1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE). 2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser) 3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’. 4. Click the region below the box marked “Start MultiAlin’. This starts your comparison 5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR. 6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison. 7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2. 8. Click the “Start MultiAlin” just like before. 9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3? 10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer. 11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike. COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike) There are 3 genes below… they start with the > symbol… >gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434 TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA CCACTGAAACCGCCCCCGC ...

1. 1. The 3 genes that you will compare at listed below. Take a
look. I’ve colored ‘the header region’ of each so that you can
distinguish one from the other. DO NOT CHANGE THE
FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU
COPY THE GENE DON’T FORGET TO INCLUDE THE
‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol
tells the software the start of the gene. and the red region
DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare
them). The link is http://multalin.toulouse.inra.fr/multalin/
(cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste
into the “white box-region” just below region marked Sequence-
data. Make sure you copy the entire sequence for each gene
including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’.
This starts your comparison
5. Examine results. Make note of the colors. If the colors are
‘alike’ that means the sequences are similar. THIS PROGRAM
USES COLOR TO DETERMINE HOW SIMILAR 2
SEQUENCES ARE.SAME COLOR MEANS THEY ARE
SIMILAR.
6. Use the back-space button and return to the original screen.
Delete the sequences in the white box. This allows for a new
comparison.
7. Paste sequences 2 and 3 in the box. this allows for
comparison of sequences 2 and 3, similar to what was done for
1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1

2. and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of
1-2 and separately, 2-3. Doesn’t matter if you don’t have color
printer.
11. Or… at the bottom of the image page, there is a command --
- “Results as a gif file’. It is located under the region marked,
‘AVAILABLE FILES’… Click on this (Results as a gif file’)
and print your results. Staple the first comparison to the
second, and turn in. or give as computer file. Which ever are
more convenient? Tell me which 2 comparisons (ie, genes) are
more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly
alike; blue = different sequence). I want you to take note of the
sequences that red compared to those regions that are blue…)…
the bottom = summary of the comparison- gene 1 versus 2)
(more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for
growth arrest-specific 2 like 1 isoform a variant, clone:
JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTG
GCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGC
CACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGC
CCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGG
CCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCT

3. GGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCT
GGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCA
GCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGCACCAGGGACTCCTGCCCGCG
GCCCCCGCATGACACCCAGCGACCTGCGCAA
CCTCGACGAGCTGGTGAGGGAGATTCTGGGCCGCTGCAC
CTGCCCTGACCAGTTTCCCATGATCAAGGTC
TCAGAGGGGAAGTACCGTGTGGGGGACTCGAGCCTGCTC
ATCTTTGTGCGGGTGCTGAGGAGCCACGTGA
TGGTGCGAGTGGGTGGTGGCTGGGACACGCTGGAGCATT
ACCTGGACAAGCACGACCCGTGCCGCTGCTC
CTCCACTGCTCATCGCCCACCCCAGCCGAGGGTCTGCACC
TTTTCTCCACAGAGGGTGTCGCCCACCACC
>gi|21961309|gb|BC034582.1| Homo sapiens keratin associated
protein 3-2, mRNA (cDNA clone MGC:34106
IMAGE:3909612), complete cds
CCTCATCTAAGAAACTGAAAGCTAACCAGACGCCCATTGC
CATGGATTGCTGTGCCTCTCGCAGCTGCAG
TGTCCCCACTGGGCCTGCCACCACCATCTGCTCCTCCGAC
AAATCCTGCCGCTGTGGAGTCTGCCTGCCC
AGCACCTGCCCACACACAGTTTGGTTACTGGAGCCCATCT
GCTGTGACAACTGTCCCCCACCCTGCCACA
TTCCTCAGCCCTGCGTGCCCACCTGCTTCCTGCTCAACTCC

4. TGCCAGCCAACTCCGGGCCTGGAGACCCT
CAACCTCACCACCTTCACTCAGCCCTGCTGTGAGCCCTGC
CTCCCAAGAGGCTGCTGATGGATGGCTACT
TTGCTCAGTGCCCGACAACGAAGAATCCAGAAGCTGTCCC
TTCAGTATTCACTTGCCTCAGTAGTTTGCC
AGATGTTAAGGTAGACCAGATGACCCAGATATGAAGAAC
TTACCTTTGGTTTTAATGGGGGAAAAAAAGA
AAAGTATTTTTTATGGTTATTTAGCTGAAAAACCATTTGG
TTCCTGTGGGCAGGTGAATGAGTTTTATTA
GCAAAATACTGTTTCAATCTTTAAGACCTCAGATTACATG
TTCTTGATCATATTGCTTCCTGGCTCTTGT
TTCTTGTACTGGGTATTTTCATAGAAGAAAATTTCTTGGT
GGGTTTTCCAATAAACTATATTTCTCTGGC
>gi|12655437|emb|AJ406932.1| Homo sapiens mRNA for
keratin associated protein 5.3 (KRTAP 5.3 gene)
AAGAAACTGAAAGCTAACCAGACGCCCATTGCCATGGAT
TGCTGTGCCTCTCGCAGCTGCAGTGTCCCCA
CTGGGCCTGCCACCACCATCTGCTCCTCCGACAAATCCTG
CCGCTGTGGAGTCTGCCTGCCCAGCACCTG
CCCACACACAGTTTGGTTACTGGAGCCCATCTGCTGTGAC
AACTGTCCCCCACCCTGCCACATTCCTCAG
CCCTGCGTGCCCACCTGCTTCCTGCTCAACTCCTGCCAGC
CAACTCCGGGCCTGGAGACCCTCAACCTCA
ACATCCAGGCCGTGCGCACCCAGGAGAAGGAGCAGATCA

5. AGACCCTCAACAACAAGTTTGCCTCCTTCAT
AGACAAGGTACGGTTCCTGGAGCAGCAGAACAAGATGCT
GGAGACCAAGTGGAGCCTCCTGCAGCAGCAG
AGGTAGACCAGATGACCCAGATATGAAGAACTTACCTTT
GGTTTTAATGGGGGAAAAAAAAGAAAAGTAT
TTTTTATGGTTATTTAGCTGAAAAACCATTTGGTTCCTGTG
GGCAGGTGAATGAGTTTTATTAGCAAAAT
ACTGTTTCAATCTTTAAGACCTCAGATTCATGTTCTTGATC
ATATTGCTTCCTGGCTCTTGTTTCTTGTA
CTGGGTATTTTCATAGAAGAAAATTTCTTGGTGGGTTTTC
CAATAAACTATATTTCTCTGGCAAAAAAAA
(Student Name)
Miami Regional University
Date of Encounter:
Preceptor/Clinical Site:
Clinical Instructor: Dr. David Trabanco DNP, APRN, AGNP-C,
FNP-C
Soap Note # Main Diagnosis ( Exp: Soap Note #3 DX:
Hypertension)
PATIENT INFORMATION
Name: Mr. DT
Age: 68-year-old
Gender at Birth: Male
Gender Identity: Male
Source: Patient
Allergies: PCN, Iodine

6. Current Medications:
· Atorvastatin tab 20 mg, 1-tab PO at bedtime
· ASA 81mg po daily
· Multi-Vitamin Centrum Silver
PMH: Hypercholesterolemia
Immunizations: Influenza last 2018-year, tetanus, and hepatitis
A and B 4 years ago.
Preventive Care: Coloscopy 5 years ago (Negative)
Surgical History: Appendectomy 47 years ago.
Family History: Father- died 81 does not report information
Mother-alive, 88 years old, Diabetes Mellitus,
HTN
Daughter-alive, 34 years old, healthy
Social History: No smoking history or illicit drug use,
occasional alcoholic beverage consumption on social
celebrations. Retired, widow, he lives alone.
Sexual Orientation: Straight
Nutrition History: Diets off and on, Does not each seafood
Subjective Data:
Chief Complaint: “headaches” that started two weeks ago
Symptom analysis/HPI:
The patient is 65 years old male who complaining of episodes of
headaches and on 3 different occasions blood pressure was
measured, which was high (159/100, 158/98 and 160/100
respectively). Patient noticed the problem started two weeks ago
and sometimes it is accompanied by dizziness. He states that he
has been under stress in his workplace for the last month.
Patient denies chest pain, palpitation, shortness of breath,
nausea or vomiting.
Review of Systems (ROS)
CONSTITUTIONAL: Denies fever or chills. Denies weakness or
weight loss. NEUROLOGIC: Headache and dizziness as
describe above. Denies changes in LOC. Denies history of
tremors or seizures.
HEENT: HEAD: Denies any head injury, or change in LOC.

7. Eyes: Denies any changes in vision, diplopia or blurred vision.
Ear: Denies pain in the ears. Denies loss of hearing or drainage.
Nose: Denies nasal drainage, congestion. THROAT: Denies
throat or neck pain, hoarseness, difficulty swallowing.
RESPIRATORY: Patient denies shortness of breath, cough or
hemoptysis.
CARDIOVASCULAR: No chest pain, tachycardia. No orthopnea
or paroxysmal nocturnal
dyspnea.
GASTROINTESTINAL: Denies abdominal pain or discomfort.
Denies flatulence, nausea, vomiting or
diarrhea.
GENITOURINARY: Denies hematuria, dysuria or change in
urinary frequency. Denies difficulty starting/stopping stream of
urine or incontinence.
MUSCULOSKELETAL: Denies falls or pain. Denies hearing a
clicking or snapping sound.
SKIN: No change of coloration such as cyanosis or jaundice, no
rashes or pruritus.
Objective Data:
VITAL SIGNS: Temperature: 98.5 °F, Pulse: 87, BP: 159/92
mmhg, RR 20, PO2-98% on room air, Ht- 6’4”, Wt 200 lb, BMI
25. Report pain 2/10.
GENERAL APPREARANCE: The patient is alert and oriented x
3. No acute distress noted. NEUROLOGIC: Alert, CNII-XII
grossly intact, oriented to person, place, and time. Sensation
intact to bilateral upper and lower extremities. Bilateral UE/LE
strength 5/5.
HEENT: Head: Normocephalic, atraumatic, symmetric, non-
tender. Maxillary sinuses no tenderness. Eyes: No conjunctival
injection, no icterus, visual acuity and extraocular eye
movements intact. No nystagmus noted. Ears: Bilateral canals
patent without erythema, edema, or exudate. Bilateral tympanic
membranes intact, pearly gray with sharp cone of light.

8. Maxillary sinuses no tenderness. Nasal mucosa moist without
bleeding. Oral mucosa moist without lesions,. Lids non-
remarkable and appropriate for race.
Neck: supple without cervical lymphadenopathy, no jugular vein
distention, no thyroid swelling or masses.
CARDIOVASCULAR: S1S2, regular rate and rhythm, no
murmur or gallop noted. Capillary refill < 2 sec.
RESPIRATORY: No dyspnea or use of accessory muscles
observed. No egophony, whispered pectoriloquy or tactile
fremitus on palpation. Breath sounds presents and clear
bilaterally on auscultation.
GASTROINTESTINAL: No mass or hernia observed. Upon
auscultation, bowel sounds present in all four quadrants, no
bruits over renal and aorta arteries. Abdomen soft non-tender,
no guarding, no rebound no distention or organomegaly noted
on palpation
MUSKULOSKELETAL: No pain to palpation. Active and
passive ROM within normal limits, no stiffness.
INTEGUMENTARY: intact, no lesions or rashes, no cyanosis or
jaundice.
ASSESSMENT:
Main Diagnosis
Essential (Primary) Hypertension (ICD10 I10): Given the
symptoms and high blood pressure (156/92 mmhg), classified as
stage 2. Once the organic cause of hypertension has been ruled
out, such as renal, adrenal or thyroid, this diagnosis is
confirmed (Codina Leik, 2015). Diagnosis is based on the
clinical evaluation through history, physical examination, and
routine laboratory tests to assess risk factors, reveal identifiable
causes and detect target-organ damage, including evidence of
cardiovascular disease (Domino et al,. 2017).
Differential diagnosis:
· Renal artery stenosis (ICD10 I70.1)

9. · Chronic kidney disease (ICD10 I12.9)
· Hyperthyroidism (ICD10 E05.90)
PLAN:
Labs and Diagnostic Test to be ordered:
· CMP
· Complete blood count (CBC)
· Lipid profile
· Thyroid-stimulating hormone (TSH)
· Urinalysis with Micro
· Electrocardiogram (EKG 12 lead)
Pharmacological treatment:
· Hydrochlorothiazide tab 25 mg, Initial dose: 25 mg orally
once daily.
· Lisinopril 10mg PO Daily
Non-Pharmacologic treatment:
· Weight loss
· Healthy diet (DASH dietary pattern): Diet rich in fruits,
vegetables, whole grains, and low-fat dairy products with
reduced content of saturated and trans l fat
· Reduced intake of dietary sodium: <1,500 mg/d is optimal
goal but at least 1,000 mg/d reduction in most adults
· Enhanced intake of dietary potassium
· Regular physical activity (Aerobic): 90–150 min/wk
· Tobacco cessation
· Measures to release stress and effective coping mechani sms.
Education
· Provide with nutrition/dietary information.
· Daily blood pressure monitoring log at home twice a day for 7
days, keep a record, bring the record on the next visit with her
PCP
· Instruction about medication intake compliance.
· Education of possible complications such as stroke, heart
attack, and other problems.

10. · Patient was educated on course of hypertension, as well as
warning signs and symptoms, which could indicate the need to
attend the E.R/U.C. Answered all pt. questions/concerns. Pt
verbalizes understanding to all
Follow-ups/Referrals
· Follow up appointment 1 weeks for managing blood pressure
and to evaluate current hypotensive therapy.
· No referrals needed at this time.
References
Codina Leik, M. T. (2014). Family Nurse Practitioner
Certification Intensive Review (2nd ed.).
ISBN 978-0-8261-3424-0
Domino, F., Baldor, R., Golding, J., Stephens, M. (2017). The
5-Minute Clinical Consult 2017
(25th ed.). Print (The 5-Minute Consult Series).
Grading Rubric
Student______________________________________
This sheet is to help you understand what we are looking for,
and what our margin remarks might be about on your write ups
of patients. Since at all of the white-ups that you hand in are
uniform, this represents what MUST be included in every write-
up.
1) Identifying Data (___5pts): The opening list of the note. It
contains age, sex, race, marital status, etc. The patient
complaint should be given in quotes. If the patient has more
than one complaint, each complaint should be listed separately
(1, 2, etc.) and each addressed in the subjective and under the
appropriate number.
2) Subjective Data (___30pts.): This is the historical part of the

11. note. It contains the following:
a) Symptom analysis/HPI(Location, quality , quantity or
severity, timing, setting, factors that make it better or worse,
and associate manifestations.(10pts).
b) Review of systems of associated systems, reporting all
pertinent positives and negatives (10pts).
c) Any PMH, family hx, social hx, allergies, medications related
to the complaint/problem (10pts). If more than one chief
complaint, each should be written u in this manner.
3) Objective Data(__25pt.): Vital signs need to be present.
Height and Weight should be included where appropriate.
a) Appropriate systems are examined, listed in the note and
consistent with those identified in 2b.(10pts).
b) Pertinent positives and negatives must be documented for
each relevant system.
c) Any abnormalities must be fully described. Measure and
record sizes of things (likes moles, scars). Avoid using “ok”,
“clear”, “within normal limits”, positive/ negative, and
normal/abnormal to describe things. (5pts).
4) Assessment (___10pts.): Diagnoses should be clearly listed
and worded appropriately.
5) Plan (___15pts.): Be sure to include any teaching, health
maintenance and counseling along with the pharmacological and
non-pharmacological measures. If you have more than one
diagnosis, it is helpful to have this section divided into separate
numbered sections.
6) Subjective/ Objective, Assessment and Management and
Consistent (___10pts.): Does the note support the appropriate
differential diagnosis process? Is there evidence that you know
what systems and what symptoms go with which complaints?

12. The assessment/diagnoses should be consistent with the
subjective section and then the assessment and plan. The
management should be consistent with the assessment/
diagnoses identified.
7) Clarity of the Write-up(___5pts.): Is it literate, organized and
complete?
Comments:
Total Score: ____________
Instructor: __________________________________
Guidelines for Focused SOAP Notes
· Label each section of the SOAP note (each body part and
system).
· Do not use unnecessary words or complete sentences.
· Use Standard Abbreviations
S: SUBJECTIVE DATA (information the patient/caregiver tells
you).
Chief Complaint (CC): a statement describing the patient’s
symptoms, problems, condition, diagnosis, physician-
recommended return(s) for this patient visit. The patient’s own
words should be in quotes.
History of present illness (HPI): a chronological description of
the development of the patient's chief complaint from the first
symptom or from the previous encounter to the present. Include
the eight variables (Onset, Location, Duration, Characteristics,
Aggravating Factors, Relieving Factors, Treatment, Severity-
OLDCARTS), or an update on health status since the last
patient encounter.

13. Past Medical History (PMH): Update current medications,
allergies, prior illnesses and injuries, operations and
hospitalizations allergies, age-appropriate immunization status.
Family History (FH): Update significant medical information
about the patient's family (parents, siblings, and children).
Include specific diseases related to problems identified in CC,
HPI or ROS.
Social History(SH): An age-appropriate review of significant
activities that may include information such as marital status,
living arrangements, occupation, history of use of drugs,
alcohol or tobacco, extent of education and sexual history.
Review of Systems (ROS). There are 14 systems for review.
List positive findings and pertinent negatives in systems
directly related to the systems identified in the CC and
symptoms which have occurred since last visit; (1)
constitutional symptoms (e.g., fever, weight loss), (2) eyes, (3)
ears, nose, mouth and throat, (4) cardiovascular, (5) respiratory,
(6) gastrointestinal, (7) genitourinary, (8) musculoskeletal, (9-
}.integument (skin and/or breast), (10) neurological, (11)
psychiatric, (12) endocrine, (13) hematological/lymphatic, {14)
allergic/immunologic. The ROS should mirror the PE findings
section.
0: OBJECTIVE DATA (information you observe, assessment
findings, lab results).
Sufficient physical exam should be performed to evaluate areas
suggested by the history and patient's progress since last visit.
Document specific abnormal and relevant negative findings.
Abnormal or unexpected findings should be described. You
should include only the information which was provided in the
case study, do not include additional data.
Record observations for the following systems if applicable to
this patient encounter (there are 12 possible systems for
examination): Constitutional (e.g. vita! signs, general
appearance), Eyes, ENT/mouth, Cardiovascular, Respiratory,
GI, GU, Musculoskeletal, Skin, Neurological, Psychiatric,
Hematological/lymphatic/immunologic/lab testing. The

14. focused PE should only include systems for which you have
been given data.
NOTE: Cardiovascular and Respiratory systems should be
assessed on every patient regardless of the chief complaint.
Testing Results: Results of any diagnostic or lab testing ordered
during that patient visit.
A: ASSESSMENT: (this is your diagnosis (es) with the
appropriate ICD 10 code)
List and number the possible diagnoses (problems) you have
identified. These diagnoses are the conclusions you have drawn
from the subjective and objective data.
Remember:Your subjective and objective data should support
your diagnoses and your therapeutic plan.
Do not write that a diagnosis is to be "ruled out" rather state the
working definitions of each differential or primary diagnosis
(es).
For each diagnoses provide a cited rationale for choosing this
diagnosis. This rationale includes a one sentence cited
definition of the diagnosis (es) the pathophysiology, the
common signs and symptoms, the patients presenting signs and
symptoms and the focused PE findings and tests results that
support the dx. Include the interpretation of all lab data given in
the case study and explain how those results support your
chosen diagnosis.
P: PLAN (this is your treatment plan specific to this patient).
Each step of your plan must include an EBP citation.
1. Medications write out the prescription including dispensing
information and provide EBP to support ordering each
medication. Be sure to include both prescription and OTC
medications.
2. Additional diagnostic tests include EBP citations to support
ordering additional tests
3. Education this is part of the chart and should be brief, this is
not a patient education sheet and needs to have a reference.
4. Referrals include citations to support a referral

15. 5. Follow up. Patient follow-up should be specified with time or
circumstances of return. You must provide a reference for your
decision on when to follow up.