SlideShare a Scribd company logo
1 of 14
Sequenced RAD Markers: A SNP
        Discovery and Genotyping Platform
         July 30th, 2009




                               Floragenex Presenter:

                               Dr. Eric Johnson, Chief Technology Officer




                           © Floragenex, Inc. 2009
www.floragenex.com
Applications for Sequenced RAD markers

   • SNP discovery
      – scalable discovery of markers in any genome
   • SNP discovery with RAD LongRead markers
      – identify SNPs and develop flanking sequence
   • Trait mapping
      – find linked markers by bulk segregant analysis
   • Genetic maps
      – SNP discovery and genotyping of a population




                               © Floragenex, Inc. 2009
www.floragenex.com
Floragenex Restriction-site Associated
DNA (RAD) Technology




                     © Floragenex, Inc. 2009
www.floragenex.com
RAD Markers Identify a Variety of
Polymorphisms
Sequences with a single change
A       B
18      00 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAAAAGAAGGACAA 38G>A
00      19 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAGAAGAAGGACAA


Sequences with complex changes
A       B
19      00 CCGGCGCAAGGCCTTCTACTGATCTGGTACGCTATCTCTTAGCATGTCC 20C>T 48A>C
00      17 CCGGCGCAAGGCCTTCTACCGATCTGGTACGCTATCTCTTAGCATGTAC

00      29 CCGGCGCGATCTGCAGGGGCGCCGACGACATTATTCCTTCGGCTCGCCG 33G>A 34+TTC
44      00 CCGGCGCGATCTGCAGGGGCGCCGACGACATTG---CTTCGGCTCGCCGTGG


Dominant markers “snip-SNPs”
A       B
00      42 CCGGCGAAACACGGGGCCACGGCGCAGGCGTTCTCCATCTCCAAAGAAC


                                      © Floragenex, Inc. 2009
www.floragenex.com
Applications for Sequenced RAD markers

   • SNP discovery
      – scalable discovery of markers in any genome
   • SNP discovery with RAD LongRead markers
      – identify SNPs and develop flanking sequence
   • Trait mapping
      – find linked markers by bulk segregant analysis
   • Genetic maps
      – SNP discovery and genotyping of a populatio




                               © Floragenex, Inc. 2009
www.floragenex.com
Paired-end Sequencing for RAD
LongReads




                     © Floragenex, Inc. 2009
www.floragenex.com
RAD LongRead contigs range in size
                                                 RAD LongRead contig lengths
                              1500




                              1125
               # of contigs




                               750




                               375




                                0
                                     100   200     300     400       500       600   700   800   900

                                                            Contig length

                                                         © Floragenex, Inc. 2009
www.floragenex.com
RAD LongReads for Genotyping Assay
Development
Goal
 • Identify testcross segregating alleles for translation into Sequenom iPlex assay
    format
RAD LongRead sequencing results
 • ~43,000 contigs
 • 9,903 SNPs identified
 • 1,005 InDels identified
Validation test
 • 280 SNPs were converted into a Sequenom assay (120 bp free of other
    polymorphisms)
Results
1) Nearly 100% conversion rate into a functional assay
2) ~85% of identified SNPs segregated as expected and mapped to LGs


                                   © Floragenex, Inc. 2009
www.floragenex.com
Applications for Sequenced RAD markers

   • SNP discovery
      – scalable discovery of markers in any genome
   • SNP discovery with RAD LongRead markers
      – identify SNPs and develop flanking sequence
   • Trait mapping
      – find linked markers by bulk segregant analysis
   • Genetic maps
      – SNP discovery and genotyping of a population




                               © Floragenex, Inc. 2009
www.floragenex.com
Trait mapping with bulked populations




                     © Floragenex, Inc. 2009
www.floragenex.com
Applications for Sequenced RAD markers

   • SNP discovery
      – scalable discovery of markers in any genome
   • SNP discovery with RAD LongRead markers
      – identify SNPs and develop flanking sequence
   • Trait mapping
      – find linked markers by bulk segregant analysis
   • Genetic maps
      – SNP discovery and genotyping of a population




                               © Floragenex, Inc. 2009
www.floragenex.com
RAD-based Physical and Genetic Maps can
optimize Whole Genome Assembly




                       © Floragenex, Inc. 2009
  www.floragenex.com
RAD Summary

RAD markers focus high-depth sequencing on a fraction of the genome
 • de novo marker discovery
 • marker density can scale with project goals
RAD LongRead markers
 • develop long contigs of 200-800 bp
 • good for porting SNPs to other genotyping platforms
 • discriminates between homeologous genomes
Trait mapping
 • Rapidly identify Mendelian alleles
Genetic mapping and physical mapping
 • RAD marker-based maps can tie together for genome assembly


                            © Floragenex, Inc. 2009
www.floragenex.com
Questions?
                     Floragenex Plant Genomics Team:
                     Eric Johnson, Chief Technical Officer
                        eric@floragenex.com
                     Rick Nipper, VP of Research
                        rick@floragenex.com

                     Office Phone
                        541.343.0747



                                    © Floragenex, Inc. 2009
www.floragenex.com

More Related Content

Viewers also liked

ROSEdu Tech Talks Prezentarea 01: Preprocesorul C
ROSEdu Tech Talks Prezentarea 01:  Preprocesorul CROSEdu Tech Talks Prezentarea 01:  Preprocesorul C
ROSEdu Tech Talks Prezentarea 01: Preprocesorul CROSEdu
 
Getting your masters doctorate in your p js
Getting your masters doctorate in your p jsGetting your masters doctorate in your p js
Getting your masters doctorate in your p jscdcummings
 
Marketing 101 Powerpoint Colorado Springs Ewi
Marketing 101 Powerpoint   Colorado Springs EwiMarketing 101 Powerpoint   Colorado Springs Ewi
Marketing 101 Powerpoint Colorado Springs Ewiseikotran
 
Sitecheckm8 Pres
Sitecheckm8 PresSitecheckm8 Pres
Sitecheckm8 PresAzulIT
 
Making Social Media Work for You
Making Social Media Work for YouMaking Social Media Work for You
Making Social Media Work for YouAllan Gates
 
Ncpea final 8-7-13
Ncpea final 8-7-13Ncpea final 8-7-13
Ncpea final 8-7-13cdcummings
 
Essentie Van Leiderschap
Essentie Van LeiderschapEssentie Van Leiderschap
Essentie Van LeiderschapRonvanschaik
 
Fansite“TenjinbashiBazaar” as local communication by socialmedia
Fansite“TenjinbashiBazaar” as local communication by socialmediaFansite“TenjinbashiBazaar” as local communication by socialmedia
Fansite“TenjinbashiBazaar” as local communication by socialmediaKazutaka NAKANO
 
Standards @ Peixe Urbano
Standards @ Peixe UrbanoStandards @ Peixe Urbano
Standards @ Peixe UrbanoFlávio Silva
 

Viewers also liked (20)

Keys to good cooking yummy mummy style
Keys to good cooking yummy mummy styleKeys to good cooking yummy mummy style
Keys to good cooking yummy mummy style
 
ROSEdu Tech Talks Prezentarea 01: Preprocesorul C
ROSEdu Tech Talks Prezentarea 01:  Preprocesorul CROSEdu Tech Talks Prezentarea 01:  Preprocesorul C
ROSEdu Tech Talks Prezentarea 01: Preprocesorul C
 
Home Fragrances Delights
Home  Fragrances DelightsHome  Fragrances Delights
Home Fragrances Delights
 
Sisältää jo vanhentunutta tietoa: (Humanistinen ammattikorkeakoulu 2010: Opo ...
Sisältää jo vanhentunutta tietoa: (Humanistinen ammattikorkeakoulu 2010: Opo ...Sisältää jo vanhentunutta tietoa: (Humanistinen ammattikorkeakoulu 2010: Opo ...
Sisältää jo vanhentunutta tietoa: (Humanistinen ammattikorkeakoulu 2010: Opo ...
 
Introduction2comsci
Introduction2comsciIntroduction2comsci
Introduction2comsci
 
Getting your masters doctorate in your p js
Getting your masters doctorate in your p jsGetting your masters doctorate in your p js
Getting your masters doctorate in your p js
 
Lynn Dearmyer
Lynn DearmyerLynn Dearmyer
Lynn Dearmyer
 
Kokemuksia verkkonuorisotyön ja mediakasvatuksen opetuksesta reaaliaikainen v...
Kokemuksia verkkonuorisotyön ja mediakasvatuksen opetuksesta reaaliaikainen v...Kokemuksia verkkonuorisotyön ja mediakasvatuksen opetuksesta reaaliaikainen v...
Kokemuksia verkkonuorisotyön ja mediakasvatuksen opetuksesta reaaliaikainen v...
 
Marketing 101 Powerpoint Colorado Springs Ewi
Marketing 101 Powerpoint   Colorado Springs EwiMarketing 101 Powerpoint   Colorado Springs Ewi
Marketing 101 Powerpoint Colorado Springs Ewi
 
Sitecheckm8 Pres
Sitecheckm8 PresSitecheckm8 Pres
Sitecheckm8 Pres
 
Making Social Media Work for You
Making Social Media Work for YouMaking Social Media Work for You
Making Social Media Work for You
 
Awkward Family Pet Photos
Awkward Family Pet PhotosAwkward Family Pet Photos
Awkward Family Pet Photos
 
Humak: hakijan opas 2014
Humak: hakijan opas 2014Humak: hakijan opas 2014
Humak: hakijan opas 2014
 
Search Marketing
Search MarketingSearch Marketing
Search Marketing
 
Ncpea final 8-7-13
Ncpea final 8-7-13Ncpea final 8-7-13
Ncpea final 8-7-13
 
Essentie Van Leiderschap
Essentie Van LeiderschapEssentie Van Leiderschap
Essentie Van Leiderschap
 
Fansite“TenjinbashiBazaar” as local communication by socialmedia
Fansite“TenjinbashiBazaar” as local communication by socialmediaFansite“TenjinbashiBazaar” as local communication by socialmedia
Fansite“TenjinbashiBazaar” as local communication by socialmedia
 
Standards @ Peixe Urbano
Standards @ Peixe UrbanoStandards @ Peixe Urbano
Standards @ Peixe Urbano
 
Sims003
Sims003Sims003
Sims003
 
Johda ja hyödynnä sosiaalista mediaa – työkalupakki kunnan nuorisotyön johtam...
Johda ja hyödynnä sosiaalista mediaa – työkalupakki kunnan nuorisotyön johtam...Johda ja hyödynnä sosiaalista mediaa – työkalupakki kunnan nuorisotyön johtam...
Johda ja hyödynnä sosiaalista mediaa – työkalupakki kunnan nuorisotyön johtam...
 

Recently uploaded

Gen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfGen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfAddepto
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsRizwan Syed
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):comworks
 
Bun (KitWorks Team Study 노별마루 발표 2024.4.22)
Bun (KitWorks Team Study 노별마루 발표 2024.4.22)Bun (KitWorks Team Study 노별마루 발표 2024.4.22)
Bun (KitWorks Team Study 노별마루 발표 2024.4.22)Wonjun Hwang
 
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)Mark Simos
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubKalema Edgar
 
Commit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyCommit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyAlfredo García Lavilla
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Mattias Andersson
 
Connect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationConnect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationSlibray Presentation
 
WordPress Websites for Engineers: Elevate Your Brand
WordPress Websites for Engineers: Elevate Your BrandWordPress Websites for Engineers: Elevate Your Brand
WordPress Websites for Engineers: Elevate Your Brandgvaughan
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Commit University
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLScyllaDB
 
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage CostLeverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage CostZilliz
 
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek SchlawackFwdays
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Patryk Bandurski
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupFlorian Wilhelm
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024BookNet Canada
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 3652toLead Limited
 

Recently uploaded (20)

Gen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfGen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdf
 
DMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special EditionDMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special Edition
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL Certs
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):
 
Bun (KitWorks Team Study 노별마루 발표 2024.4.22)
Bun (KitWorks Team Study 노별마루 발표 2024.4.22)Bun (KitWorks Team Study 노별마루 발표 2024.4.22)
Bun (KitWorks Team Study 노별마루 발표 2024.4.22)
 
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding Club
 
Commit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyCommit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easy
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?
 
Connect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationConnect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck Presentation
 
WordPress Websites for Engineers: Elevate Your Brand
WordPress Websites for Engineers: Elevate Your BrandWordPress Websites for Engineers: Elevate Your Brand
WordPress Websites for Engineers: Elevate Your Brand
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQL
 
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage CostLeverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
 
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project Setup
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
 
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptxE-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365
 

ISHS - Molecular Markers In Horticulture Presentation

  • 1. Sequenced RAD Markers: A SNP Discovery and Genotyping Platform July 30th, 2009 Floragenex Presenter: Dr. Eric Johnson, Chief Technology Officer © Floragenex, Inc. 2009 www.floragenex.com
  • 2. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population © Floragenex, Inc. 2009 www.floragenex.com
  • 3. Floragenex Restriction-site Associated DNA (RAD) Technology © Floragenex, Inc. 2009 www.floragenex.com
  • 4. RAD Markers Identify a Variety of Polymorphisms Sequences with a single change A B 18 00 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAAAAGAAGGACAA 38G>A 00 19 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAGAAGAAGGACAA Sequences with complex changes A B 19 00 CCGGCGCAAGGCCTTCTACTGATCTGGTACGCTATCTCTTAGCATGTCC 20C>T 48A>C 00 17 CCGGCGCAAGGCCTTCTACCGATCTGGTACGCTATCTCTTAGCATGTAC 00 29 CCGGCGCGATCTGCAGGGGCGCCGACGACATTATTCCTTCGGCTCGCCG 33G>A 34+TTC 44 00 CCGGCGCGATCTGCAGGGGCGCCGACGACATTG---CTTCGGCTCGCCGTGG Dominant markers “snip-SNPs” A B 00 42 CCGGCGAAACACGGGGCCACGGCGCAGGCGTTCTCCATCTCCAAAGAAC © Floragenex, Inc. 2009 www.floragenex.com
  • 5. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a populatio © Floragenex, Inc. 2009 www.floragenex.com
  • 6. Paired-end Sequencing for RAD LongReads © Floragenex, Inc. 2009 www.floragenex.com
  • 7. RAD LongRead contigs range in size RAD LongRead contig lengths 1500 1125 # of contigs 750 375 0 100 200 300 400 500 600 700 800 900 Contig length © Floragenex, Inc. 2009 www.floragenex.com
  • 8. RAD LongReads for Genotyping Assay Development Goal • Identify testcross segregating alleles for translation into Sequenom iPlex assay format RAD LongRead sequencing results • ~43,000 contigs • 9,903 SNPs identified • 1,005 InDels identified Validation test • 280 SNPs were converted into a Sequenom assay (120 bp free of other polymorphisms) Results 1) Nearly 100% conversion rate into a functional assay 2) ~85% of identified SNPs segregated as expected and mapped to LGs © Floragenex, Inc. 2009 www.floragenex.com
  • 9. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population © Floragenex, Inc. 2009 www.floragenex.com
  • 10. Trait mapping with bulked populations © Floragenex, Inc. 2009 www.floragenex.com
  • 11. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population © Floragenex, Inc. 2009 www.floragenex.com
  • 12. RAD-based Physical and Genetic Maps can optimize Whole Genome Assembly © Floragenex, Inc. 2009 www.floragenex.com
  • 13. RAD Summary RAD markers focus high-depth sequencing on a fraction of the genome • de novo marker discovery • marker density can scale with project goals RAD LongRead markers • develop long contigs of 200-800 bp • good for porting SNPs to other genotyping platforms • discriminates between homeologous genomes Trait mapping • Rapidly identify Mendelian alleles Genetic mapping and physical mapping • RAD marker-based maps can tie together for genome assembly © Floragenex, Inc. 2009 www.floragenex.com
  • 14. Questions? Floragenex Plant Genomics Team: Eric Johnson, Chief Technical Officer eric@floragenex.com Rick Nipper, VP of Research rick@floragenex.com Office Phone 541.343.0747 © Floragenex, Inc. 2009 www.floragenex.com