Your SlideShare is downloading. ×
  • Like
ISHS - Molecular Markers In Horticulture Presentation
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Now you can save presentations on your phone or tablet

Available for both IPhone and Android

Text the download link to your phone

Standard text messaging rates apply

ISHS - Molecular Markers In Horticulture Presentation

  • 1,058 views
Published

Presentation by CTO Eric Johnson on the various applications and features of RAD based sequencing technology to plant sciences.

Presentation by CTO Eric Johnson on the various applications and features of RAD based sequencing technology to plant sciences.

Published in Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
No Downloads

Views

Total Views
1,058
On SlideShare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
39
Comments
0
Likes
2

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Sequenced RAD Markers: A SNP Discovery and Genotyping Platform July 30th, 2009 Floragenex Presenter: Dr. Eric Johnson, Chief Technology Officer www.floragenex.com © Floragenex, Inc. 2009
  • 2. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population • Physical maps – Rapid ordering of large BAC libraries www.floragenex.com © Floragenex, Inc. 2009
  • 3. Floragenex Restriction-site Associated DNA (RAD) Technology www.floragenex.com © Floragenex, Inc. 2009
  • 4. RAD Markers Identify a Variety of Polymorphisms Sequences with a single change A B 18 00 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAAAAGAAGGACAA 38G>A 00 19 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAGAAGAAGGACAA Sequences with complex changes A B 19 00 CCGGCGCAAGGCCTTCTACTGATCTGGTACGCTATCTCTTAGCATGTCC 20C>T 48A>C 00 17 CCGGCGCAAGGCCTTCTACCGATCTGGTACGCTATCTCTTAGCATGTAC 00 29 CCGGCGCGATCTGCAGGGGCGCCGACGACATTATTCCTTCGGCTCGCCG 33G>A 34+TTC 44 00 CCGGCGCGATCTGCAGGGGCGCCGACGACATTG---CTTCGGCTCGCCGTGG Dominant markers “snip-SNPs” A B 00 42 CCGGCGAAACACGGGGCCACGGCGCAGGCGTTCTCCATCTCCAAAGAAC www.floragenex.com © Floragenex, Inc. 2009
  • 5. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population • Physical maps – Rapid ordering of large BAC libraries www.floragenex.com © Floragenex, Inc. 2009
  • 6. Paired-end Sequencing for RAD LongReads www.floragenex.com © Floragenex, Inc. 2009
  • 7. RAD LongRead contigs range in size RAD LongRead contig lengths 1500 1125 # of contigs 750 375 0 100 200 300 400 500 600 700 800 900 Contig length www.floragenex.com © Floragenex, Inc. 2009
  • 8. RAD LongReads for Genotyping Assay Development Goal • Identify testcross segregating alleles for translation into Sequenom iPlex assay format RAD LongRead sequencing results • ~43,000 contigs • 9,903 SNPs identified • 1,005 InDels identified Validation test • 280 SNPs were converted into a Sequenom assay (120 bp free of other polymorphisms) Results 1) Nearly 100% conversion rate into a functional assay 2) ~85% of identified SNPs segregated as expected and mapped to LGs www.floragenex.com © Floragenex, Inc. 2009
  • 9. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population • Physical maps – Rapid ordering of large BAC libraries www.floragenex.com © Floragenex, Inc. 2009
  • 10. Trait mapping with bulked populations www.floragenex.com © Floragenex, Inc. 2009
  • 11. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population • Physical maps – Rapid ordering of large BAC libraries www.floragenex.com © Floragenex, Inc. 2009
  • 12. RAD-Based Physical Mapping RAD sequences form a fingerprint for each BAC Digestion Sites BAC RAD Sequence A RAD-based physical map closes gaps in a whole genome assembly RAD Sequence BACs WGS Contigs Sequence-Based Genetic Markers www.floragenex.com © Floragenex, Inc. 2009
  • 13. RAD-based Physical and Genetic Maps can optimize Whole Genome Assembly www.floragenex.com © Floragenex, Inc. 2009
  • 14. RAD Summary RAD markers focus high-depth sequencing on a fraction of the genome • de novo marker discovery • marker density can scale with project goals RAD LongRead markers • develop long contigs of 200-800 bp • good for porting SNPs to other genotyping platforms • discriminates between homeologous genomes Trait mapping • Rapidly identify Mendelian alleles Genetic mapping and physical mapping • RAD marker-based maps can tie together for genome assembly www.floragenex.com © Floragenex, Inc. 2009
  • 15. Questions? Floragenex Plant Genomics Team: Eric Johnson, Chief Technical Officer eric@floragenex.com Rick Nipper, VP of Research rick@floragenex.com Office Phone 541.343.0747 www.floragenex.com © Floragenex, Inc. 2009