1. PortfolioYou are expected to collate a portfolio of items to

•Download as DOCX, PDF•

0 likes•2 views

You are required to compile a portfolio demonstrating your learning from this module and your program. The portfolio should include a current CV, self-reflection on your strengths and weaknesses in transversal skills, and a development plan to improve skills identified. A second submission will provide a log showing how you followed your development plan to enhance your employability through the program.

Education

1. Portfolio
You are expected to collate a portfolio of items to demonstrate
your learning achieved during this
module as well as you programme.
Purpose of Portfolio:
• Reflect on your strengths and weaknesses in relation to
transversal skills (including
academic skills).
• Prepare a development plan to develop/enhance skills as a
result from the self-reflection.
• Provide a log of activities to demonstrate how you have
followed your development plan.
• Demonstrate overall, your enhanced employability as a result
of the programme.
Your portfolio will be submitted in two sets:
Portfolio Set 1
This should include the following:
a) Current CV
b) Reflective Self-analysis of Skills
c) Skills Development Plan

1. PortfolioYou are expected to collate a portfolio of items to

More from AbbyWhyte974

1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive. 2. See the list of example speech occasions and purposes for inspiration, if needed. 3. Plan your speech, considering what your introduction, main points, and conclusion will include. 4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action. 5. Create notes or bullet points that you can refer to while presenting your speech. 6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length. 7. Before filming, review the rubric to ensure that you understand how you will be evaluated. 8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera. 9. Review your video to ensure that you can be seen and heard. Refilm as needed. 10. Review the checklist and requirements to ensure that your Touchstone is complete. 11. Upload your video using the blue button at the top of this page. ...

1. Think about a persuasive speech that you would like to present

AbbyWhyte974

1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are: a. frequency and average. b. average and correlation. c. central tendency and dispersion. d. histograms and polygons. 2. The ________________ is the sum of all the scores divided by the number of scores. a. median b. mean c. mode d. standard deviation 3. The generally preferred measure of central tendency is usually the a. range b. mean c. standard deviation d. Median 4. Which of the following is the most useful descriptive statistic for measuring dispersion? a. Range b. Variance c. mean deviation d. standard deviation 5. The standard deviation is a. the square of the variance. b. the square root of the variance. c. smaller than the mean. d. the difference between the highest and lowest scores. 6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of a. 1.00 b. 0.00 c. 2.00 d. -2.00 7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________. a. manipulation; chance b. manipulation; experimental error c. sampling error; independent variable d. independent variable; experimental error 8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s). a. different; different b. different; the same c. the same; different d. the same; the same 9. The power of a statistical test refers to its ability to a. reject false null hypotheses. b. reject false experimental hypotheses. c. reject true null hypotheses. d. reject true experimental hypotheses. 10. Simple analysis of variance is used in designs having a. one independent variable b. more than one independent variable c. more than one independent variable (IV) but less than four IVs d. more than one dependent variable 11. The number of participants in a study is denoted by a. s. b. n. c. z. d. r. 12. A _____________ is a complete set of measurements. a. sample b. population c. random sampling d. parameter 13. _____________ is one way of ensuring that a sample is representative of the population. a. The two-tailed test b. The between-subjects design c. The sign test d. Random sampling 14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of a. average young, white, college males. b. college male students. c. college students. d. young adults. 15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error a. 5% of the time. b. 10% of the time. c. 15% of the time. d. 95% of the time. 16. Which of the following would be considered the most conservative alpha level ...

1. The two properties about a set of measurements of a dependent v

AbbyWhyte974

1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts. 1. Germany 5 9 2 6 10 3 7 4 8 2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts. City Country Vienna Austria 3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points 4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts 5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points 6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points 7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts 8. Name two sets of countries where Danube River (is) forms the border. Set 1: ________________________________ (2 countries) Set 2: _____________________________________ (2 countries) 4 points 9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points 10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points 11. What specific human activities have impacted fish life in the river? Name three. 3 points 12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points 13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it! 14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.” 2 points ...

1. The Danube River flows through 10 countries. Name them in the s

AbbyWhyte974

1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE). 2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser) 3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’. 4. Click the region below the box marked “Start MultiAlin’. This starts your comparison 5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR. 6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison. 7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2. 8. Click the “Start MultiAlin” just like before. 9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3? 10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer. 11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike. COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike) There are 3 genes below… they start with the > symbol… >gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434 TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA CCACTGAAACCGCCCCCGC ...

1. The 3 genes that you will compare at listed below. Take a look.

AbbyWhyte974

1. Student and trainer details Student details Full name: Student ID: Contact number: Email address: Trainer details Full name: 2. Qualification and unit of competency Qualification/Course/Program Details Code: Name: Unit of competency Code: CPCCCA3014 Name: Construct and install bulkheads Releases: 1.0 Release date: 27/Nov/2020 3. Assessment Submission Method ☐ By hand to trainer/assessor ☐ By email to trainer/assessor ☐ Online submission via Learning Management System (LMS) ☐ Any other method _________________________________________________ (Please describe here) 4. Student declaration · I have read and understood the information in the Unit Requirements prior to commencing this Student Pack · I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice; · I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack; · For the purposes of assessment, I give the trainer/assessor permission to: · Reproduce this assessment and provide a copy to another member of staff; and · Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking). Student signature: ________________________________ Date: ____/_____/______________ 5. Assessment Plan The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways. Evidence number/ Task number Assessment method/ Type of evidence/ Task name Sufficient evidence recorded/Outcome Assessment task 1 Knowledge Test (KT) S / NS (First Attempt) S / NS (Second Attempt) Assessment task 2 Skill Test (ST) S / NS (First Attempt) S / NS (Second Attempt) Outcome C ☐ NYC ☐ Date assessed: Trainer signature: 6. Completion of the Assessment Plan Your trainer is required to fill out the Assessment Plan Outcome records above, when: · You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency. · Your work has been reviewed and assessed by your trainer/assessor. · You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency. · You have been provided with relevant and detailed feedback. Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as: · Result of Assessment (satisfactory or unsatisfactory) · Student name, signature and date · Assessor name, signature and date · Relevant and detailed feedback 7. U ...

1. Student and trainer detailsStudent details Full nameStu

AbbyWhyte974

1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors. 2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors. 3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library. 4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input. 5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors. 6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment. 7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors. CASE STUDY—BEWARE: One Emergency May Hide Another! A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy. THE NURSE'S STORY—SALLY SIMMS, RN I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career. I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment. One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...

1. Student uses MS Excel to calculate income tax expense or refund

AbbyWhyte974

1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him? 2. Plato - Of his many ideas, which do you think has been his most influential, and why? 3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous? 4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals? 7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it. 8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism. 9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776. 10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be? 11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system? 12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...

1. Socrates - In your view, what was it about Socrates’ teachings

AbbyWhyte974

1. Select a “patient” (friend or family member) on whom to perform a complete H&P. 2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE. 3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format. 4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format. 5. The SOAP Note must contain all required elements as outlined in the rubric below. 6. You must self-score your SOAP note using the rubric and attach it to the assignment. Criteria Ratings Points Thread Content 50 to >46.0 pts Advanced 47 to 50 points All key components of the Discussion Board Forum prompt are answered in the thread. Major points are supported by all of the following: *Reading & Study materials; *Pertinent, conceptual, or personal examples; *Thoughtful analysis (considering assumptions, analyzing implications, and comparing/contrasting concepts); and *Source citations in current APA format, include the required 7 or more from personal research, the course readings, and the integration of 1 biblical principle. 46 to >43.0 pts Proficient 44 to 46 points Some key components of the Discussion Board Forum prompt are answered in the thread. Major points are supported by some of the following): *Reading & Study materials; *Pertinent, conceptual, or personal examples; *Thoughtful analysis (considering assumptions, analyzing implications, and comparing/contrasting concepts); and *Source citations in current APA format, include the required 7 or more from personal research, the course readings, and the integration of 1 biblical principle. 43 to >0.0 pts Developing Minimal key components of the Discussion Board Forum prompt are answered in the thread. Major points are supported by some or none of the following: *Reading & Study materials; *Pertinent, conceptual, or personal examples; *Thoughtful analysis (considering assumptions, analyzing implications, and comparing/contrasting concepts); and *Source citations in current APA format, include the required 7 or more from personal research, the course readings, and the integration of 1 biblical principle 0 pts Not Present 50 pts Replies Content 41 to >39.0 pts Advanced Contribution made to discussion with each reply expounding on the thread. Major points are supported by all of the following: *Reading & Study materials; *Pertinent, conceptual, or personal examples; *Thoughtful analysis (considering assumptions, analyzing implications, and comparing/contrasting concepts); and *Three peer-reviewed source citations in current APA format, and the integration of 1 biblical principle. 39 to >35.0 pts Proficient Marginal contribution made to discussion with each reply slightly exp ...

1. Select a patient” (friend or family member) on whom to perform

AbbyWhyte974

1. Respond to your classmates’ question and post. Submission to your classmates must meet a minimum requirement of 50 Curiosity Points to count for credit. 1. What is the thesis of your Response? 1. Defend your Response in 200 words or less PEERS QUESTION AND POST: How does having a growth mindset affect students? When having a growth mindset, you will always believe that there is room to grow. You will not be comfortable and complacent. With a growth mindset, you are always wanting to become better. It helps students know that they are not stuck and that they can achieve any goal they want. I believe that having that growth mindset gives students motivation to want to do better and be better. - Gabriella Enriquez https://biglifejournal.com/blogs/blog/teach-growth-mindset-kids-activities Procedia Engineering 69 ( 2014 ) 830 – 837 Available online at www.sciencedirect.com 1877-7058 © 2014 The Authors. Published by Elsevier Ltd. Open access under CC BY-NC-ND license. Selection and peer-review under responsibility of DAAAM International Vienna doi: 10.1016/j.proeng.2014.03.060 ScienceDirect 24th DAAAM International Symposium on Intelligent Manufacturing and Automation, 2013 Thinking Styles and Product Development Project Types: How to Match Them? Anja Orcik*, Petar Vrgovic, Zeljko Tekic Faculty of Technical Sciences, University of Novi Sad, Trg Dositeja Obradovica 6, 21000 Novi Sad, Serbia Abstract Focusing on the characteristics of different thinking styles and different product development project types, we suggest that people should adapt their thinking strategies according to the challenge they face and choose a thinking style that is a best match for the type of project they are working on. Even though people can perform well in more than one thinking style, they can be more successful if they adequately choose the most appropriate one for solving the problem in front of them. Considering that different thinking styles have different ideas and conclusions as results, we propose how to match them to a specific product development project type that has a certain degree of change in the product as a deliverable. For further research, these findings open the possibility to define the most appropriate creative problem solving methods and techniques that spur and support a specific style of thinking. © 2014 The Authors. Published by Elsevier Ltd. Selection and peer-review under responsibility of DAAAM International Vienna. Keywords: Thinking styles; Brain Dominance Instrument; Product development projects; Problem solving 1. Introduction Product development has been defined as one of the riskiest, yet most important endeavours of the modern corporation [1]. To respond to the changing environment and stay competitive in long-term, companies need to provide quality, variety, novelty and functionality of products for their customers [2]. This requires constant improvement of existing products, as we ...

1. Respond to your classmates’ question and post. Submission to y

AbbyWhyte974

1. Review the HCAPHS survey document, by clicking on the hyperlink

AbbyWhyte974

1. Saint Leo Portal loginUser ID[email protected]

AbbyWhyte974

1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties polling data is based on this aspect of Parties Rep. Senfronia Thompson filed for the role of Speaker of Texas House In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom a sector of a political party (ex. Trump Republican, conservative Democrat) is called 2. Which candidate’s office is chosen/nominated by delegate convention? sheriff of Medina County U.S. congressman from the 4th Texas congressional district president of the United States governor of Texas 3. Which statement best depicts the effect of redistricting on representative democracy? Legislators represent the same number of Republicans and Democratic voters representation is mostly based on geographic cohesion representation is mostly based on the voting patterns of Texas residents gerrymandering is a legitimate method of forming districts 4. The difference between absentee ballot and mail-in ballot is? absentee is for people residing outside of their state mail-in ballots are issued to people who can't go to polls in some states there is no difference, as all ballots are mailed in in Texas mail-in ballots require doctors note 5 Unlike the US, most democratic governments have _______ political systems with _______. 2-party//direct representation Multi-party//proportional 2-party//direct representation multi-party//proportional representation independent party//single-member districts 2-party//single-member districts [ Choose ] [ Choose ] [ Choose ] Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04 My Car Data MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...

1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea

AbbyWhyte974

1. Read the story first. 2. Bold Face Terms: Make a separate list of all the definitions of the bold face terms in the story first from your reference sources like a medical dictionary or website etc. Start by listing all the bold face medical terms and their definitions and cite your sources of reference. Example: appendectomy: the surgical excision of the organ known as the appendix which is a vestigial organ (Webster, 2010) Then list all your full references at the bottom of your work. Submit this list as part of your work. 3. Translate definitions into simple terms and insert them into the story: Next, translate all of the bold faced medical terms into simple language as if you are explaining it to a patient or to someone who may not understand medical terminology and incorporate these simple translations into your story. This means you should remove the actual medical terms in bold face print but leave the meaning in place with your translated explanations of these terms. Your finished work should be easily understood. It is OK to alter the sentence structure to accomodate your translations. Remember to use simple basic language to explain these complicated medical terms to another person. Highlight your new translation either by bold facing or capitalizing the words. Do not just insert the definitions. You will not get credit for this and points will be taken off. The goal here is for you to learn how make the complicated sound simple. Example: Initial sentence with medical term in place: The patient is having an appendectomy. Translation into simple terms in your story: The patient is have his appendix cut out and removed. In other words, rewrite the story completely in layman's terms or plain English so that someone without a medical or science background would be able to understand. Your translation must be clear and easy to understand. Take into account the context of how the terms were used. You must use all the bold faced terms "translated meanings" in your story. So when you are complete you will have a list of terms plus definitions (with sources cited) plus a rewritten story in plain English. 4. Submitting Your Completed Work: Submit your work on a Microsoft Word document using the attachment tool. Submit all work as one WORD document.. Your file name should end in .doc or .docx or you can use a plain text file format ending in .rtf If unsure how to do this please contact tech support. Include your list of definitions and your translated story and your references. Be sure to run a spell check on your work before submitting. If you have any difficulty using the attachment tool please call tech support for help. Exams may be worked on any time during the week but must be submitted on or before the due date. Submit your exam by clicking on the title of this section "Exam I -Due..." then scroll to the bottom of the page to submit your work. Exam 2 – part 1 Morticia was particularly interested in entering cosmetolog ...

1. Read the story first.2. Bold Face TermsMake a separate l

AbbyWhyte974

1. Read and summarize ERD paragraphs #: 59, 60, 61. 59. The free and informed judgment made by a competent adult patient concerning the use or withdrawal of life- sustaining procedures should always be respected and normally complied with, unless it is contrary to Catholic moral teaching. 60. Euthanasia is an action or omission that of itself or by intention causes death in order to alleviate suffering. Catholic health care institutions may never condone or participate in euthanasia or assisted suicide in any way. Dying patients who request euthanasia should receive loving care, psychological and spiritual support, and appropriate remedies for pain and other symptoms so that they can live with dignity until the time of natural death. 61. Patients should be kept as free of pain as possible so that they may die comfortably and with dignity, and in the place where they wish to die. Since a person has the right to prepare for his or her death while fully conscious, he or she should not be deprived of consciousness without a compelling reason. Medicines capable of alleviating or suppressing pain may be given to a dying person, even if this therapy may indirectly shorten the person’s life so long as the intent is not to hasten death. Patients experiencing suffering that cannot be alleviated should be helped to appreciate the Christian understanding of redemptive suffering. Ethical and Religious Directives for Catholic Health Care Services Sixth Edition UNITED STATES CONFERENCE OF CATHOLIC BISHOPS 2 Ethical and Religious Directives for Catholic Health Care Services, Sixth Edition This sixth edition of the Ethical and Religious Directives for Catholic Health Care Services was developed by the Committee on Doctrine of the United States Conference of Catholic Bishops (USCCB) and approved by the USCCB at its June 2018 Plenary Assembly. This edition of the Directives replaces all previous editions, is recommended for implementation by the diocesan bishop, and is authorized for publication by the undersigned. Msgr. J. Brian Bransfield, STD General Secretary, USCCB Excerpts from The Documents of Vatican II, ed. Walter M. Abbott, SJ, copyright © 1966 by America Press are used with permission. All rights reserved. Scripture texts used in this work are taken from the New American Bible, copyright © 1991, 1986, and 1970 by the Confraternity of Christian Doctrine, Washington, DC, 20017 and are used by permission of the copyright owner. All rights reserved. Digital Edition, June 2018 Copyright © 2009, 2018, United States Conference of Catholic Bishops, Washington, DC. All rights reserved. No part of this work may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or by any information storage and retrieval system, without permission in writing from the copyright holder. 3 Ethi ...

1. Read and summarize ERD paragraphs # 59, 60, 61. 59. T

AbbyWhyte974

1. PURPOSE: To document and evaluate teaching skills necessary to provide teaching to an individual client with a demonstrated need. With the completion of this assignment the student will be able to achieve the following objectives. a. Demonstrate ability to thoroughly assess the learning styles of an individual or family using given developmental or cultural models. b. Demonstrate ability to anticipate learning needs based on developmental or cultural assessments. c. Identify and utilize teaching/learning principles to facilitate achievement of learning goals and outcomes. d. Select and prioritize learning strategies based on the developmental or cultural assessment to achieve learning goals and outcomes. e. Support rationales for teaching plan using teaching and learning theories from required readings with references 2. NURSING COMPETENCIES: a. Assessing and identifying developmental, cultural, and socioeconomic factors affecting a client. b. Providing evidence-based health information and teaching based on developmental, cultural, and socioeconomic factors affecting a client or family c. Integrating teaching/learning activities into client interactions based on developmental, cultural, and socioeconomic factors affecting a client or family. d. Incorporating health promotion and teaching into the plan of care based on developmental, cultural, and socioeconomic factors affecting a family or client. 3. PLAN: submitted to the clinical instructor during the teaching experience. Your clinical instructor must approve the topic. a. Develop nursing diagnosis (NANDA) b. Develop two (2) learning objectives c. State methodology (teaching methods) d. Provide and utilize teaching aids e) e. State needed resources 4. This write-up should be 2-3 pages to follow the Teaching Experience Rubric. 5. SUGGESTED TOPICS FOR TEACHING PLAN: a. Mother’s with infants who have hyperbilirubinemia b. Maternal and neonatal infection c. Care of the Mother and Infant with Substance Abuse Problems d. Immunization schedule for the newborn e. Newborn care f. Post op cesarean section care g. Post vaginal delivery care h. Breastfeeding Course Number and Name Course: NURS 316L TEACHING EXPERIENCE PROJECT GUIDELINES & RUBRIC i. Postpartum depression Revision Date: Month, Year (i.e. February, 2010) Page 1 Page 1 of 3 TEACHING EXPERIENCE RUBRIC NAME: DATE: TOPIC:COURSE: START TIME: END TIME: Criteria 4 3 2 1-0 Score Comprehensive Assessment · Clear and concise discussion of patient’s admission diagnosis, demographic data, and anticipated learning needs · Clear and comprehensive patient assessment data to support a deficient knowledge nursing diagnosis. · Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and anticipated learning needs. · Vague and incomplete patient assessment data to support deficient knowledge nursing diagnosis. · Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and antici ...

1. PURPOSE To document and evaluate teaching skills necessary to

AbbyWhyte974

1. Rate yourself according to your confidence level performing the skills identified in the Clinical Skills Self-Assessment Form.  2. Based on your ratings, summarize your strengths and opportunities for improvement.   3. Based on your self-assessment and theory of nursing practice, develop four (4) measurable goals and objectives for a practicum experience.  4. Include them on the designated area of the form. Self-Assessment Form Desired Clinical Skills for Students to Achieve Confident (Can complete independently) Mostly confident (Can complete with supervision) Beginning (Have performed with supervision or needs supervision to feel confident) New (Have never performed or does not apply) Comprehensive psychiatric evaluation skills in: Recognizing clinical signs and symptoms of psychiatric illness across the lifespan X Differentiating between pathophysiological and psychopathological conditions X Performing and interpreting a comprehensive and/or interval history and physical examination (including laboratory and diagnostic studies) X Performing and interpreting a mental status examination X Performing and interpreting a psychosocial assessment and family psychiatric history X Performing and interpreting a functional assessment (activities of daily living, occupational, social, leisure, educational). X Diagnostic reasoning skill in: Developing and prioritizing a differential diagnoses list X Formulating diagnoses according to DSM 5 based on assessment data X Differentiating between normal/abnormal age-related physiological and psychological symptoms/changes X Pharmacotherapeutic skills in: Selecting appropriate evidence based clinical practice guidelines for medication plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management) X Evaluating patient response and modify plan as necessary X Documenting (e.g., adverse reaction, the patient response, changes to the plan of care) X Psychotherapeutic Treatment Planning: Recognizes concepts of therapeutic modalities across the lifespan X Selecting appropriate evidence based clinical practice guidelines for psychotherapeutic plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management, modality appropriate for situation) X Applies age appropriate psychotherapeutic counseling techniques with individuals and/or any caregivers X Develop an age appropriate individualized plan of care X Provide psychoeducation to individuals and/or any caregivers X Promote health and disease prevention techniques X Self-assessment skill: Develop SMART goals for practicum experiences X Evaluating outcomes of practicum goals and modify plan as necessary X Documenting and reflecting on learning experiences X Professional skills: Maintains professional boundaries and thera ...

1. Rate yourself according to your confidence level performing the

AbbyWhyte974

1. President William McKinley, letter to Congress, April 25, 1898. [I took action] under the joint resolution approved April 20, 1898, "for the recognition of the independence of the people of Cuba, demanding that the Government of Spain relinquish its authority and Government in the island of Cuba, and to withdraw its land and naval forces from Cuba and Cuban waters…" …The Government of Spain…responds by treating the reasonable demands of this Government as measures of hostility, following with that instant and complete severance of relations by its action which by the usage of nations accompanies an existent state of war between sovereign powers. I now recommend the adoption of a joint resolution declaring that a state of war exists between the United States of America and the Kingdom of Spain… 2. Teller Amendment, Adopted by the Senate, April 19, 1898 [The United States] hereby disclaims any disposition of intention to exercise sovereignty, jurisdiction, or control over said island except for pacification thereof, and asserts its determination, when that is accomplished, to leave the government and control of the island to its people. 3. Senator Alfred Beveridge (R-Indiana), in Congress, January 9, 1900. . . . [J]ust beyond the Philippines are China's illimitable markets. . . We will not renounce our part in the mission of our race, trustee of God, of the civilization of the world. . . Where shall we turn for consumers of our surplus?. . . China is our natural customer. . . [England, Germany and Russia] have moved nearer to China by securing permanent bases on her borders. The Philippines gives us a base at the door of all the East. . . They [the Filipinos] are a barbarous race, modified by three centuries of contact with a decadent race [the Spanish]. . . It is barely possible that 1,000 men in all the archipelago are capable of self-government in the Anglo-Saxon sense. . . The Declaration [of Independence] applies only to people capable of self-government. How dare any man prostitute this expression of the very elect of self-government peoples to a race of Malay children of barbarism, schooled in Spanish methods and ideas? And you, who say the Declaration applies to all men, how dare you deny its application to the American Indian? And if you deny it to the Indian at home, how dare you grant it to the Malay abroad. 4. President Woodrow Wilson, War Message to Congress, 1917 The Imperial German Government [announced that] it was its purpose to put aside all restraints of law or of humanity and use its submarines to sink every vessel that sought to approach either the ports of Great Britain and Ireland or the western coasts of Europe or any of the ports controlled by the enemies of Germany within the Mediterranean.… It is a war against all nations. American ships have been sunk, American lives taken, in ways which it has stirred us very deeply to learn of, but the ships and people of other neutral and friendly nations have been sunk and ...

1. President William McKinley, letter to Congress, April 25, 1898.

AbbyWhyte974

1. Prof. Lennart Van der Zeil’s theorem says that any programming language is complete if it can be used to write a program to compute any computable number. a. What is a computable number? b. What is a non-computable number? c. If all existing programming languages are complete why do we need more than one? 2. Two methodologies are used to transform programs written in a source language (also known as a programmer-oriented language, or a horizontal language, or a high-level language) into a target language (also known as a machine language, or a vertical language, or a low-level language). There is a static method called translation and a dynamic method called interpretation. Yet FORTRAN while 98% static ., uses interpretation for the Formatted I/O statement, similarly COBOL uses interpretation for the MOVE and MOVE CORRESPONDING statements; on the other hand, Java is fully interpretative except that in some programs and certain data sets it may invoke a JIT (Just In Time) compiler to execute a bit of static code. Why do language designers mix these modalities if either is complete? Hint: This is a long question with a short answer. 3. C and C++ store numerical arrays (matrices) in row major order and each index range must begin with 0; whereas FORTRAN stores arrays in column major order and the (default) index range starts (almost always) with 1. Engineers and scientists are often faced with the problem of converting a working program, or much more often a subroutine, from one language to another. Unfortunately, due to the index range difference (0 to n-1) in C/C++ and (1 to N) in FORTRAN, viewing one array as simply the transpose of the other will not suffice. What steps would you take to convert such a subroutine to compute the product of two matrices A(N,M) and B(M,N) to produce C(N,N) from FORTRAN to C++? 4. What was the major reason Jim Gosling invented Java? Did he succeed? 5. What are the four major features of C++ that were eliminated in Java? Why were they taken out? Why do we not miss them? 6. What was Kim Polese’ role at SUN Microsystems and why did she think Java should be positioned as a general purpose computer programming language? How did she accomplish this truly incredible feat, not done since Captain (later Admiral) Grace Murray Hopper, USN standardized COBOL in the early 1960s. 7. Describe briefly the role of women in the development of computer programming and computer programming languages. (Ada Lovelace, Betty Holberton, Grace Hopper, Mandaly Grems, Kim Polese, Laura Lemay) 8. What are the pros and cons of overloaded operators in C++? Java has only one, what is it? 9. State your own arguments for allowing mixed mode arithmetic statements. (See Ch 7) 10. What is BNF and why are meta-languages like BNF and EBNF used? ...

1. Prof. Lennart Van der Zeil’s theorem says that any programming

AbbyWhyte974

1. Preparing for assessment. Date Week 3 Session title Preparing for assessments Content covered Have enough knowledge on the university assessments before you start doing it. Comments on readings/practice. Making study plan and Managing time are the best method to have the peace of mind. Most interesting points Feeling organised when finish multiple assessments in the right time. Most difficult points Reading the academic articles and find the relative information that supports my topic, How to discuss more in depth. · Introduction The above session provided the best academic and coordination skills by explained the multiple essential tips of preparing properly for the assessments and considering the times determinant, which encouraged me to think and write professionally. · Reflection Discussion on the study plan for assessments As the English language is my second tongue, I have faced many difficulties with reading and writing academic articles. I found the above topic has a significant impact positively to prepare my assessments in advance, especially when it displays at the beginning of my first semester in the university. However, an ongoing experience on what I gained from this session has a huge impact on me. For instance, after this session, I organised a table that shows each type of the assessments separately, and each one has its basics and elements in its allotted box. As a result, while I’m doing my estimates, I refer to my table and find my structures ready, which helps me seize the time and be more skilled. · Reflection Discussion on prepare well for my assessments. As I'm in my first year at the university, I thought there was no need to have an entire assessments plan. Later on, I noticed that working on assessments without organising a plan affects the whole semester assessments, which might cause time conflict in the Assignments due date. I wasn't aware of how important it is the preparing and reading enough sources before start writing. However, Glancing and reading enough information can convert the assessment from stress work to exciting work, which will help set the scene and allow me to think critically and write academically. Based on the benefits that I acquired from the session, the critical thinking and in depth discussion in a particular topic will need to be supported by academic information from reading more articles and spend more time on this part of the work. After this session, I became able to organise my assessments, which allow me to have enough time to working on them and preventing some of the study stresses and cramming. Also, I have been able to take a period to refresh my mind and get my memory retention. However, there is no doubt that it encouraged me to provide the work in a prime manner. This experience will be beneficial in my subsequent semesters to develop my ability to be further organised in my study and aware of how to prepare before the assessments. Conclusion ...

1. Preparing for assessment. DateWeek 3Session titlePr

AbbyWhyte974

1. Project Description Definition of Project The supervision of workers' operations or corporate functions is difficult work for the administrative environment. Modern frameworks have certain limitations in the implementation of integrated workforce control functions. This project aims to improve the structure of EMS (employee management system). The new framework helps administrators to trace staff profiles, particularly their tasks, and it will capture the present position. The accompanying boss forecasts the workforce requirements by detailed information of workers and plans a valid timeline for each employee to reduce the difficulties of collaborative working. This project focuses on developing a user-friendly interface that helps supervisors reliably collect or store information for workers (Abdulhamid, Dada, & Ajibuwa, 2019). 2. Plan scale, deliverables, and outcomes This project has a high scope since many companies compete for previous techniques to monitor employee records, but face challenges with data quality and human-made errors. EMS enables organizations to capture, store and exchange the details needed about current and recently entered staff. The present state of the delegated activities of workers would inevitably be monitored by employee supervision and their responsibilities would also be mainly helpful. Through the use of the EMS framework, quality control levels will ultimately be possible to delegate workers the correct stress and improve employee loyalty. The corporation would raise employee engagement rates, which would also increase group morale and person efficiency (Abdulhamid, Dada, & Ajibuwa, 2019). 3. The Project Limitations Two main limitations, such as effort and money, have been faced throughout the project implementation period. For this sort of IT project, capital resources are important since it incorporates certain hardware and software requirements in the procurement and the project faces difficulties throughout the development process owing to proper evaluation on a budget schedule. Time is another requirement for this project. Any project mission has to be accomplished within a very limited time but job-related problems have been induced by a combination of vacations and the shortage of project participants due to sickness. However, this project was performed using productive management techniques, which collaborated in collaboration for the successful coordination and communication of the project (Denney, 2020). 4. Recommendation of Project This initiative is about handling and tracking staff, so privacy and protection are the two main employee issues. EMS shops or collect all workers' employee records. This means that owing to certain software fixes or gaps, security attacks such as ransomware, insider attacks, and unauthorized entry, security safety is a high priority of this initiative. So, in this project, I would like to see certain improvements, first of all, I would suggest gaining some financia ...

1. Project Description Definition of ProjectThe supervision of w

AbbyWhyte974

More from AbbyWhyte974 (20)

1. Think about a persuasive speech that you would like to present

1. The two properties about a set of measurements of a dependent v

1. The Danube River flows through 10 countries. Name them in the s

1. The 3 genes that you will compare at listed below. Take a look.

1. Student and trainer detailsStudent details Full nameStu

1. Student uses MS Excel to calculate income tax expense or refund

1. Socrates - In your view, what was it about Socrates’ teachings

1. Select a patient” (friend or family member) on whom to perform

1. Respond to your classmates’ question and post. Submission to y

1. Review the HCAPHS survey document, by clicking on the hyperlink

1. Saint Leo Portal loginUser ID[email protected]

1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea

1. Read the story first.2. Bold Face TermsMake a separate l

1. Read and summarize ERD paragraphs # 59, 60, 61. 59. T

1. PURPOSE To document and evaluate teaching skills necessary to

1. Rate yourself according to your confidence level performing the

1. President William McKinley, letter to Congress, April 25, 1898.

1. Prof. Lennart Van der Zeil’s theorem says that any programming

1. Preparing for assessment. DateWeek 3Session titlePr

1. Project Description Definition of ProjectThe supervision of w

Recently uploaded

Transparency, Recognition and the role of eSealing - Ildiko Mazar and Koen No...

EADTU

Wellbeing inclusion and digital dystopias.pptx

Jisc

dusjagr & nano talk on open tools for agriculture research and learning

Marc Dusseiller Dusjagr

FICTIONAL SALESMAN/SALESMAN SNSW 2024.pdf

Pondicherry University

VAMOS CUIDAR DO NOSSO PLANETA! .

Colégio Santa Teresinha

Simple, Complex, and Compound Sentences Exercises.pdf

stareducators107

OS-operating systems- ch05 (CPU Scheduling) ...

Dr. Mazin Mohamed alkathiri

Tatlong Kwento ni Lola basyang-1.pdf arts

Nbelano25

The basics of sentences session 3pptx.pptx

heathfieldcps1

How to Add a Tool Tip to a Field in Odoo 17

Celine George

QUATER-1-PE-HEALTH-LC2- this is just a sample of unpacked lesson

httgc7rh9c

How to Manage Global Discount in Odoo 17 POS

Celine George

How to setup Pycharm environment for Odoo 17.pptx

Celine George

80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...

Nguyen Thanh Tu Collection

𝐋𝐞𝐬𝐬𝐨𝐧 𝐎𝐮𝐭𝐜𝐨𝐦𝐞𝐬: -Discern accommodations and modifications within inclusive classroom environments, distinguishing between their respective roles and applications. -Through critical analysis of hypothetical scenarios, learners will adeptly select appropriate accommodations and modifications, honing their ability to foster an inclusive learning environment for students with disabilities or unique challenges.

Understanding Accommodations and Modifications

MJDuyan

This presentation covers the essential parameters of Unit 2 Operations Processes of the subject Operations & Supply Chain Management. Topics Covered: Volume Variety and Flow. Types of Processes and Operations Systems - Continuous Flow system and intermittent flow systems.Job Production, Batch Production, Assembly line and Continuous Flow, Process and Product Layout. Design of Service Systems, Service Blueprinting.

OSCM Unit 2_Operations Processes & Systems

Sandeep D Chaudhary

Introduction to TechSoup’s Digital Marketing Services and Use Cases

TechSoup

NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...

Amil baba

Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptx

Pooja Bhuva

How to Add New Custom Addons Path in Odoo 17

Celine George

Recently uploaded (20)

Transparency, Recognition and the role of eSealing - Ildiko Mazar and Koen No...

Wellbeing inclusion and digital dystopias.pptx

dusjagr & nano talk on open tools for agriculture research and learning

FICTIONAL SALESMAN/SALESMAN SNSW 2024.pdf

VAMOS CUIDAR DO NOSSO PLANETA! .

Simple, Complex, and Compound Sentences Exercises.pdf

OS-operating systems- ch05 (CPU Scheduling) ...

Tatlong Kwento ni Lola basyang-1.pdf arts

The basics of sentences session 3pptx.pptx

How to Add a Tool Tip to a Field in Odoo 17

QUATER-1-PE-HEALTH-LC2- this is just a sample of unpacked lesson

How to Manage Global Discount in Odoo 17 POS

How to setup Pycharm environment for Odoo 17.pptx

80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...

Understanding Accommodations and Modifications

OSCM Unit 2_Operations Processes & Systems

Introduction to TechSoup’s Digital Marketing Services and Use Cases

NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...

Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptx

How to Add New Custom Addons Path in Odoo 17

1. PortfolioYou are expected to collate a portfolio of items to

1. 1. Portfolio You are expected to collate a portfolio of items to demonstrate your learning achieved during this module as well as you programme. Purpose of Portfolio: • Reflect on your strengths and weaknesses in relation to transversal skills (including academic skills). • Prepare a development plan to develop/enhance skills as a result from the self-reflection. • Provide a log of activities to demonstrate how you have followed your development plan. • Demonstrate overall, your enhanced employability as a result of the programme. Your portfolio will be submitted in two sets: Portfolio Set 1 This should include the following: a) Current CV b) Reflective Self-analysis of Skills c) Skills Development Plan

1. PortfolioYou are expected to collate a portfolio of items to

Recommended

Recommended

More Related Content

More from AbbyWhyte974

More from AbbyWhyte974 (20)

Recently uploaded

Recently uploaded (20)

1. PortfolioYou are expected to collate a portfolio of items to