archaea, and eukaryotes diverged from each other between 2 and 4 billion years ago Comparative genomic studies confirm the relevance of research on model organisms to our understanding of biology in general and human biology in particular
70.
© 2014 Pearson
Education, Inc. Comparing Closely Related Species The genomes of two closely related species are likely to be organized similarly Particular genetic differences between the two species can be easily correlated with phenotypic differences between them
71.
© 2014 Pearson
Education, Inc. Human and chimpanzee genomes differ by 1.2% at single base pairs and by 2.7% because of insertions and deletions Several genes are evolving faster in humans than in chimpanzees These include genes involved in defense against malaria and tuberculosis and in regulation of brain size Genes that seem to be evolving fastest code for transcription factors
72.
© 2014 Pearson
Education, Inc. The FOXP2 gene is a transcription factor whose product turns on genes involved in vocalization in vertebrates When the FOXP2 gene is disrupted in mice, they fail to vocalize normally
73.
© 2014 Pearson
Education, Inc. Figure 18.16 (No whistles) (a) (b) Wild type Hetero- zygote Homo- zygote Numberofwhistles 400 200 300 100 0
74.
© 2014 Pearson
Education, Inc. Figure 18.16a
75.
© 2014 Pearson
Education, Inc. Comparing Genomes Within a Species As a species, humans have only been around about 200,000 years and have low within-species genetic variation Most of the variation within humans is due to single nucleotide polymorphisms (SNPs) There are also inversions, deletions, and duplications and a large number of copy-number variants (CNVs) These variations are useful for studying human evolution and human health
76.
© 2014 Pearson
Education, Inc. Comparing Developmental Processes Evolutionary developmental biology, or evo-devo, compares the developmental processes of different multicellular organisms Genomic information shows that minor differences in gene sequence or regulation can result in striking differences in form
77.
© 2014 Pearson
Education, Inc. Widespread Conservation of Developmental Genes Among Animals Molecular analysis of the homeotic genes in Drosophila has shown that they all include a sequence called a homeobox An identical or very similar nucleotide sequence has been discovered in the homeotic genes of both vertebrates and invertebrates The vertebrate genes homologous to homeotic genes of flies have kept the same chromosomal arrangement
78.
© 2014 Pearson
Education, Inc. Figure 18.17 Adult fruit fly Fruit fly embryo (10 hours) Fly chromosome Mouse chromosomes Mouse embryo (12 days) Adult mouse
79.
© 2014 Pearson
Education, Inc. Related homeobox sequences have been found in regulatory genes of yeasts and plants The homeodomain is the part of the protein that binds to DNA when the protein functions as a transcriptional regulator The more variable domains in the protein recognize particular DNA sequences and specify which genes are regulated by the protein
80.
© 2014 Pearson
Education, Inc. Sometimes small changes in regulatory sequences of certain genes lead to major changes in body form For example, variation in Hox gene expression controls variation in leg-bearing segments of crustaceans and insects
81.
© 2014 Pearson
Education, Inc. Figure 18.18 Genital segmentsThorax Abdomen Thorax Abdomen
82.
© 2014 Pearson
Education, Inc. Figure 18.UN01a
83.
© 2014 Pearson
Education, Inc. Figure 18.UN01b
84.
© 2014 Pearson
Education, Inc. Figure 3.UN01ba
85.
© 2014 Pearson
Education, Inc. Figure 3.UN01bb
86.
© 2014 Pearson
Education, Inc. Figure 3.UN02
87.
© 2014 Pearson
Education, Inc. Figure 3.UN03 ζ ∋ ψζ ψα 2 ψα 1 α2 α1 ψθ Gγ Aγ ψβ δ β α-Globin gene family β-Globin gene family Chromosome 16 Chromosome 11
Editor's Notes
Figure 18.1 What genomic information distinguishes a human from a chimpanzee?
Figure 18.2-1 Whole-genome shotgun approach to sequencing (step 1)
Figure 18.2-2 Whole-genome shotgun approach to sequencing (step 2)
Figure 18.2-3 Whole-genome shotgun approach to sequencing (step 3)
Figure 18.3 Bioinformatics tools available on the Internet
Figure 18.4 A human gene microarray chip
Table 18.1 Genome sizes and estimated numbers of genes
Table 18.1a Genome sizes and estimated numbers of genes (part 1)
Table 18.1b Genome sizes and estimated numbers of genes (part 2)
Figure 18.5 Types of DNA sequences in the human genome
Figure 18.6 The effect of transposable elements on corn kernel color
Figure 18.6a The effect of transposable elements on corn kernel color (part 1: Barbara McClintock)
Figure 18.6b The effect of transposable elements on corn kernel color (part 2: corn kernels)
Figure 18.7 Transposon movement
Figure 18.8 Retrotransposon movement
Figure 18.9 Gene families
Figure 18.9a Gene families (part 1: ribosomal RNA family)
Figure 18.9b Gene families (part 2: -globin and -globin families)
Figure 18.9c Gene families (part 3: ribosomal RNA family, TEM)
Figure 18.10 Related human and chimpanzee chromosomes
Figure 18.11 A comparison of human and mouse chromosomes
Figure 18.12 Gene duplication due to unequal crossing over
Figure 18.13 A model for the evolution of the human -globin and -globin gene families from a single ancestral globin gene
Figure 18.14 Evolution of a new gene by exon shuffling
Figure 18.15 Evolutionary relationships of the three domains of life
Figure 18.16 The function of FOXP2, a gene that is rapidly evolving in the human lineage
Figure 18.16a The function of FOXP2, a gene that is rapidly evolving in the human lineage (photo)
Figure 18.17 Conservation of homeotic genes in a fruit fly and a mouse
Figure 18.18 Effect of differences in Hox gene expression in crustaceans and insects
Figure 18.UN01a Skills exercise: reading an amino acid sequence identity table (part 1)
Figure 18.UN01b Skills exercise: reading an amino acid sequence identity table (part 2)
Figure 18.UN01ba Skills exercise: reading an amino acid sequence identity table (part 2a)
Figure 18.UN01bb Skills exercise: reading an amino acid sequence identity table (part 2b)
Figure 18.UN02 Summary of key concepts: genome size
Figure 18.UN03 Summary of key concepts: multigene families
Download now