ISHS - Molecular Markers In Horticulture Presentation

1,340 views

Published on

Presentation by CTO Eric Johnson on the various applications and features of RAD based sequencing technology to plant sciences.

Published in: Technology
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
1,340
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
46
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide
  • ISHS - Molecular Markers In Horticulture Presentation

    1. 1. Sequenced RAD Markers: A SNP Discovery and Genotyping Platform July 30th, 2009 Floragenex Presenter: Dr. Eric Johnson, Chief Technology Officer www.floragenex.com © Floragenex, Inc. 2009
    2. 2. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population • Physical maps – Rapid ordering of large BAC libraries www.floragenex.com © Floragenex, Inc. 2009
    3. 3. Floragenex Restriction-site Associated DNA (RAD) Technology www.floragenex.com © Floragenex, Inc. 2009
    4. 4. RAD Markers Identify a Variety of Polymorphisms Sequences with a single change A B 18 00 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAAAAGAAGGACAA 38G>A 00 19 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAGAAGAAGGACAA Sequences with complex changes A B 19 00 CCGGCGCAAGGCCTTCTACTGATCTGGTACGCTATCTCTTAGCATGTCC 20C>T 48A>C 00 17 CCGGCGCAAGGCCTTCTACCGATCTGGTACGCTATCTCTTAGCATGTAC 00 29 CCGGCGCGATCTGCAGGGGCGCCGACGACATTATTCCTTCGGCTCGCCG 33G>A 34+TTC 44 00 CCGGCGCGATCTGCAGGGGCGCCGACGACATTG---CTTCGGCTCGCCGTGG Dominant markers “snip-SNPs” A B 00 42 CCGGCGAAACACGGGGCCACGGCGCAGGCGTTCTCCATCTCCAAAGAAC www.floragenex.com © Floragenex, Inc. 2009
    5. 5. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population • Physical maps – Rapid ordering of large BAC libraries www.floragenex.com © Floragenex, Inc. 2009
    6. 6. Paired-end Sequencing for RAD LongReads www.floragenex.com © Floragenex, Inc. 2009
    7. 7. RAD LongRead contigs range in size RAD LongRead contig lengths 1500 1125 # of contigs 750 375 0 100 200 300 400 500 600 700 800 900 Contig length www.floragenex.com © Floragenex, Inc. 2009
    8. 8. RAD LongReads for Genotyping Assay Development Goal • Identify testcross segregating alleles for translation into Sequenom iPlex assay format RAD LongRead sequencing results • ~43,000 contigs • 9,903 SNPs identified • 1,005 InDels identified Validation test • 280 SNPs were converted into a Sequenom assay (120 bp free of other polymorphisms) Results 1) Nearly 100% conversion rate into a functional assay 2) ~85% of identified SNPs segregated as expected and mapped to LGs www.floragenex.com © Floragenex, Inc. 2009
    9. 9. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population • Physical maps – Rapid ordering of large BAC libraries www.floragenex.com © Floragenex, Inc. 2009
    10. 10. Trait mapping with bulked populations www.floragenex.com © Floragenex, Inc. 2009
    11. 11. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population • Physical maps – Rapid ordering of large BAC libraries www.floragenex.com © Floragenex, Inc. 2009
    12. 12. RAD-Based Physical Mapping RAD sequences form a fingerprint for each BAC Digestion Sites BAC RAD Sequence A RAD-based physical map closes gaps in a whole genome assembly RAD Sequence BACs WGS Contigs Sequence-Based Genetic Markers www.floragenex.com © Floragenex, Inc. 2009
    13. 13. RAD-based Physical and Genetic Maps can optimize Whole Genome Assembly www.floragenex.com © Floragenex, Inc. 2009
    14. 14. RAD Summary RAD markers focus high-depth sequencing on a fraction of the genome • de novo marker discovery • marker density can scale with project goals RAD LongRead markers • develop long contigs of 200-800 bp • good for porting SNPs to other genotyping platforms • discriminates between homeologous genomes Trait mapping • Rapidly identify Mendelian alleles Genetic mapping and physical mapping • RAD marker-based maps can tie together for genome assembly www.floragenex.com © Floragenex, Inc. 2009
    15. 15. Questions? Floragenex Plant Genomics Team: Eric Johnson, Chief Technical Officer eric@floragenex.com Rick Nipper, VP of Research rick@floragenex.com Office Phone 541.343.0747 www.floragenex.com © Floragenex, Inc. 2009

    ×