Infer the significance of cell division.
Differentiate a DNA molecule, a chromosome, and a chromatid.
Characterize the phases of the cell cycle and their control points.
Describe the major events associated with stages of mitosis.
Explain the process of cytokinesis.
Learning Objectives
Describe the role of apoptosis in the life cycle of a cell.
Relate cancer as a result of the malfunction of the cell during the cell cycle.
Infer the significance of cell division.
Differentiate a DNA molecule, a chromosome, and a chromatid.
Characterize the phases of the cell cycle and their control points.
Describe the major events associated with stages of mitosis.
Explain the process of cytokinesis.
Learning Objectives
Describe the role of apoptosis in the life cycle of a cell.
Relate cancer as a result of the malfunction of the cell during the cell cycle.
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
These lecture slides, by Dr Sidra Arshad, offer a quick overview of physiological basis of a normal electrocardiogram.
Learning objectives:
1. Define an electrocardiogram (ECG) and electrocardiography
2. Describe how dipoles generated by the heart produce the waveforms of the ECG
3. Describe the components of a normal electrocardiogram of a typical bipolar leads (limb II)
4. Differentiate between intervals and segments
5. Enlist some common indications for obtaining an ECG
Study Resources:
1. Chapter 11, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 9, Human Physiology - From Cells to Systems, Lauralee Sherwood, 9th edition
3. Chapter 29, Ganong’s Review of Medical Physiology, 26th edition
4. Electrocardiogram, StatPearls - https://www.ncbi.nlm.nih.gov/books/NBK549803/
5. ECG in Medical Practice by ABM Abdullah, 4th edition
6. ECG Basics, http://www.nataliescasebook.com/tag/e-c-g-basics
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...VarunMahajani
Disruption of blood supply to lung alveoli due to blockage of one or more pulmonary blood vessels is called as Pulmonary thromboembolism. In this presentation we will discuss its causes, types and its management in depth.
Factory Supply Best Quality Pmk Oil CAS 28578–16–7 PMK Powder in Stockrebeccabio
Factory Supply Best Quality Pmk Oil CAS 28578–16–7 PMK Powder in Stock
Telegram: bmksupplier
signal: +85264872720
threema: TUD4A6YC
You can contact me on Telegram or Threema
Communicate promptly and reply
Free of customs clearance, Double Clearance 100% pass delivery to USA, Canada, Spain, Germany, Netherland, Poland, Italy, Sweden, UK, Czech Republic, Australia, Mexico, Russia, Ukraine, Kazakhstan.Door to door service
Hot Selling Organic intermediates
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
MANAGEMENT OF ATRIOVENTRICULAR CONDUCTION BLOCK.pdfJim Jacob Roy
Cardiac conduction defects can occur due to various causes.
Atrioventricular conduction blocks ( AV blocks ) are classified into 3 types.
This document describes the acute management of AV block.
Report Back from SGO 2024: What’s the Latest in Cervical Cancer?bkling
Are you curious about what’s new in cervical cancer research or unsure what the findings mean? Join Dr. Emily Ko, a gynecologic oncologist at Penn Medicine, to learn about the latest updates from the Society of Gynecologic Oncology (SGO) 2024 Annual Meeting on Women’s Cancer. Dr. Ko will discuss what the research presented at the conference means for you and answer your questions about the new developments.
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...i3 Health
i3 Health is pleased to make the speaker slides from this activity available for use as a non-accredited self-study or teaching resource.
This slide deck presented by Dr. Kami Maddocks, Professor-Clinical in the Division of Hematology and
Associate Division Director for Ambulatory Operations
The Ohio State University Comprehensive Cancer Center, will provide insight into new directions in targeted therapeutic approaches for older adults with mantle cell lymphoma.
STATEMENT OF NEED
Mantle cell lymphoma (MCL) is a rare, aggressive B-cell non-Hodgkin lymphoma (NHL) accounting for 5% to 7% of all lymphomas. Its prognosis ranges from indolent disease that does not require treatment for years to very aggressive disease, which is associated with poor survival (Silkenstedt et al, 2021). Typically, MCL is diagnosed at advanced stage and in older patients who cannot tolerate intensive therapy (NCCN, 2022). Although recent advances have slightly increased remission rates, recurrence and relapse remain very common, leading to a median overall survival between 3 and 6 years (LLS, 2021). Though there are several effective options, progress is still needed towards establishing an accepted frontline approach for MCL (Castellino et al, 2022). Treatment selection and management of MCL are complicated by the heterogeneity of prognosis, advanced age and comorbidities of patients, and lack of an established standard approach for treatment, making it vital that clinicians be familiar with the latest research and advances in this area. In this activity chaired by Michael Wang, MD, Professor in the Department of Lymphoma & Myeloma at MD Anderson Cancer Center, expert faculty will discuss prognostic factors informing treatment, the promising results of recent trials in new therapeutic approaches, and the implications of treatment resistance in therapeutic selection for MCL.
Target Audience
Hematology/oncology fellows, attending faculty, and other health care professionals involved in the treatment of patients with mantle cell lymphoma (MCL).
Learning Objectives
1.) Identify clinical and biological prognostic factors that can guide treatment decision making for older adults with MCL
2.) Evaluate emerging data on targeted therapeutic approaches for treatment-naive and relapsed/refractory MCL and their applicability to older adults
3.) Assess mechanisms of resistance to targeted therapies for MCL and their implications for treatment selection
1. Week 1: Individual Assignments DUE:9/3 at 12am
REPLICATION, TRANSCRIPTION, TRANSLATION
1. The process of translation is breaking down the RNA strand to see what proteins are
formed. To even get to the proper RNA strain, you have to form the complement DNA
strain then transcribe it. After transcription, you can break down the molecules and figure
out what proteins are formed.
2. ATGCTTTACTGAGGACTAGCT becomes TACGAAATGACTCCTGACTCGA
(complement strain) then becomes UACGAAAUGACGCCUGAUCGA (RNA
transcription)
3. One molecule involved in translation is messenger RNA. This molecule carries the
coding for protein synthesis. Another is ribosomes or ribosomal DNA. This is where
protein synthesis takes place. These are both crucial in order to form DNA/RNA strands.
MITOSIS
1. The process of mitosis is a small part of cell division. It involves the division of the
nucleus and the actual cell itself into 2 cells. This process involves splitting the
chromosomes that begin forming during this process in half. The main point of mitosis is
to replace older cells and basically are why we keep growing.
2. The stages of mitosis are:
Prophase: chromosomes begin to form, and nucleolus disappears
Metaphase: spindle fibers appear and attach to the chromosomes, aligning them in the
middle.
Anaphase: spindle fibers shorten, and the chromosomes separate.
Telophase: nuclear envelope forms and the cell begins o separate around the 2 newly
formed nuclei.
3. The spindle fibers are extremely important in any cell division/growth process. These
fibers are what divide the chromosomes equally. Without the spindle fibers there would
be no way to organize the chromosomal pairs and maintain the genetic material.
4. Interphase is the biggest phase of the cell cycle. During interphase, the cell grows and
maintains its normal functions. During this time the cell replicates DNA to prepare for
cell division. Organelles are also replicated in preparation of forming the new cell. The
nucleus is not duplicated, that occurs during the process of miosis.
