9 112 Samaradivakara S DNA barcoding of cinnamon

2,902 views
2,654 views

Published on

Published in: Technology, Travel
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
2,902
On SlideShare
0
From Embeds
0
Number of Embeds
13
Actions
Shares
0
Downloads
118
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide

9 112 Samaradivakara S DNA barcoding of cinnamon

  1. 1. Saroopa Samaradivakara Genetech Research Institute
  2. 2. Cinnamon <ul><li>Cinnamon is a small evergreen tree belonging to the family Lauraceae </li></ul><ul><li>It is native to Sri Lanka </li></ul><ul><li>Sri Lanka is the largest “true” cinnamon producer in the world (Cinnamomum zeylanicum or C. verum) </li></ul><ul><li>Commercially important types </li></ul><ul><ul><ul><li>Ceylon cinnamon (native to Sri Lanka) </li></ul></ul></ul><ul><ul><ul><li>Cassia </li></ul></ul></ul>Genetech Research Institute
  3. 3. What is Barcoding? <ul><li>DNA barcoding involves sequencing a standard region of DNA as a tool for species identification </li></ul><ul><ul><ul><li>Low substitution rates of mitochondrial DNA in plants </li></ul></ul></ul><ul><li>Some of the leading candidate chloroplast plastid DNA regions used in land plants barcoding are atpF-atpH spacer, MatK gene, rbcL gene,rpoB gene, rpoC1gene, psbK-psbI spacer and TrnH- psbA spacer </li></ul>Genetech Research Institute
  4. 4. Genetech Research Institute
  5. 5. Why TrnH and MatK barcoding loci? <ul><ul><ul><li>matK is one of the most rapidly evolving plastid coding regions and it gives a sequence of better quality </li></ul></ul></ul><ul><ul><ul><li>trnH–psbA demonstrates good amplification across land plants </li></ul></ul></ul><ul><ul><ul><li>TrnH and MatK expected band sizes ~450bp and ~930bp respectively </li></ul></ul></ul>http://www.pnas.org/content/106/31/12794 (12.10.2009) Genetech Research Institute
  6. 6. <ul><li>Beside from the C. verum there are 7 wild species </li></ul><ul><ul><ul><li>Cinnamomum tamala </li></ul></ul></ul><ul><ul><ul><li>Cinnamomum dubium (Sinhala: sewel Kurundu or wal Kurundu ) </li></ul></ul></ul><ul><ul><ul><li>Cinnamomum ovalifolium </li></ul></ul></ul><ul><ul><ul><li>Cinnamomum litseafolium (Sinhala: Kudu Kurundu ) </li></ul></ul></ul><ul><ul><ul><li>Cinnamomum citriodorum (Sinhala: Pangiri Kurundu - rare) </li></ul></ul></ul><ul><ul><ul><li>Cinnamomum rivulorum </li></ul></ul></ul><ul><ul><ul><li>Cinnamomum sinharajense </li></ul></ul></ul><ul><ul><ul><li>Cinnamomum capparu-corende (Sinhala: Kapuru Kurundu ) </li></ul></ul></ul>Why is it important to barcode Cinnamon? http://en.wikipedia.org/wiki/Cinnamon Genetech Research Institute
  7. 7. <ul><li>Cassia types cultivated in Sri Lanka </li></ul><ul><ul><ul><li>Chinese cassia ( Cinnamomum aromanticum ) </li></ul></ul></ul><ul><ul><ul><li>Indonesian cassia ( Cinnamomum brumannii Nees) </li></ul></ul></ul><ul><ul><ul><li>Vietnam cassia (Cinnamomum ioureirii Nees) </li></ul></ul></ul><ul><ul><ul><li>However, these related species, Cassia are sometimes sold labelled as cinnamon. </li></ul></ul></ul><ul><ul><ul><li>Therefore a DNA based method to rapidly identify the different strains of cinnamon and cassia would be an important tool for the conservation of the cinnamon strains of Sri Lanka and the control of the use of the name “True cinnamon” in the world market </li></ul></ul></ul>Genetech Research Institute
  8. 8. OBJECTIVES <ul><li>To barcode DNA extracted from Cinnamon leaves </li></ul><ul><li>To amplify DNA extracted from processed cinnamon bark for the two barcode loci chosen </li></ul><ul><li>To decide which loci out of MatK and TrnH enable producing DNA barcodes more easily </li></ul>Genetech Research Institute
  9. 9. Method Objective 1 <ul><li>We used four different species generally known to be the following types of cinnamon that can be found in Sri Lanka </li></ul><ul><ul><ul><li>Cinnamomum camphora </li></ul></ul></ul><ul><ul><ul><li>Cinnamomum aromanticum </li></ul></ul></ul><ul><ul><ul><li>“ Dawul Kurundu” </li></ul></ul></ul><ul><ul><ul><li>“ Wal Kurundu” </li></ul></ul></ul>Genetech Research Institute
  10. 10. Genetech Research Institute Cinnamomum aromaticum “ Wal Kurundu” “ Dawul kurundu” Cinnamomum camphora
  11. 11. <ul><li>DNA was extracted from leaves using the CTAB method </li></ul><ul><li>PCR conducted for both TrnH and MatK </li></ul><ul><li>Enhancers BSA and DMSO were used for the MatK system </li></ul><ul><li>DMSO was added in a dilution series of 0.5ul, 1.0ul, 1.5ul </li></ul><ul><li>Agarose gel electrophoresis was done to obtain bands for the PCR products and the bands were purified </li></ul><ul><li>Purified products were used for the sequencing process </li></ul>Genetech Research Institute
  12. 12. Results Genetech Research Institute
  13. 13. <ul><ul><ul><li>Cinnamomum camphora </li></ul></ul></ul>A - λ 100 bp ladder B - PCR amplified products of primers trnH-psbA C - Negative control for trnH-psbA primer products (all except template DNA) D - PCR amplified products of primer matK with 0.5 µ l of 14.07 M DMSO E - PCR amplified products of primer matK with 1.0 µ l of 14.07 M DMSO F - PCR amplified products of primer matK with 1.5 µ l of 14.07 M DMSO G - Negative control for matK (including 1.0 µ l of 14.07 M DMSO) 500bp Genetech Research Institute matK trnH A B C D E F G H
  14. 14. GTAGTTATGAACCCTGTAGACATCCCCACGGGGTGGTGAAGGGAGGGCCCGATTGGTAGAAAAAAAC CCACAACCCCGGGGTTATCCTGCGCTTGGAAGAAAAAGTAGGAAAAGGAATAAATATAGTAATAGTTT TATTATTCGTCGCCGTAAATAGAAATATTCAAAATCAAATAAATATTGTTTTTTAAGGTGAAATAAAGATATTTACACCCCGTCCAAGTTTATAGGGATAGCAAATGCTGGGCGAACGACGGGAATTGAACCCGCGCATGTGGATTCACTCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCCTCTCTCAAAAGGATTCCATTTTCACCATTCATTATTTTTTCTTTATTACTTCACTCTCCTTCCTGCTGAAATACAGATATTGTACATAAAACAAAATGTTGTACGTAAAATAAAAAAAAAAAGAAAAATGCTTTGATTTTTTCCTAAAATCAAATTCTTTTGAAGAATAAGAGTATATAAATTGCAGGTTGGTACAGAAGAAACTACGATATCGATCACGAAATAACCAGCGGTTTTCATAAGTTGAATAAAAGAAATGAAAATGAAAAACGATTATGTGAAAACACTCTGAACCAAATAGATCAATCCAAACTTCTTAATAGAACAGAAGTTTGGTATTGATC Trn H Cinnamomum camphora Genetech Research Institute
  15. 15. Genetech Research Institute
  16. 16. <ul><li>MatK Cinnamomum camphora </li></ul><ul><li>ACTTTTTCGAGACAGTTATCACATTTAATTCATGTGTCAGATATACTAATTCCCCCCCCCATCCATCTGGAAATCTTGGTTCAAACCCTTCACTCTTGGATACAAGATACTCCTTCGTTGCATTTATTGCGATTCTCTCTCTACGAGTATTGGAATTCAAATAGTCTCATTACTCCAAAAAATTCCATTTCCCTTTTTTCAAAAGAGAATCAAAGATTCTTCTTGTTCCTCTCTAATTCTCATGTATATGAATGTGAATTCATATTCATTTTTCTCCGTAAACAACCCTTTCATTTACGATCAAAATCTTTTGGATCCTTTCTTGAGCGAACACATTTCTATGCAAAAATAGAATATCTTGTAGTAGTGCTTTGTAACGATTTTCAGAAAACCCTATGGTTGTTCAAAGACCCTTTTATGCATTATGTCAGATATCAAGGAAAATCGATTCTGGCTTCAAGGGGGGCTCGTCTTCTGATAAAGAAATGGAAATCTCACCTTGTCAACTTTTGGCAATCTCATTTTGACTTGTGGTCTCACCCGGCCAGGATCCATATAAAGCAATTATATAATCATCCCTCCATTTCCTGGGCTATCTTTCAAGTGTACCAACTAAACATCTTCGGAGAAAGGATCAAATGTTAA </li></ul>Genetech Research Institute
  17. 17. Genetech Research Institute
  18. 18. “ Dawul kurundu” D1 - λ 100 bp ladder D2 - PCR amplified products of primers matK for “ Dawul kurudu ” D3 - Negative control for matK D4 - PCR amplified products of primer trnH-psbA for “ Dawul kurudu ” D5 - PCR amplified products of primer trnH-psbA for C. camphora D6 - Negative control for matK primer products Genetech Research Institute 500bp D1 D2 D3 D4 D5 D6 trnH
  19. 19. “ Dawul kurundu” TrnH <ul><li>AGAGGGCAACTGAGCCCCTGTGCCTTGATCCCTTGGCTACTTCCTGCCTACTCTCTCAAAAGATTCCCTTTCACCGTTCATTATTTTTTTATTTAGTCTTTATTACTTCCCCCCTCCTTCCTGCTGAAATACAGATATTGTACATAAAAAAAAAAAAAAATGCTTTGATTTTAGGAAAAAATTAAATTCTTTTGAAAAATAAGAGTATATAAATTGCGGGTTGGTACAGAAAAAACTACAATATTCGATCATGAAATAACCAGGGGTTTTTATAAGTTGAATAAAAGAGATGAAAATGAAAAACGATTATGTGAATAAAACACTACTGAACCAAATAGATCAATACCAAACTTCTTGTTCTATTAAGAAGTTTGGTATTGATCCTTCAACGACTCGTATACCCTAATACCAAAGTATTATCCGTTTGTAGATGGAACTTCGACAGCAGCTAGGTCTAGAGGGAAGTTGTGAGCCTTACGTTCTCGCCTATACACT </li></ul>Genetech Research Institute
  20. 20. Genetech Research Institute
  21. 21. Cinnamomum aromaticum and “Wal kurundu” TrnH A- 100bp Ladder B- Amplification with TrnH C- negative control D- Amplification with MatK having 1ul of DMSO E- negative control F- Amplification with MatK having 1.5ul of DMSO G- negative control Genetech Research Institute 500bp
  22. 22. <ul><li>Partial Sequence of Cinnamomum aromaticum TrnH region </li></ul><ul><li>TCTTAGTCCTATGGATCCCTTGGGCTACATCCGCCTTCTCCCTCTCTCAAATATGGAATTCCATTTTCACCATTCATTAATTTTTTAATTTAGTCTTTATTACTTCACTCTCCTTCCTGCTGAAATACAGATATTGTACATAAAACAAAATGTTGTACATAAAAAAAAAAAAAAAAAAAATGCTTTGATTTTTTCCTAAAATCAAA </li></ul><ul><li>Partial Sequence of “Wal Kurundu” region </li></ul><ul><li>CAGGGCCTTGGATCCACTAGGGCTACATCCGCCCTCTTTCTCCTTTCAATGGAATTCCATTTTCACCATTCATTATTTTTTAATTTAGTCTTTATTACTTCACTCTCCTTCCCGCTGAAATACAGATATTGGGCATAATATTCATTGTTGTATGTATCA </li></ul>Genetech Research Institute
  23. 23. <ul><li>Extraction methods used </li></ul><ul><li>CTAB method used in extracting DNA from leaves </li></ul><ul><li>CTAB method having Polyvinyl Pyrrolidone ( PVP ) this is used to remove polyphenols present in the bark </li></ul>Objective 2 Extraction of DNA from processed Cinnamon bark for obtaining DNA Barcodes Genetech Research Institute
  24. 24. Discussion <ul><ul><ul><li>Suitability of the two Barcode loci TrnH and MatK - TrnH gives a better amplification than MatK. </li></ul></ul></ul><ul><ul><ul><li>Though MatK is recommended there are instances where the MatK region has been difficult to amplify. </li></ul></ul></ul><ul><ul><ul><li>Sequence data generated gave very good concordance with sequences of some species in NCBI eg: Cinnamomum camphora </li></ul></ul></ul><ul><ul><ul><li>However some other specimens such as “Dawul Kurundu” did not show sufficient concordance with similar species in NCBI </li></ul></ul></ul>Genetech Research Institute
  25. 25. <ul><ul><ul><li>This could be due to these species being endemic plants and that nobody till date has generated barcode sequences and submitted to NCBI </li></ul></ul></ul><ul><li>Therefore there is a need to submit barcode sequences for such endemic species </li></ul><ul><li>This project is now in prgress and we hope to generate TrnH sequences for all the varieties of cinnamon in Sri Lanka </li></ul>Genetech Research Institute
  26. 26. <ul><li>It is important for the purpose of international trade. </li></ul><ul><li>Although we tried several methods of extraction up to now we have not been able to generate a PCR product for bark DNA </li></ul>Cinnamon bark DNA extraction and amplification Genetech Research Institute
  27. 27. <ul><li>This maybe due to the following reasons: </li></ul><ul><li>The amount of chloroplast in the bark is much less than in the leaf </li></ul><ul><li>The chloroplasts in bark may have undergone degradation during maturity and senescence </li></ul><ul><li>The chloroplast degradation during processing of the cinnamon bark </li></ul><ul><li>The bark may contain more cinnamic oils and acids which may have an inhibitory effect on the PCR </li></ul>Genetech Research Institute
  28. 28. <ul><li>Therefore DNA barcoding which uses chloroplast DNA does not seem to be the best option for cinnamon bark samples </li></ul><ul><li>In such a case an autosomal DNA marker maybe more suitable for this purpose </li></ul><ul><li>However DNA barcoding is a good option for determining the phylogenetic relationships between the different cinnamon varieties in Sri Lanka and it will help to resolve some of the long standing taxonomic disputes of cinnamon </li></ul>Genetech Research Institute
  29. 29. References <ul><li>Scientific papers </li></ul><ul><li>Aron J . Fazekas, Prasad R. Kesanakurti , Kevin S. Burgess,Diana M. Percy,Sean W. Graham, Spencer C. H. Barrett, Steven G. NEWMASTER,Mehrdad Hajibabaei and Brian C. Husband. Are plant species inherently harder to discriminate than animal species using DNA barcoding markers? Molecular Ecology Resources (2009) 9 (Suppl. 1), 130–139 </li></ul><ul><li>Web references </li></ul><ul><li>www.pnas.orgcgidoi10.1073pnas.0503123102 </li></ul><ul><li>http://www.pnas.org/content/106/31/12794 </li></ul><ul><li>http://www.plant-talk.org/resource/dna.html </li></ul><ul><li>http://barcoding.si.edu/PDF/Informationonbarcodeloci.pdf </li></ul><ul><li>http://www.kew.org/barcoding/protocols.html) </li></ul><ul><li>http://en.wikipedia.org/wiki/Cinnamon </li></ul>Genetech Research Institute
  30. 30. Aknowledgement <ul><li>Dr. Neil Fernandopulle </li></ul><ul><li>Bhagya Mendis </li></ul><ul><li>Thanuja Jayatunga </li></ul><ul><li>Romani Slegers </li></ul><ul><li>Ujith Karunaratne </li></ul><ul><li>Ms. Gayathri Baranage and Mr. Ishara Herath </li></ul><ul><li>Ms.Imalka Gunasekera and Trashila Wickramasinghe </li></ul><ul><li>Sample providers </li></ul><ul><li>Dr Dharshan De Silva and all the members of Genetech Research Institute </li></ul><ul><li>Funded by Genetech Research Institute </li></ul>Genetech Research Institute
  31. 31. Genetech Research Institute
  32. 32. <ul><li>MatK primer map. Note that the designation of F and R varies between primer names from different sources. </li></ul><ul><li>MATK </li></ul><ul><li>For matK, the proposed barcode region is indicated on the primer map above. It falls in the region between bp205-1046 (227-1019 excluding primer sequence) in the Arabidopsis thaliana sequence. </li></ul><ul><li>It is recognised that these primers will not work in all angiosperms and further primer development work is required in non-angiosperms for matK . We encourage community effort to enhance amplification strategies for matK, including the development of new primers and primer cocktails. </li></ul><ul><li>http://barcoding.si.edu/PDF/Informationonbarcodeloci.pdf </li></ul>Genetech Research Institute
  33. 33. Genetech Research Institute
  34. 34. <ul><li>94◦C - 3 min - 1 cycle </li></ul><ul><li>94◦C - 1 min </li></ul><ul><li>55◦C - 1 min 35 cycles </li></ul><ul><li>72◦C - 1 min </li></ul><ul><li>72◦C - 3 min - 1 cycle </li></ul>PCR protocol Genetech Research Institute
  35. 35. A- 100bp Ladder B- Amplification of Cinnamomum aromaticum with TrnH C- Amplification of “Wal kurundu” with TrnH Genetech Research Institute 500bp

×