1. The situation in which an individual is interviewing for a job

•Download as DOCX, PDF•

0 likes•10 views

In a job interview, there is information asymmetry between the interviewer and the candidate. The candidate inherently knows more about their own background and qualifications than the interviewer does. To address this, the interviewer can ask questions to learn more about the candidate's work history, education, skills, and goals. They can also make an assessment based on basic information provided, like academic credentials. If a candidate deliberately withholds important details, the interviewer may choose not to hire them. However, the interviewer should not immediately reject a candidate if they are missing some information, as there could be a reasonable explanation.

Education

1. The situation in which an individual is interviewing for a job
also exhibits information asymmetry. Explain why. How does
the relatively poorly informed party deal with this?
In the situation in which an individual is interviewing for a job
exhibits information asymmetry, the interviewer is the party
with less information, while the person who comes to the
interview is the party with more information. This may be
because the candidate who came to the interview did not
provide sufficient information. But when this happens, I think
the interviewer cannot completely abandon the candidate,
because it is very likely that the candidate has some difficulties
or forgot to provide this information. For interviewers, I think
they can learn about candidates by asking or chatting, such as
their job wishes, experience, and future plans. They can also
judge whether a candidate meets their requirements by knowing
some basic information, such as academic qualifications. If
there is a deliberate concealment of information, the candidate
can be abandoned.
Samantha Kim
Mod 4 Discussion
COLLAPSE
Top of Form
The situation in which an individual is interviewing for a job
also exhibits information asymmetry. Explain why. How does
the relatively poorly informed party deal with this?
The situation where an individual is interviewing for a job is an
example of information asymmetry because the interviewer has
to depend on the information given by the individual in order to
come to a conclusion about the potential candidate. The
candidate has more information about themselves than does the
interviewer, and given this advantage can retain potential flaws

which could hurt their chances at receiving the position.
Another reason could be that the worker could exaggerate some
of their traits as well as their willingness to work after
receiving an offer for the job. The interviewer in this situation
can look at other factors such as education and grades to assess
the candidate's work ethic and ability to perform.
Bottom of Form
Needed 175 words Initial Post for each of the discussion and
two replies of 60 words for each discussion.
Mod 1 Discussion
Distinguish between cost-benefit analysis (CBA) and cost
effectiveness analysis (CEA). Can CEA replace CBA in all
cases? If not, why not?
Mod 2 Discussion
Someone says the following: “Lifestyle may be the most
important determinant of health status, but changing lifestyles
may not be the least costly way to improve population health
status.” Explain the circumstances under which this opinion
could be true. What does the evidence on lifestyle suggest about
government policies to improve the public’s overall health?
Mod 3 Discussion
The situation in which an individual is interviewing for a job
also exhibits information asymmetry. Explain why. How does
the relatively poorly informed party deal with this?

Similar to 1. The situation in which an individual is interviewing for a job

Top 20 police dispatcher interview questions answers

PoliceCareer88

DHS Interview Guide 2019.pdf

samuelgetaneh3

3 Tips for Conducting Smarter Interviews

GoodHelpings

Franklin American Mortgage interview questions and answers

taylorlorr

Inside the interview: A Job Seeker's Guide to Understanding the Interviewer's...

Robyn Melhuish

Effective Interviewing

ADARSH SINGH

Problems faced by both the interviewer and the interviewee during an intervie...

Azas Shahrier

Interviewing job applicants - interpersonal Skills

Ammar Matter

15 Questions You Need To Prepare For

david_harvardbrown

HR questions

baabtra.com - No. 1 supplier of quality freshers

How to hire the right people

Chelse Benham

An interviewer's prespective

Mauro Calcano

United states medical supply interview questions and answers

Selinasimpson245

Us cellular interview questions and answers

taylorjessica762

Pharmacy2U interview questions and answers

ahahmari

United technologies interview questions and answers

jonesnathan741

Greenway Medical Technologiesinterview questions and answers

nadsavan

Job Description Report - HR Admin

Nikole Cunningham

Al. murad d.i.y. interview questions and answers

victoriamartin968

American technologies interview questions and answers

JamieCarragher012

Similar to 1. The situation in which an individual is interviewing for a job (20)

Top 20 police dispatcher interview questions answers

DHS Interview Guide 2019.pdf

3 Tips for Conducting Smarter Interviews

Franklin American Mortgage interview questions and answers

Inside the interview: A Job Seeker's Guide to Understanding the Interviewer's...

Effective Interviewing

Problems faced by both the interviewer and the interviewee during an intervie...

Interviewing job applicants - interpersonal Skills

15 Questions You Need To Prepare For

HR questions

How to hire the right people

An interviewer's prespective

United states medical supply interview questions and answers

Us cellular interview questions and answers

Pharmacy2U interview questions and answers

United technologies interview questions and answers

Greenway Medical Technologiesinterview questions and answers

Job Description Report - HR Admin

Al. murad d.i.y. interview questions and answers

American technologies interview questions and answers

More from AbbyWhyte974

1. Use “Postman” to test API at https://postman-echo.com/ a. Use GET, POST, PUT, DELETE methods b. Use global variables c. Create test script d. Import any API from other websites 2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods) Upload screenshots to the system. Identifying Data & Reliability Ms. Jones, a 28-year-old African American female , is present into the hospital beacuse of an infected wound on her foot. Her speech is clear and concise and well- structured. Throughout the interview, she maintain eye contact while freely sharing information. N/A General Survey Ms. Jones is stting upright on the exam table, alert and oriented x3, friendly and well nourished. She is calm and appropriately dressed for the weather. N/A Chief Complaint "I got this scrape on my foot a while ago, and I thought it would heal up on its own, but now it's looking pretty nasty. And the pain is killing me!" N/A History Of Present Illness One week ago, Ms. Tina was going down her steps with no shoes and stumbled scratching her right foot on the edge of the step and was taken to the emergency room by her mother where an x-ray was performed and the site showed no abnormality. They cleaned her injuries and Tremadol was reccomended for pain and she was told to remain off of her foot and to keep it very clean and dry at all times as she was realeased home. her foot became swollen 2 days aglo as the pain exacerbated and she saw grayish whte pus draining from the wound and that is when she started taking Tramadol. She rated her agony of pain as a 7 out of 10 on her wounded foot nevertheless; she says it emanates to her whole foot and that there was drainage initially when the episode previoulsy began. Ms. Tina has been cleaning the injury with cleanser and soap and applying Neosporin to the wound two times each day and occasionaly applied peroxide. The pain was depicted as throbbing and very still and sometimes sharp shooting pain or torment when she puts weight on her foot. She can not accomadate her tennis shoes on her right foot so she had been wearing flip tumbles or slippers everyday. The pai pills have eased the excruciating pain for few hours and she reported having fever. She has lost 10 pounds in barley a month accidentally and has work for two days as she reported. She denied any ongoing sickness and feels hungrier than expected. Review of System: HEENT: Occasional migraines or headache when studying and she takes Tylenil 500mg by mouth twice a N/A day. Ms. Tina reports more awful vision in the course of recent months ands no contact or restorative lenses. She denies any congestions, hearing problem or soar throat however, she admits infrequent running nose. Neurological: Occasional migrain revealed, no dizziness, syncope, loss of motivation, ataxia, loss of tingling in her extremities or furthest point. Respiratory: No brevity or shortness of breath, hac k or cough or sputum. Cardiovasc ...

1. Use Postman” to test API at httpspostman-echo.coma. Use

AbbyWhyte974

1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper. 2. Use the format of the paper to organize your paper. 3. Use the samples of essay critiques as guidelines when completing this assignment. 4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry. 5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact. 6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers. Jules Ferry (1832-1893): On French Colonial Expansion Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for championing laws that removed Catholic influence from most education in France and for promoting a vast extension of the French colonial empire. The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas: economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort. In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the industrialized population of Europe and especially the people of our rich and hardworking country of France: the need for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing need, one may say a crying need, of our industrial population? I merely express in a general way what each one of you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is setting up trade barriers; because across the ocean the United States of America have become protectionists, and extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more difficult of access, but these great states are beginning to pour into our own markets products not seen there before. This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand, freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...

1. Use the rubric to complete the assignment and pay attention t

AbbyWhyte974

1. True or false. Unlike a merchandising business, a manufacturing

AbbyWhyte974

1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%. Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows. Portfolio Average Annual Rate of Return (%) Average Premium (Extra return versus Treasury bills) (%) Treasury bills 3.8 Treasury bonds 5.3 1.5 Common stocks 11.5 7.7 a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.) b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.) 2. Assume these are the stock market and Treasury bill returns for a 5-year period: Year Stock Market Return (%) T-Bill Return (%) 2013 33.30 0.12 2014 13.20 0.12 2015 −3.50 0.12 2016 14.50 0.07 2017 23.80 0.09 Required: a. What was the risk premium on common stock in each year? Year Risk Premium 2013 % 2014 % 2015 % 2016 % 2017 % · b. What was the average risk premium? Average risk premium % c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.) Standard deviation % 3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59. Required: a. What is the total rate of return on the stock? b. What are the dividend yield and percentage capital gain? c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case? 4. You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end. a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.) Stock Price Rate of Return 38 % 40 % 46 % b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.) Stock Price Real Rate of Return 38 % 40 % 46 % 5. Consider the following scenario analysis: Rate of Return Scenario Probability Stocks Bonds Recession 0.30 −8 % 21 % Normal economy 0.50 22 % 9 % Boom 0.20 32 % 9 % a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms? multiple choice · No · Yes b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...

1. Top hedge fund manager Sally Buffit believes that a stock with

AbbyWhyte974

1. This question is on the application of the Binomial option pricing model. PKZ stock is currently trading at 100. Over three-months it will either go up by 6% or down by 5%. Interest rates are zero. a. [25 marks] Using a two period binomial model to construct a delta- hedged portfolio, price a six month European call option on PKZ stock with a strike price of £105. b. [3 Marks] Using your answer from the first part, together with the put-call parity, price a put option on the same stock with same strike and expiry. COMP0041 SEE NEXT PAGE 2 2. This question is on the Binomial method in the limit δt → 0. [40 Marks] The binomial model for pricing options leads to the for- mula V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)] where U = eσ √ δt, D = e−σ √ δt, q = erδt −D U −D . V (S,t) is the option value, t is the time, S is the spot price, σ is volatility and r is the risk-free rate. By carefully expanding U,D,q as Taylor series in δt or √ δt (as appropriate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor series in both their arguments, deduce that to O (δt) , ∂V ∂t + 1 2 σ2S2 ∂2V ∂S2 + rS ∂V ∂S − rV = 0. COMP0041 SEE NEXT PAGE 3 3. This question is on probability and Monte Carlo a. Consider theprobabilitydensity function p (x) fora randomvariable X given by p (x) = { µ exp (−µx) x ≥ 0 0 x < 0 where µ (> 0) is a constant. i. [15 Marks] Show that for this probability density function E [ eθX ] = ( 1 − θ µ )−1 Hint: You may assume µ > θ in obtaining this result. ii. [20 Marks] By expanding ( 1 − θ µ )−1 as a Taylor series, show that E [xn] = n! µn , n = 0, 1, 2, .... iii. [15 Marks] Hence calculate the skew and kurtosis for X. COMP0041 CONTINUED ON NEXT PAGE 4 b. [32 Marks] An Exchange Option gives the holder the right to exchange one asset for another. The discounted payoff for this contract V is V = e−rT max (S1 (T) −S2 (T) , 0) . The option price is then given by θ = E [V ] where Si (t) = Si (0) e (r−12σ 2 i )t+σiφi √ t for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ. Youmayassumethatauniformrandomnumbergenerator isavail- able. Use a Cholesky factorisation method to show( φ1 φ2 ) = ( 1 0 ρ √ 1 −ρ2 )( x1 x2 ) , where ( x1 x2 ) is a vector of independent N (0, 1) variables and has the same distribution as ( φ1 φ2 ) . Give a Monte Carlo simulation algorithm that makes use of anti- thetic variates for the estimation of θ. COMP0041 SEE NEXT PAGE 5 4. This question is on finite differences a. [30 Marks] Consider a forward difference operator, ∆, such that ∆V (S) = V (S + h) −V (S) , (4.1) where h is an infinitessimal. By introducing the operators D ≡ ∂ ∂S ; D2 ≡ ∂2 ∂S2 show that ∆ ≡ ehD −1 (4.2) where 1 is the identity operator. Hint: start by doing a Taylor expansion on V (S + h) . By rearranging (4.2) show that D = 1 h ( ∆ − ∆2 2 + ∆3 3 − ∆4 4 + O ( ∆5 )) . Hence obtain the second order approximation for ∂V ...

1. This question is on the application of the Binomial option

AbbyWhyte974

1. Tiktaalik https://www.palaeocast.com/tiktaalik/ We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs. Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years. 2. News Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/ Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.” It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism. 3. Experience Bitcoin and virtual world I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...

1. Tiktaalik httpswww.palaeocast.comtiktaalikW

AbbyWhyte974

1. This week, we learned about the balanced scorecard and dashboard reporting, performance measurement, sources of revenues for different types of healthcare organizations, and financial and strategic planning initiatives. For your Unit 3 Complete assignment, write a narrative essay (minimum 1,200 words) in which you first discuss the use of the income statement, in general, for decision-making. Then, calculate the net operating income and operating margin for this year and last year using the table information below and discuss what these figures mean for the company (i.e. what ‘story’ do they tell the reader). Use at least three scholarly sources and remember to demonstrate a thorough understanding of the READ and ATTEND sections in your essay. Cite your sources using APA format. Table 3 HEALTH CAMPAIGNS: CREATING & EVALUATING Day 33 Review Ch. 8 Review Activity Homework AGENDA: 1. 2. 3. 4. Public Health Public health: prevention of disease and illness among groups of people. Creation of public policy regarding health issues and tracks diseases _________________ Public health services (CDC) (Lillie; Mattson & Hall, 2011) Health Campaigns Health campaign Seeks to promote public health Targets beliefs, attitudes, or behaviors ________- acceptance of something as true or not ______- positive or negative feeling about something ________-actions ____________ Goes beyond health education to involve health information and environmental support/resources for health (Lillie; Mattson & Hall, 2011) Messaging Model for Health COM Campaigns 4 phases of the health campaign process 1. Establish a working group and ____________ 2. Strategic planning from____________ 3. _________________ and evaluation 4. ______________on process evaluation and outcome evaluation (Lillie; Mattson & Hall, 2011) Messaging Model for Health COM Campaigns (Mattson & Hall, 2011, p. 253) Phase 1: Establish a Working Group _________: core team for strategic planning and advising Includes stakeholders, health experts, organizational officials, community partners _________: orgs and businesses who have an interest in the campaign Provide resources: (Lillie; Mattson & Hall, 2011) Phase 2: Strategic Planning Strategic plan: campaign goal and plan of action _______ analysis: S_______ and w______of campaign team (internal to team) O_____ and t______ (external to campaign) Ex. grassroots support or resistant audience __________: research to form strategies, select target audiences, and develop marketing strategies (Lillie; Mattson & Hall, 2011) Phase 2: Strategic Planning CONT. Needs assessment: process to understand and determine a community’s/population’s health issues Pre-campaign gather info from Key informants community forum survey _________: already existing statistics (Lillie; Mattson & Hall, 2011) Phase 2: Strategic Planning CONT. Messaging process: after determining baseline attitudes, beliefs, and behavi ...

1. This week, we learned about the balanced scorecard and dashboar

AbbyWhyte974

1. The company I chose was Amazon 2. 3. 4. 1) Keep in mind that the data includes Amazon and competitors 2) Example(For reference only) Table showing FedEx’s stock quote Item Value Interpretation and brief explanation Current market price $274.48 This is the price of FedEx stock that it sells for on the free stock market at as of now. Anyone wishing to purchase the company’s stock will have to pay the $274.48. This market value will habitually vary all through the exchange day as investors sell and buy the Fed Ex stock. The price will increase if more traders want to buy it and decrease or drop as traders begin selling more of the company’s stock. Market capitalization $72.076 Billion This the stock price multiplied by the number of equity shares outstanding. So it is the price above multiplied by the number of FedEx’s hares outstanding Beta 1.39 (5 year Monthly) Beta is a measure of how a separate asset shifts when the general stock market decreases or increases(Beta, 2011). In simple it is measure of a risk associated with an asset's risk in relation to the whole market (for instance, the S&P500 index). It is a measure of FedEx’s stock relative volatility. FedEx’s beta is more than meaning it is less stable. If S&P 500 Index has a base of let’s say 1 and this index changes by 3% then the stock of FedEx will as well change by 4.17% (1.39 X 3%). PE Ratio 40.41 In general, a great P/E ratio shows that investors anticipate for greater pays. Though, a security with a great P/E ratio is not certainly a superior investment than one with a lesser P/E ratio (Park, 2020). On the other hand, when a corporation's security has a small P/E ratio, it might have an indication that the stock is underestimated. In light of FedEx’s PE ratio of 40.41 its means that the stock was trading at around 40 times the earnings. This ratio is more than the overall ration in the S&P 500 Index meaning the company share is not overvalued. EPS $6.79 This is computed by dividing the net earnings attributable to the shareholders by the number of outstanding equity shares. This point outs the amount a corporation makes from each share. This item is important in determining the stock prices particularly when calculating the P/E ratio. $6.79 shows that each FedEx common stock earns around $6.79. Earning date December 16th 2020 This is the date of when a company will release its next financial reports. So, FedEx will have its next financial statements released on 16th December 2020. On this day there are expected large movements of its underlying. Forward Dividend Yield 2.60 (0.93%) This forward yield is an approximation of a year's dividend stated as a ratio of the present stock price. The year's expected dividend is determined by taking a security’s most latest actual dividend disbursement and annualizing it. The forward dividend yield is computed by dividing a year's value of future dividend disbursements by a stock's present share price. It is a corporation's pr ...

1. The company I chose was Amazon2.3.4.1) Keep i

AbbyWhyte974

1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive. 2. See the list of example speech occasions and purposes for inspiration, if needed. 3. Plan your speech, considering what your introduction, main points, and conclusion will include. 4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action. 5. Create notes or bullet points that you can refer to while presenting your speech. 6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length. 7. Before filming, review the rubric to ensure that you understand how you will be evaluated. 8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera. 9. Review your video to ensure that you can be seen and heard. Refilm as needed. 10. Review the checklist and requirements to ensure that your Touchstone is complete. 11. Upload your video using the blue button at the top of this page. ...

1. Think about a persuasive speech that you would like to present

AbbyWhyte974

1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are: a. frequency and average. b. average and correlation. c. central tendency and dispersion. d. histograms and polygons. 2. The ________________ is the sum of all the scores divided by the number of scores. a. median b. mean c. mode d. standard deviation 3. The generally preferred measure of central tendency is usually the a. range b. mean c. standard deviation d. Median 4. Which of the following is the most useful descriptive statistic for measuring dispersion? a. Range b. Variance c. mean deviation d. standard deviation 5. The standard deviation is a. the square of the variance. b. the square root of the variance. c. smaller than the mean. d. the difference between the highest and lowest scores. 6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of a. 1.00 b. 0.00 c. 2.00 d. -2.00 7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________. a. manipulation; chance b. manipulation; experimental error c. sampling error; independent variable d. independent variable; experimental error 8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s). a. different; different b. different; the same c. the same; different d. the same; the same 9. The power of a statistical test refers to its ability to a. reject false null hypotheses. b. reject false experimental hypotheses. c. reject true null hypotheses. d. reject true experimental hypotheses. 10. Simple analysis of variance is used in designs having a. one independent variable b. more than one independent variable c. more than one independent variable (IV) but less than four IVs d. more than one dependent variable 11. The number of participants in a study is denoted by a. s. b. n. c. z. d. r. 12. A _____________ is a complete set of measurements. a. sample b. population c. random sampling d. parameter 13. _____________ is one way of ensuring that a sample is representative of the population. a. The two-tailed test b. The between-subjects design c. The sign test d. Random sampling 14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of a. average young, white, college males. b. college male students. c. college students. d. young adults. 15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error a. 5% of the time. b. 10% of the time. c. 15% of the time. d. 95% of the time. 16. Which of the following would be considered the most conservative alpha level ...

1. The two properties about a set of measurements of a dependent v

AbbyWhyte974

1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts. 1. Germany 5 9 2 6 10 3 7 4 8 2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts. City Country Vienna Austria 3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points 4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts 5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points 6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points 7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts 8. Name two sets of countries where Danube River (is) forms the border. Set 1: ________________________________ (2 countries) Set 2: _____________________________________ (2 countries) 4 points 9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points 10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points 11. What specific human activities have impacted fish life in the river? Name three. 3 points 12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points 13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it! 14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.” 2 points ...

1. The Danube River flows through 10 countries. Name them in the s

AbbyWhyte974

1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE). 2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser) 3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’. 4. Click the region below the box marked “Start MultiAlin’. This starts your comparison 5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR. 6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison. 7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2. 8. Click the “Start MultiAlin” just like before. 9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3? 10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer. 11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike. COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike) There are 3 genes below… they start with the > symbol… >gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434 TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA CCACTGAAACCGCCCCCGC ...

1. The 3 genes that you will compare at listed below. Take a look.

AbbyWhyte974

1. Student and trainer details Student details Full name: Student ID: Contact number: Email address: Trainer details Full name: 2. Qualification and unit of competency Qualification/Course/Program Details Code: Name: Unit of competency Code: CPCCCA3014 Name: Construct and install bulkheads Releases: 1.0 Release date: 27/Nov/2020 3. Assessment Submission Method ☐ By hand to trainer/assessor ☐ By email to trainer/assessor ☐ Online submission via Learning Management System (LMS) ☐ Any other method _________________________________________________ (Please describe here) 4. Student declaration · I have read and understood the information in the Unit Requirements prior to commencing this Student Pack · I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice; · I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack; · For the purposes of assessment, I give the trainer/assessor permission to: · Reproduce this assessment and provide a copy to another member of staff; and · Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking). Student signature: ________________________________ Date: ____/_____/______________ 5. Assessment Plan The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways. Evidence number/ Task number Assessment method/ Type of evidence/ Task name Sufficient evidence recorded/Outcome Assessment task 1 Knowledge Test (KT) S / NS (First Attempt) S / NS (Second Attempt) Assessment task 2 Skill Test (ST) S / NS (First Attempt) S / NS (Second Attempt) Outcome C ☐ NYC ☐ Date assessed: Trainer signature: 6. Completion of the Assessment Plan Your trainer is required to fill out the Assessment Plan Outcome records above, when: · You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency. · Your work has been reviewed and assessed by your trainer/assessor. · You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency. · You have been provided with relevant and detailed feedback. Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as: · Result of Assessment (satisfactory or unsatisfactory) · Student name, signature and date · Assessor name, signature and date · Relevant and detailed feedback 7. U ...

1. Student and trainer detailsStudent details Full nameStu

AbbyWhyte974

1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors. 2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors. 3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library. 4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input. 5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors. 6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment. 7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors. CASE STUDY—BEWARE: One Emergency May Hide Another! A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy. THE NURSE'S STORY—SALLY SIMMS, RN I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career. I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment. One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...

1. Student uses MS Excel to calculate income tax expense or refund

AbbyWhyte974

1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him? 2. Plato - Of his many ideas, which do you think has been his most influential, and why? 3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous? 4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals? 7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it. 8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism. 9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776. 10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be? 11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system? 12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...

1. Socrates - In your view, what was it about Socrates’ teachings

AbbyWhyte974

1. Select a “patient” (friend or family member) on whom to perform a complete H&P. 2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE. 3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format. 4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format. 5. The SOAP Note must contain all required elements as outlined in the rubric below. 6. You must self-score your SOAP note using the rubric and attach it to the assignment. Criteria Ratings Points Thread Content 50 to >46.0 pts Advanced 47 to 50 points All key components of the Discussion Board Forum prompt are answered in the thread. Major points are supported by all of the following: *Reading & Study materials; *Pertinent, conceptual, or personal examples; *Thoughtful analysis (considering assumptions, analyzing implications, and comparing/contrasting concepts); and *Source citations in current APA format, include the required 7 or more from personal research, the course readings, and the integration of 1 biblical principle. 46 to >43.0 pts Proficient 44 to 46 points Some key components of the Discussion Board Forum prompt are answered in the thread. Major points are supported by some of the following): *Reading & Study materials; *Pertinent, conceptual, or personal examples; *Thoughtful analysis (considering assumptions, analyzing implications, and comparing/contrasting concepts); and *Source citations in current APA format, include the required 7 or more from personal research, the course readings, and the integration of 1 biblical principle. 43 to >0.0 pts Developing Minimal key components of the Discussion Board Forum prompt are answered in the thread. Major points are supported by some or none of the following: *Reading & Study materials; *Pertinent, conceptual, or personal examples; *Thoughtful analysis (considering assumptions, analyzing implications, and comparing/contrasting concepts); and *Source citations in current APA format, include the required 7 or more from personal research, the course readings, and the integration of 1 biblical principle 0 pts Not Present 50 pts Replies Content 41 to >39.0 pts Advanced Contribution made to discussion with each reply expounding on the thread. Major points are supported by all of the following: *Reading & Study materials; *Pertinent, conceptual, or personal examples; *Thoughtful analysis (considering assumptions, analyzing implications, and comparing/contrasting concepts); and *Three peer-reviewed source citations in current APA format, and the integration of 1 biblical principle. 39 to >35.0 pts Proficient Marginal contribution made to discussion with each reply slightly exp ...

1. Select a patient” (friend or family member) on whom to perform

AbbyWhyte974

1. Respond to your classmates’ question and post. Submission to your classmates must meet a minimum requirement of 50 Curiosity Points to count for credit. 1. What is the thesis of your Response? 1. Defend your Response in 200 words or less PEERS QUESTION AND POST: How does having a growth mindset affect students? When having a growth mindset, you will always believe that there is room to grow. You will not be comfortable and complacent. With a growth mindset, you are always wanting to become better. It helps students know that they are not stuck and that they can achieve any goal they want. I believe that having that growth mindset gives students motivation to want to do better and be better. - Gabriella Enriquez https://biglifejournal.com/blogs/blog/teach-growth-mindset-kids-activities Procedia Engineering 69 ( 2014 ) 830 – 837 Available online at www.sciencedirect.com 1877-7058 © 2014 The Authors. Published by Elsevier Ltd. Open access under CC BY-NC-ND license. Selection and peer-review under responsibility of DAAAM International Vienna doi: 10.1016/j.proeng.2014.03.060 ScienceDirect 24th DAAAM International Symposium on Intelligent Manufacturing and Automation, 2013 Thinking Styles and Product Development Project Types: How to Match Them? Anja Orcik*, Petar Vrgovic, Zeljko Tekic Faculty of Technical Sciences, University of Novi Sad, Trg Dositeja Obradovica 6, 21000 Novi Sad, Serbia Abstract Focusing on the characteristics of different thinking styles and different product development project types, we suggest that people should adapt their thinking strategies according to the challenge they face and choose a thinking style that is a best match for the type of project they are working on. Even though people can perform well in more than one thinking style, they can be more successful if they adequately choose the most appropriate one for solving the problem in front of them. Considering that different thinking styles have different ideas and conclusions as results, we propose how to match them to a specific product development project type that has a certain degree of change in the product as a deliverable. For further research, these findings open the possibility to define the most appropriate creative problem solving methods and techniques that spur and support a specific style of thinking. © 2014 The Authors. Published by Elsevier Ltd. Selection and peer-review under responsibility of DAAAM International Vienna. Keywords: Thinking styles; Brain Dominance Instrument; Product development projects; Problem solving 1. Introduction Product development has been defined as one of the riskiest, yet most important endeavours of the modern corporation [1]. To respond to the changing environment and stay competitive in long-term, companies need to provide quality, variety, novelty and functionality of products for their customers [2]. This requires constant improvement of existing products, as we ...

1. Respond to your classmates’ question and post. Submission to y

AbbyWhyte974

1. Review the HCAPHS survey document, by clicking on the hyperlink

AbbyWhyte974

1. Saint Leo Portal loginUser ID[email protected]

AbbyWhyte974

1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties polling data is based on this aspect of Parties Rep. Senfronia Thompson filed for the role of Speaker of Texas House In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom a sector of a political party (ex. Trump Republican, conservative Democrat) is called 2. Which candidate’s office is chosen/nominated by delegate convention? sheriff of Medina County U.S. congressman from the 4th Texas congressional district president of the United States governor of Texas 3. Which statement best depicts the effect of redistricting on representative democracy? Legislators represent the same number of Republicans and Democratic voters representation is mostly based on geographic cohesion representation is mostly based on the voting patterns of Texas residents gerrymandering is a legitimate method of forming districts 4. The difference between absentee ballot and mail-in ballot is? absentee is for people residing outside of their state mail-in ballots are issued to people who can't go to polls in some states there is no difference, as all ballots are mailed in in Texas mail-in ballots require doctors note 5 Unlike the US, most democratic governments have _______ political systems with _______. 2-party//direct representation Multi-party//proportional 2-party//direct representation multi-party//proportional representation independent party//single-member districts 2-party//single-member districts [ Choose ] [ Choose ] [ Choose ] Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04 My Car Data MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...

1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea

AbbyWhyte974

More from AbbyWhyte974 (20)

1. Use Postman” to test API at httpspostman-echo.coma. Use

1. Use the rubric to complete the assignment and pay attention t

1. True or false. Unlike a merchandising business, a manufacturing

1. Top hedge fund manager Sally Buffit believes that a stock with

1. This question is on the application of the Binomial option

1. Tiktaalik httpswww.palaeocast.comtiktaalikW

1. This week, we learned about the balanced scorecard and dashboar

1. The company I chose was Amazon2.3.4.1) Keep i

1. Think about a persuasive speech that you would like to present

1. The two properties about a set of measurements of a dependent v

1. The Danube River flows through 10 countries. Name them in the s

1. The 3 genes that you will compare at listed below. Take a look.

1. Student and trainer detailsStudent details Full nameStu

1. Student uses MS Excel to calculate income tax expense or refund

1. Socrates - In your view, what was it about Socrates’ teachings

1. Select a patient” (friend or family member) on whom to perform

1. Respond to your classmates’ question and post. Submission to y

1. Review the HCAPHS survey document, by clicking on the hyperlink

1. Saint Leo Portal loginUser ID[email protected]

1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea

Recently uploaded

How to Add New Custom Addons Path in Odoo 17

Celine George

dusjagr & nano talk on open tools for agriculture research and learning

Marc Dusseiller Dusjagr

FSB Advising Checklist - Orientation 2024

Elizabeth Walsh

Ernest Hemingway's For Whom the Bell Tolls ( About Ernest Hemingway, The Contemporary Movement and Hemingway's Role, His Later life, Hemingway and the Spanish Civil War, Hemingway's Major Works and Contributions, Ernest Hemingway's Writing Style, For Whom the Bell Tolls, Plot Summary of "For Whom the Bell Tolls", Themes, Characters, Critical Response & It's Importance, Legacy, Hemingway's Style: Imagery, About It's Adaptation “FOR WHOM THE BELL TOLLS (1943)”, Critical Acclaim and Enduring Legacy.

Ernest Hemingway's For Whom the Bell Tolls

Pallavi Parmar

REMIFENTANIL: An Ultra short acting opioid.pptx

Dr. Ravikiran H M Gowda

Tatlong Kwento ni Lola basyang-1.pdf arts

Nbelano25

What is 3 Way Matching Process in Odoo 17.pptx

Celine George

COMMUNICATING NEGATIVE NEWS - APPROACHES .pptx

annathomasp01

Orientation Canvas Course Presentation.pdf

Elizabeth Walsh

Program code examples (known also as worked examples) play a crucial role in learning how to program. Instructors use examples extensively to demonstrate the semantics of the programming language being taught and to highlight the fundamental coding patterns. Programming textbooks allocate considerable space to present and explain code examples. To make the process of studying code examples more interactive, CS education researchers developed a range of tools to engage students in the study of code examples. These tools include codecasts (codemotion,codecast,elicasts), interactive example explorers (WebEx, PCEX), and tutoring systems (DeepTutor). An important component in all types of worked examples is code explanations associated with specific code lines or code chunks of an example. The explanations connect examples with general programming knowledge explaining the role and function of code fragments or their behavior. In textbooks, these explanations are usually presented as comments in the code or as explanations on the margins. The example explorer tools allow students to examine these explanations interactively. Tutoring systems, which engage students in explaining the code, use these model explanations to check student responses and provide scaffolding. In all these cases, to make a worked example re-usable beyond its presentation in a lecture, the explanations have to be authored by instructors or domain experts i.e., produced and integrated into a specific system. As the experience of the last 10 years demonstrated, these explanations are hard to obtain. Those already collected are usually “locked” in a specific example-focused system and can’t be reused. The purpose of this working group is to support broader re-used of worked examples augmented with explanations. Our current plan is to develop а standard approach to represent explained examples. This approach will enable an example created for any of the existing systems to be explored in a standard format and imported into any other example-focused system. We plan to follow a successful experience of the PEML working group focused on re-using programming exercises.

SPLICE Working Group:Reusable Code Examples

Peter Brusilovsky

21st_Century_Skills_Framework_Final_Presentation_2.pptx

JoelynRubio1

Simple, Complex, and Compound Sentences Exercises.pdf

stareducators107

Michaelis Menten Equation and Estimation Of Vmax and Tmax.pptx

RugvedSathawane

When Quality Assurance Meets Innovation in Higher Education - Report launch w...

Gary Wood

Jamworks pilot and AI at Jisc (20/03/2024)

Jisc

APM webinar hosted by the Scotland Network on 14 May 2024. Speakers: Chris Drysdale and Peter Huggett An interactive session discussing how Project Managers can identify mental health symptoms, provide tools to help themselves and others, plus also increase the capabilities of the Project Management function. This webinar was held on 14 May 2024. The covid-19 pandemic led to concerns about a worsening of mental health & wellbeing across the world and increased awareness in both society and the workplace. This webinar looks to advise the benefits of having a Mental Health First Aid function in the workplace whilst also providing tools and techniques that can be readily used and applied to yourself and colleagues. Additionally, there are wider benefits to Project Management which will be proposed and discussed.

Including Mental Health Support in Project Delivery, 14 May.pdf

Association for Project Management

Details on CBSE Compartment Exam.pptx1111

GangaMaiya1

Play hard learn harder: The Serious Business of Play

Pooky Knightsmith

FICTIONAL SALESMAN/SALESMAN SNSW 2024.pdf

Pondicherry University

Introduction to TechSoup’s Digital Marketing Services and Use Cases

TechSoup

Recently uploaded (20)

How to Add New Custom Addons Path in Odoo 17

dusjagr & nano talk on open tools for agriculture research and learning

FSB Advising Checklist - Orientation 2024

Ernest Hemingway's For Whom the Bell Tolls

REMIFENTANIL: An Ultra short acting opioid.pptx

Tatlong Kwento ni Lola basyang-1.pdf arts

What is 3 Way Matching Process in Odoo 17.pptx

COMMUNICATING NEGATIVE NEWS - APPROACHES .pptx

Orientation Canvas Course Presentation.pdf

SPLICE Working Group:Reusable Code Examples

21st_Century_Skills_Framework_Final_Presentation_2.pptx

Simple, Complex, and Compound Sentences Exercises.pdf

Michaelis Menten Equation and Estimation Of Vmax and Tmax.pptx

When Quality Assurance Meets Innovation in Higher Education - Report launch w...

Jamworks pilot and AI at Jisc (20/03/2024)

Including Mental Health Support in Project Delivery, 14 May.pdf

Details on CBSE Compartment Exam.pptx1111

Play hard learn harder: The Serious Business of Play

FICTIONAL SALESMAN/SALESMAN SNSW 2024.pdf

Introduction to TechSoup’s Digital Marketing Services and Use Cases

1. The situation in which an individual is interviewing for a job

1. 1. The situation in which an individual is interviewing for a job also exhibits information asymmetry. Explain why. How does the relatively poorly informed party deal with this? In the situation in which an individual is interviewing for a job exhibits information asymmetry, the interviewer is the party with less information, while the person who comes to the interview is the party with more information. This may be because the candidate who came to the interview did not provide sufficient information. But when this happens, I think the interviewer cannot completely abandon the candidate, because it is very likely that the candidate has some difficulties or forgot to provide this information. For interviewers, I think they can learn about candidates by asking or chatting, such as their job wishes, experience, and future plans. They can also judge whether a candidate meets their requirements by knowing some basic information, such as academic qualifications. If there is a deliberate concealment of information, the candidate can be abandoned. Samantha Kim Mod 4 Discussion COLLAPSE Top of Form The situation in which an individual is interviewing for a job also exhibits information asymmetry. Explain why. How does the relatively poorly informed party deal with this? The situation where an individual is interviewing for a job is an example of information asymmetry because the interviewer has to depend on the information given by the individual in order to come to a conclusion about the potential candidate. The candidate has more information about themselves than does the interviewer, and given this advantage can retain potential flaws

2. which could hurt their chances at receiving the position. Another reason could be that the worker could exaggerate some of their traits as well as their willingness to work after receiving an offer for the job. The interviewer in this situation can look at other factors such as education and grades to assess the candidate's work ethic and ability to perform. Bottom of Form Needed 175 words Initial Post for each of the discussion and two replies of 60 words for each discussion. Mod 1 Discussion Distinguish between cost-benefit analysis (CBA) and cost effectiveness analysis (CEA). Can CEA replace CBA in all cases? If not, why not? Mod 2 Discussion Someone says the following: “Lifestyle may be the most important determinant of health status, but changing lifestyles may not be the least costly way to improve population health status.” Explain the circumstances under which this opinion could be true. What does the evidence on lifestyle suggest about government policies to improve the public’s overall health? Mod 3 Discussion The situation in which an individual is interviewing for a job also exhibits information asymmetry. Explain why. How does the relatively poorly informed party deal with this?

1. The situation in which an individual is interviewing for a job

Recommended

Recommended

More Related Content

Similar to 1. The situation in which an individual is interviewing for a job

Similar to 1. The situation in which an individual is interviewing for a job (20)

More from AbbyWhyte974

More from AbbyWhyte974 (20)

Recently uploaded

Recently uploaded (20)

1. The situation in which an individual is interviewing for a job