biotechnology

1. Vol. 58, No. 9INFECTION AND IMMUNITY, Sept. 1990, p. 2821-2827
0019-9567/90/092821-07$02.00/0
Copyright X) 1990, American Society for Microbiology
Selection and Characterization of Recombinant Clones That Produce
Mycobacterium leprae Antigens Recognized by Antibodies in Sera
from Household Contacts of Leprosy Patients
RUDY A. HARTSKEERL,* RIA M. VAN RENS, LINDA F. E. M. STABEL, MADELEINE Y. L. DE WIT, AND
PAUL R. KLATSER
N. H. Swellengrebel Laboratory of Tropical Hygiene, Royal Tropical Institute, Meibergdreef39, 1105 AZ Amsterdam,
The Netherlands
Received 21 February 1990/Accepted 29 May 1990
A Mycobacterium leprae expression library was constructed in the vectors EX1, pEX2, and pEX3 and
screened with a pool of 19 well-absorbed sera from household contacts of leprosy patients. Twelve selected
recombinants that were further characterized differed clearly from recombinants selected with murine
monoclonal antibodies. Whereas the monoclonal antibodies recognized mainly six recombinant antigens, the
human sera from contacts reacted with a range of different recombinant antigens. None of the contact
recombinant antigens was identical or related to well-characterized antigens from M. leprae or other
mycobacteria selected with monoclonal antibodies, including proteins of the heat shock families. Two groups
of recombinant antigens could be distinguished: one that was recognized by all sera used in the pool and one
that was recognized by only a limited number of sera. These antigens, selected with sera from household
contacts of previously untreated lepromatous leprosy patients, may be relevant to the immune responses during
the early phase of infection with M. leprae.
Leprosy is still a major health problem in many parts of
the world; despite the great efforts that have been made to
better control the disease, the prevalence of the disease
remains at a constant level (41). Studies on the immunology
of leprosy have mainly focused on clinical aspects of the
disease. Relatively little is known about the immunological
events during the preclinical phase of the disease.
Serological studies among household contacts of leprosy
patients, in which higher seropositivity rates were reported
than the incidence rates expected in these populations,
suggest that seropositivity reflects subclinical infection (2,
12). Considering the low sensitivity of these tests when
relatively small numbers of bacilli are present (2), the
seropositive contacts are probably only a small proportion of
the total pool of infected individuals. The dynamics of
infection would likely be, as for many other infectious
diseases, as follows. A person becomes colonized with
Mycobacterium leprae and subsequently either gets rid of
the bacterium or becomes infected (invasion of tissue by
bacteria). Subsequently, the individual could either over-
come the infection (by an effective immune response or by
treatment) or develop the disease. Little is known about the
factors that determine the dynamics of infection. Available
methodology to determine the immunological status of in-
fected individuals lacks either sensitivity, as in the case of
serological tests (2, 13), or specificity, as in the case of the
lepromin skin test (41). However, it is important to broaden
our knowledge of the immunological reactions during the
early stages of infection. Such information could, for exam-
ple, lead to the identification of antigens involved in protec-
tion or in pathogenesis and, equally important, may result in
the development of new tools for the detection of preclinical
leprosy.
Most of the recombinant antigens from M. leprae were
*
Corresponding author.
initially identified either with murine monoclonal antibodies
(45) or with sera from diseased individuals (9, 29). However,
the immune responses in inbred mice and in persons with
clinical leprosy may well be distinct from those during early
infection. As a first step to identify antigens that may play a
role during the early phase of infection with M. leprae, we
screened an M. leprae gene library with sera obtained from
household contacts of untreated multibacillary leprosy pa-
tients. These contacts, who had lived in close proximity with
the index cases for several years, are likely to be infected
with M. leprae. In this report we describe the selection and
characterization of recombinant clones obtained with such
sera.
MATERIALS AND METHODS
Strains and plasmids. M. leprae was isolated from spleen
tissue of experimentally infected armadillos (Dasypus
novemcintus Linn.) as recommended by the World Health
Organization (40). Escherichia coli K-12 strain POP2136 was
used as a host for construction of recombinant plasmids and
for gene expression. POP2136 is a nonexcisable lambda
lysogenic strain carrying the cI ts856 gene (Genofit, Geneva,
Switzerland). Strain S1036 is POP2136 carrying plasmid
pEX2. Plasmids pEX1, pEX2, and pEX3 have been de-
scribed by Stanley and Luzio (34).
Media and reagents. Strain POP2136 and derivatives were
grown in LB medium (22). When appropriate, 100 ,ug of
ampicillin per ml was added to the medium. Difco agar
(1.5%) was added to solidify the medium. Restriction endo-
nucleases and T4 DNA ligase were from Boehringer GmbH
(Mannheim, Federal Republic of Germany) and New En-
gland BioLabs, Inc. (Beverly, Mass.). Alkaline phosphatase-
labeled anti-human polyvalent immunoglobulins were from
Sigma Chemical Co. (St. Louis, Mo.).
Sera. Sera from 19 household contacts of previously
untreated lepromatous leprosy patients (coded in this paper
as a to s) were kindly provided by R. V. Cellona (Leonard
2821
onFebruary16,2017byTamilNaduVeterinary&AnimalScienceUniversityhttp://iai.asm.org/Downloadedfrom

2. 2822 HARTSKEERL ET AL.
Wood Memorial Center for Leprosy Research, Cebu City,
The Philippines). The contacts included 8 women and 11
men whose mean age at the time of blood withdrawal was
34.7 years (standard deviation, 14.8 years). The mean dura-
tion of contact with the index case was 17.6 years (standard
deviation, 8.4 years). During follow-up of these contacts up
to 3 years after blood withdrawal, none of them had become
a clinically and bacteriologically established leprosy patient.
None of the contacts had been vaccinated with Mycobacte-
rium bovis BCG.
Sera were pooled and extensively absorbed as described
by Sathish et al. (29). Briefly, the pool of sera was incubated
overnight at 4°C with whole POP2136 and heat-induced
S1036 cells. Subsequently, the pool was absorbed over
columns of lysates of strain POP2136, heat-induced strain
S1036, and purified beta-galactosidase from E. coli (Sigma)
coupled to cyanogen bromide (CNBr)-activated Sepharose
4B (Sigma). The pool was subjected to four cycles of
absorption. Pooled sera were used at a final dilution of 1:200
in blocking buffer (see below) to screen the libraries. Ab-
sorption of individual sera was essentially done by the same
procedure, except that the elution over the columns was
omitted.
DNA technology. Standard procedures were used for re-
striction enzyme digestion, ligation, and transformation (22).
Preparation of genomic DNA from nonirradiated M. leprae
was done as described previously (15). DNA sequencing of
the pEX1, pEX2, and pEX3 derivatives was done by the
dideoxy-chain termination method (28) with a T7 sequencing
kit (Pharmacia LKB, Uppsala, Sweden) and a Thermalbase
Taq sequencing kit (Stratagene, La Jolla, Calif.). For DNA
sequencing, plasmid DNAs were isolated by alkaline extrac-
tion (5) and further purified by CsCl gradient centrifugation
or by use of the Geneclean kit (BIO 101, La Jolla, Calif.).
Synthetic oligonucleotides S10 (CAACATCAGCCGCT
ACAGTC), 86.25-2 (GGCGACGACTCCTGGAGCCCG),
and 17.5.88-2 (CAGCAAGCTTGGCTGCAGGTCG) were
used as primers for DNA sequencing. Primers S10 and
86.25-2 are homologous to the region of lacZ from 145 to 125
base pairs (bp) and 33 to 12 bp, respectively, upstream of the
EcoRI site (18). Primer 17.5.88-2 is homologous to the region
13 to 35 bp downstream of this EcoRI site in pEX2 (34). All
primers were synthesized on a 381A DNA synthesizer
(Applied Biosystems) and were used without further purifi-
cation.
For dot blot hybridization, 1-,ug samples of plasmid DNA
were spotted onto Duralose-UV membranes (Stratagene).
The subsequent procedure was essentially the same as for
colony hybridization (22). Insert DNA used as a probe was
excised from hybrid plasmids with Sail and SmaI. Small
insertion fragments (100 to 400 bp) were amplified as previ-
ously described (15) with oligonucleotides 86.25-2 and
17.5.88-2 as the set of primers in the amplification reaction.
Amplified fragments were cleaved with Sall and SmaI.
Unique cleavage sites for these restriction enzymes are
positioned to the left and right of the BamHI cloning site of
the pEX plasmid vectors. Fragments were separated by
electrophoresis on agarose gels and isolated from the aga-
rose with the Geneclean kit. Some of the DNA inserts
apparently contained one or more Sall-SmaI cleavage sites,
since more than one insert fragment was visible on the
agarose gels. Preparation of 32P-labeled probe DNA was
done with a random priming DNA labeling kit (Boehringer)
according to the instructions of the manufacturer. Addition-
ally, probe DNA was labeled by using a DNA digoxigenin-
dUTP labeling and detection kit (Boehringer). Prehybridiza-
tion, hybridization, and washing of all membranes were done
as described previously (15). DNASIS and PROSIS software
(Pharmacia LKB) was used for the homology search of
nucleotide and amino acid sequences.
Construction of the M. leprae expression libraries in pEX1,
pEX2, and pEX3. M. leprae genomic DNA was partially
digested with Sau3A as follows: 5 U of Sau3A was added to
10 ,ug ofM. Ieprae DNA in 100 RI1 of Sau3A buffer. After 30,
60, and 120 s of incubation at 37°C, samples of 30 ,u1 were
taken and immediately transferred to phenol saturated with
10 mM Tris hydrochloride (pH 8.0)-10 mM EDTA to stop
the reaction. After phenol-ether extraction, DNA was recov-
ered by ethanol precipitation. Two fractions (30 and 60 s)
contained fragments of 0.5 to 4 kbp, judged from electropho-
retic patterns of the fractions on agarose gels. These frac-
tions were pooled and used for cloning into the pEX plas-
mids.
Samples (1.5 p.g) of partially digested M. leprae DNA
were ligated to 0.15 p.g of pEX1, pEX2, and pEX3 digested
with BamHI. Transformation of strain POP2136 with ligated
DNA resulted in 2 x 104 to 5 x 104 transformants per ligation
mixture.
Screening of the pEX1, pEX2, and pEX3 libraries. Colonies
grown on nitrocellulose filters (type BA 85; Schleicher &
Schuell, The Netherlands) at 30°C were replicated toa
second filter. Induction of expression and preparation of the
replica filters for colony enzyme-linked immunosorbent as-
say was essentially done as described by Stanley and Luzio
(34). For the colony enzyme-linked immunosorbent assay,
filters were washed in wash buffer (100 mM Tris hydrochlo-
ride [pH 8.0], 0.1% [vol/vol] Tween 80, 0.02% [wt/vol]
NaN3) and in blocking buffer (wash buffer containing 0.25%
[wt/vol] bovine serum albumin and 0.25% [wt/vol] gelatin).
Filters were then incubated overnight with the pooled sera
and washed again in wash buffer before incubation with
alkaline phosphatase-labeled anti-human immunoglobulins
diluted 1:500 in blocking buffer. The filters were then washed
and developed in substrate buffer (100 mM Tris hydrochlo-
ride [pH 9.6]-100 mM NaCl-50 mM MgCl2 containing 0.1 mg
of nitro blue tetrazolium grade III per ml and 0.05 mg of
5-bromo-4-chloro-3-indolylphosphate per ml).
Immunological techniques. Sodium dodecyl sulfate-poly-
acrylamide gel electrophoresis was done on 8% acrylamide
gels as described by Laemmli (21), and Western immuno-
blotting was done bythe method of Burnette (7) as modified
by Van Embden et al. (38). For dot blot analysis, 5 p.1 of
lysate (optical density at 600 nm, 5) was spotted onto
nitrocellulose or Immobilon-P (Millipore B.V., Etten-Leur,
The Netherlands) membranes. Substrate buffer for alkaline
phosphatase-labeled anti-human immunoglobulins was as
described above for the colony enzyme-linked immunosor-
bent assay.
RESULTS
M. leprae expression library. Restriction enzyme analysis
of plasmid DNA isolated from randomly picked colonies of
the gene libraries in pEX1, pEX2, and pEX3 revealed that
approximately 40% of the plasmids contained an M. leprae
DNA insert larger than 400 bp, with a mean ofabout 1.0 kbp.
Colony hybridization with 32P-labeled M. Ieprae genomic
DNA as a probe showed that up to 60% of the plasmids
contained an M. leprae DNA insert. Apparently, a substan-
tial number of plasmids contained DNA inserts smaller than
400 bp, which are difficult to detect on agarose gels. Based
on these data, the number of transformants, and a genomic
INFECT. IMMUN.
onFebruary16,2017byTamilNaduVeterinary&AnimalScienceUniversityhttp://iai.asm.org/Downloadedfrom

3. M. LEPRAE ANTIGENS RECOGNIZED BY CONTACTS' SERA 2823
A
a b c d e f g h j k ni n
. 4b,.
116- -."_ _ "
B
a b c d e f g h k ni ri
116-
FIG. 1. Coomassie brilliant blue-stained sodium dodecyl sulfate-
polyacrylamide gel (A) and Western blot (B) of crude lysates (5 ,ul,
optical density at 600 nm of 5 for sodium dodecyl sulfate-polyacryl-
amide gel electrophoresis and Western blotting) of the following
heat-induced strains: a, S1036; b, S1143; c, S1142; d, S1141; e,
S1140; f, S1130; g, S1129; h, S1123; i, S1120; j, S1119; k, S1116; 1,
S1115; m, S1114; n, S1113. The Western blot was developed with a
pool of 19 sera from household contacts; the sera were absorbed as
described in Materials and Methods.
size of 3.3 x 103 kbp for M. leprae (10), each pEX1-, pEX2-,
or pEX3-derived recombinant contained three to six myco-
bacterial genome equivalents.
Selection of recombinants. About 1.7 x 105 colonies of the
M. leprae gene libraries in pEX1, pEX2, and pEX3 were
screened with the absorbed contact serum pool. We selected
36 potentially positive recombinants. These recombinants
were characterized with respect to DNA inserts and expres-
sion products. Recombinant plasmids contained inserts
ranging in size from 0.2 to 2.5 kbp. All recombinants
expressed M. leprae antigens as fusion proteins with ,-
galactosidase, with apparent molecular weights ranging from
116,000 (116K proteins) to 145,000 (145K proteins). Western
blot analysis revealed that 12 of the recombinants produced
antigens that clearly reacted more strongly with antibodies in
the sera from contacts than did the control antigen, cro-,B-
galactosidase, produced by strain S1036 (Fig. 1). Seven
recombinants produced proteins that were reactive with the
conjugate in the absence of serum and the lysates of the
other 17 recombinants produced bands on Western blots
with intensities that were comparable to that of the control
antigen (data not shown). It is possible that these latter
recombinants expressed conformational epitopes. To inves-
tigate this, we performed a dot blot analysis in which, in
contrast to Western blot analysis, conformational epitopes
remain intact. However, no positive reactions could be
detected on the dot blots with these clones (data not shown).
Therefore, we believe that these 17 recombinants are arti-
facts. We continued our study with the 12 clearly positive
recombinants and one conjugate-reactive recombinant for
further analysis (Table 1). All fusion proteins appeared as
clear bands migrating at a position of 116K or higher, both on
TABLE 1. Characterization of recombinant clones
selected with contacts' sera
Strain Plasmid Vector Mol wt' DNA insertG%
S1113 pTHL1031 pEXl 116,000, 120,000 0.6 75.6
S1114 pTHL1032 pEX2 140,000 1.0 62.2
S1115 pTHL1033 pEX3 135,000 1.1 69.9
S1116 pTHL1034 pEX3 119,000 0.213* 63.8
S1119 pTHL1037 pEX1 116,000 1.5 72.7
S1120 pTHL1038 pEX2 116,000 0.146* 60.6
S1123 pTHL1041 pEX2 118,000, 135,000 >0.3 70.6
S1129 pTHL1051 pEX3 145,000 0.6 61.7
S1130 pTHL1052 pEX3 140,000 0.7 65.0
S1140d pTHL1055 pEX1 116,000, 119,000 1.9 77.5
S1141 pTHL1056 pEX2 120,000 1.0 67.8
S1142 pTHL1057 pEX3 123,000 1.2 62.2
S1143 pTHL1058 pEX3 119,000, 120,000 0.3 66.1
a Apparent molecular weights deduced from electrophoretic patterns on
sodium dodecyl sulfate-polyacrylamide gels. Two values indicate that two
bands appeared on sodium dodecyl sulfate-polyacrylamide gels and on
Western blots (Fig. 1).
b Sizes of DNA inserts were estimated from electropheretic patterns of
restriction enzyme digests on agarose gels. Sizes derived from established
DNA sequences are indicated by asterisks.
c Content of nucleotides G+C in the coding parts of the fragments depicted
in Fig. 2.
d Antigen was reactive to conjugate in the absence of serum (see Results).
sodium dodecyl sulfate-polyacrylamide gels and Western
blots (Fig. 1).
Nucleotide and deduced amino acid sequences. To charac-
terize the recombinant antigens, we determined part of the
nucleotide sequence of one strand of the various DNA
inserts, adjacent to lacZ (Fig. 2). Both strands of the small
inserts of plasmids pTHL1034 and pTHL1038 were se-
quenced. The correct reading frame of the M. leprae part of
the fused genes could be derived from the reading frame of
the lacZ counterpart (18). The coding regions of the various
established DNA sequences had an overall G+C content of
60% or more (Table 1). The established sequences shown in
Fig. 2 do not have regions of homology and thus represent
different antigenic determinants. Moreover, as can be de-
duced from the apparent molecular weights (Table 1) and the
established DNA sequences (Fig. 2), eight of the recombi-
nant plasmids (pTHL1031, pTHL1034, pTHL1037,
pTHL1038, pTHL1055, pTHL1056, pTHL1057, and
pTHL1058) encode C-terminal parts of different antigens,
suggesting that a high percentage of the recombinants ex-
pressed different M. leprae antigens. Consistent with this,
dot blot hybridizations revealed that none of the DNA
inserts hybridized to DNA from a pEX clone other than its
own (data not shown). Apparently, the pEX-derived plas-
mids contained distinct DNA inserts. Therefore, we con-
clude that the selected recombinants expressed parts of
different antigens.
Do the immunologically reactive clones express known
mycobacterial antigens? Comparison of nucleotide and de-
duced amino acid sequences with known sequences was
used to establish homologies and relationships with a num-
ber of well-characterized mycobacterial antigens. The DNA
sequences of the clones selected with contacts' sera were
compared with the sequences of the genes encoding the
following proteins: 70K (14), 65K (26), 36K (PRA; 37), 28K
(9), 18K (6), 12K (16), and manganese superoxide dismutase
(35) of M. leprae; 65K (30), 19K (3), 12K (4, 31), and Pab (1)
of Mycobacterium tuberculosis; 65K (32), MPB70 (27),
MPB64 (42), MPB57 (43), and the a antigen (24) of M. bovis
VOL. 58, 1990
onFebruary16,2017byTamilNaduVeterinary&AnimalScienceUniversityhttp://iai.asm.org/Downloadedfrom

4. 2824 HARTSKEERL ET AL. INFECT. IMMUN.
pTHL 1031 1 GGATCGGAACCGCGAAAACGCGACGGCCCGCCGCGCGGTGCGCGGCGGGCCGACAAGCTT 60
1 G S E P R K R D G P P R G A R R A D K L 20
61 GCCGGTGGCGGAAGCGTCCGCCGG
21 A G G G S V R R
pTHL1032 1 GGGATCGAACAGCTTGACGCCCGTGTCGAGGCGGATCTACCGCCAGTTCTCGCTGACCAT 60
1 G E Q L D A R V E A D L P P V L A D H 20
61 CGTCTCCTCGATGGCGCTGTCGGTGCT
21 R L L D G A V G A
pTHL1033 1 GAAACCGTGCGCCTGGCCGTGCGCCAGCTCGACCGCGTGATCGACCTGAACTTCTATCCG 60
1 E T V R L A V R Q L D R V D L N F Y P 20
61 ATCGAGACCGCACGCCGCGCCAACCTGCGCTGGCGCCCGGTCGGCCTCGGCGCGATGGGC 120
21 E T A R R A N L R W R P V G L G A M G 40
121 CTGCAGGACGTGTTCTTCAAGCTGCGCCTGCCGTTCGACTCCGAGCCGGCG
41 L Q D V F F K L R L P F D S E P A
pTHL1034 1 GATCGGCGACGTCGACCAAGACCGCGTGGTCGCGGTGACCAACGTCGGCCACCTGCTCGC 60
1 D R R R R P R P R G R G D Q R R P P A R 20
61 GTTCCCGGTCGCGGAGCTGCCGGAACTCGACAAGGGCAAGGGCAACAAGATCCTCCACAT 120
21 V P G R G A A G T R Q G Q G Q Q D P P H 40
121 ACCATTCCGAACCGCGTTGAGACAGCCGAGCGTGCCGATTTGACGCATAGTCGTCGGTAA 180
41 T P N R V E T A E R A D L T H S R R * 60
181 GTACCAAGGTGGAGTCGTCATCCGCCGCCGATCC
pTHL1037 1 GGATCACAGCTTCCGCGCGTCGGGGCACCACGGTGATCGATCCGGGCTTCCTCGCCGTGT 60
1 G S Q L P R V G A PR *
61 ACGAGGAAGGCAAGGACGCCAAGGCCGCCGAGGACGAGGACGAAGGCCGCAAGCTGCCGC 120
pTHL 1038 1 GGGATCGAGACGCGCAACAGCGATGGCCTTCTCGACGGGAAAGCACGGGGCACTGTCGAT 60
1 G E T R N S D G L L D G K A R G T V D 20
61 TTCTACTAACGCGTGTCGGCCTTCCAGTTGCAGGTAACGAAGGACGATGTACCCGTCACG 120
21 F Y *
1 21 CAATTTCAGTGGCTTCTGACGCTCGATCC
pTHL1041 1 GGGATCTCGCCGTTCGGGCTGCCGGTGAACTTGTACGCTGCGTCCAGCGCCTTGAGCTGC 60
1 G S P F G L P V N L Y A A S S A L S C 20
61 TCGACGCTGAGCGTTTCGGGCATGCCCTCGATGAAGTGCACCCACTCCTGCGTGCTCCAC 120
21 S T L S V S G M P S M K C T H S C V L H 40
1 21 TTCGCGGTCGCCGCGGCCGCGGCAGCGTGCCGCCCTCGACCCAGGCCTTGCGCGCGGCGT 180
41 F A V A A A A A A C R P R P R P C A R R 60
pTHL1051 1 GATCACCACGCCGCCCTTGTCGCCCTTGTACATGTGCGGCAACCGGGCCTTGGTGGTCAG 60
1 D H H A A L V A L V H V R 0 P G L G G Q 20
61 GAAGGCGCCGTCGAGATGGATGGCGAGCATCTTCTTCCAGTCGGCGAAGGCGTAGTTCTC 120
21 E G A V E M D G E H L L P V G E G V V L 40
121 GATCGGATTGACGATCTGGATGCCGGCGTTGGAGACCAGGATGTCGATGCCGCCGAGTTG 180
41 D R D D L D A G V G D 0 D V D A A E L 60
pTHL1052 1 GATCGCGGCGAATGCGGCCGAGGTCATGATCGCGTAGCTGATCGCGTAGAACATCGCCGC 60
1 D R G E C G R G H D R V A D R V E H R R 20
61 GGCGAAGCCTGCGCGCCGCCGCCGGCCATGCCGATGAACAGGAAGCCGACATGCGAGACC 120
21 G E A C A P P P A M P M N R K P T C E T 40
pTHL 1055 1 GGATCCCGCCCAGCGCAGAGCCTGCGCGCAGGCCTATCTCAACACCCTGCGCCTGGCCGT 60
1 G S R P A Q S L R A G L S Q H P A P G R 20
61 CGGCCGCGCCGCGCCGGCCGGCGCAGCGCGTTCACCCGTGCCGCGATCCGGGCCAACACC 120
21 R P R R A G R R S A F T R A A I R A N T 40
pTHL1056 1 GGGATCGGCGATTACGACAGCGCTGGCGCAGCCAAACTGCAGGCGGTGTGGCTCGGCAAC 60
1 G G D Y D S A G A A K L 0 A V W L G N 20
61 GCGCCTGTCGGTTTGGTGGTCGGGAGCGGCAGCACGCAGACGCTGCAATATGTGCAGCCG 120
21 A P V G L V V G S G S T Q T L Q Y V Q P 40
121 GATCGCCAGCGCCGGCGCGCCGACCACCACGCCCAGCGCATAGGCGCTGATGACATGGCC 180
41 D R Q R R R A D H H A 0 R G A D D M A 60
pTHL 1057 1 GATCAGCCAGTCCAGGCTCATGCCGTCCTTCGCGAAAATGCGCAGAAGCTGTTCGAGGTG 60
1 D Q P V 0 A H A V L R E N A 0 K L F E V 20
61 CCGCAAACTCGGCTCGCTTCTGCCGTTTTCCCACTTGGATACAGTGGCAGAGGTGATCAA 120
21 P Q T R L A S A V F P L G Y S G R G D 0 40
121 CGCGTCGATGCGCTTGCCGGCGGCGGCCTTGGGGATGTCCTGCACGGCGGCGAGGAACTC 180
41 R V D A L A G G G L G D V L H G G E E L 60
pTHL1058 1 GATCGCGGCCTGGATGCGGCTTTGCAGCGCGCTCACGTCCAGGCCTTCGAGCAAGGTGCC 60
1 D R G L D A A L 0 R A H V Q A F E Q G A 20
61 GGCCAGGTCGGGAATGCCGTAGTTCAGTACGCTGGCGGCGACGTAGGGATGCGCCTCGAG 120
21 G 0 V G N A V V Q Y A G G D V G M R L E 40
121 CGCTTCGTCAGACCAGTGCCGGGTGCAGTTGAGCAGCCACGACAGGTCGCGACGATGCAT 180
41 R F V R P V P G A V E Q P R Q V A T M H 60
FIG. 2. Nucleotide sequence and deduced amino acid sequence of a part of the M. leprae DNA inserts of the various hybrid plasmids
encoding M. leprae antigenic determinants recognized by contacts' sera. The DNA sequence of the part of the inserts adjacent to lacZ was
determined for one strand by using primers S10 and 86.25-2. Primer 17.5.88-2 was used to sequence the complementary strands of the inserts
of plasmids pTHL1034 and pTHL1038. Boldface type indicates nucleotides belonging to the vector or the BamHI-Sau3A cloning sites.
pTHL1033 contains a mutation at the cloning site; the first nucleotide in the sequence belongs to the vector. The translation of all nucleotide
sequences is in accordance with the open reading frame of lacZ in the pEX plasmids.
BCG; and the a antigen of Mycobacterium kansasii (23). In antigens are related at the protein level. To investigate such
all cases, the complementary strands were also involved in a relationship, deduced translation products of all genes as
the comparisons. No significant homology was found with well as the amino acid sequence of the tuberculin-active
any of these genes. Consequently, none of the cloned protein of M. tuberculosis (20) were compared. Errors in the
contact antigens is identical with any ofthe known M. leprae nucleotide sequence due to the sequencing of only one
antigens, nor is any antigen encoded by possible open strand could have led to frame shifts and hence to a partly
reading frames on the complementary strands of the corre- incorrect deduction of the translation products. To prevent
sponding genes. Furthermore, at the DNA level no relation- misinterpretations caused by the use of such wrongly de-
ship could be found between the contact antigens and the duced amino acid sequences, the translation products from
other mycobacterial antigens. However, it could be that the all three reading frames were used in the homology search.
onFebruary16,2017byTamilNaduVeterinary&AnimalScienceUniversityhttp://iai.asm.org/Downloadedfrom

5. M. LEPRAE ANTIGENS RECOGNIZED BY CONTACTS' SERA
B a bode f gh±i j k1 m no p q r a
ili
FIG. 3. Western blot analysis of lysates of recombinant clones
with the individual contact sera from the pool. (A) Lysate of strain
S1143 as a typical example of group 1 lysates, reacting with all
individual sera and (B) lysate of strain S1120 as a typical example of
group 2 lysates, reacting with a limited number of individual sera.
Lanes a through s were developed with individual sera coded a
through s, respectively. Individual sera were absorbed with E. coli
as described in Materials and Methods.
No significant homologies between any one of these trans-
lation products and any of the other mycobacterial antigens
were found.
Taking these results together, we conclude that the recom-
binant M. leprae antigens selected with sera from contacts
are not homologous or related to any other well-character-
ized mycobacterial antigen.
Reactivity of recombinant antigens with individual sera. To
investigate which ofthe sera in the pool contained antibodies
to the fusion proteins expressed by the selected recombi-
nants, lysates of these recombinant clones were subjected to
Western blotting with the individual sera as probes. Based
on the results from the Western blotting experiments, the
antigens could be divided into two groups. Group 1 antigens
showed a weak reaction with all tested sera, i.e., S1113,
S1114, S1115, S1116, S1119, S1123,S1141, S1142, and
S1143. Group 2 antigens reacted strongly with a limited
number of sera, i.e., S1120 (reacting with serum c), S1129
(reacting with sera e, h, m, and n), and S1130 (reacting with
serum k). As typical examples for each group of antigens,
Western blots of lysates of S1143 (group 1) and S1120 (group
2) are shown in Fig. 3.
DISCUSSION
In this paper we report the selection and characterization
of several antigenic determinants of M. leprae that are
recognized by sera from well-documented contacts of lep-
rosy patients. For this selection, we constructed a genomic
library of DNA from nonirradiated M. leprae.
The previously described lambda gtll::M. leprae expres-
sion library (45) was shown to contain a relatively high
percentage of a number of identical recombinants (37; un-
published observations). This is probably caused by effec-
tive multiplication of these recombinants during amplifica-
tion of the library. Recombinants with alow replication rate
are present in low numbers in the library and hence can
easily be missed in the screening. Instead of using an
amplified library, we preferred to construct a new expression
library and to use it without significant amplification in the
screening procedure.
From this library we selected 12 recombinants that pro-
duced antigenic determinants clearly recognized by sera
from contacts on Western blots. All antigens were produced
as fusion proteins ranging from 116K to 145K. This means
that parts of 2K to 31K M. leprae antigens were expressed
by the various recombinants. The corresponding DNA in-
serts had sufficient coding capacities.
To further characterize the recombinant antigens, we
established the nucleotide sequence of a 84- to 180-bp
segment of the various inserts adjacent to lacZ. Based on
these nucleotide sequences and on the apparent molecular
weights ofthe recombinant antigens, as well as on the results
of DNA hybridizations, we conclude that all 12 recombi-
nants probably encode different antigens. One of seven
recombinants showing conjugate binding in the absence of
serum was characterized in a similar way (S1140). Whether
such expressed recombinants might bind to the Fc part of
immunoglobulins needs further investigation.
Screening of M. leprae libraries with sera of leprosy
patients (9, 29) or their contacts (this report) has resulted in
the selection of recombinants producing a variety of anti-
gens. A relatively large number of antigens had been identi-
fied earlier in M. leprae by using blotting techniques (8, 11,
19). In contrast, murine monoclonal antibodies have pre-
dominantly recognized six antigens, 12K, 18K, 28K, 36K,
65K, and 70K (39), which have also been frequently selected
from recombinant libraries. This discrepancy in the number
ofantigens recognized by murine monoclonal antibodies and
human sera might be a reflection of both quantitative and
qualitative differences in their immune responses to M.
leprae.
Comparison ofnucleotide and amino acid sequences ofthe
contact clones did not reveal any significant homology with
other well-characterized antigens from M. leprae or from
other mycobacteria, including the 12K, 18K, 65K, and 70K
heat shock proteins (33, 39, 44). Apparently, the sera con-
tained only limited amounts ofantibodies to these heat shock
proteins. At first glance this seems surprising, since these
stress-related proteins are supposed to be major immunolog-
ical targets (44) and antibody responses to some of these
antigens have been reported in leprosy patients (25). A
possible explanation for the absence of heat shock protein-
producing recombinants could be that heat shock proteins
form a well-conserved group of molecules also present in E.
VOL. 58, 1990 2825
onFebruary16,2017byTamilNaduVeterinary&AnimalScienceUniversityhttp://iai.asm.org/Downloadedfrom

6. 2826 HARTSKEERL ET AL.
coli (33, 36). Hence, cross-reactive antibodies against heat
shock proteins have very likely been depleted during the
absorption step. In agreement with this explanation, no heat
shock protein-producing recombinants could be selected
with E. coli-absorbed patient sera (29). On the other hand, it
might bepossible that no such antibodies are present in most
sera from contacts.
Two groups of recombinant antigens could be distin-
guished: one group was recognized by the sera of all contacts
used in thisstudy; the other group was recognized by the
sera of only a limited number of contacts. Apparently, some
mycobacterial antigenic determinants are capable of induc-
ing antibody responses independent of host-related factors,
whereas others are not.
In this study we describe the identification of M. leprae
antigenic determinants that may play a role at the early stage
of infection. Household contacts used in this study have
lived in the close vicinity of untreated lepromatous leprosy
patients for long periods and are very likely to be infected
with M. leprae. The contacts have not been vaccinated with
M. bovis BCG. Therefore, we assume that the antibodies
present in the absorbed sera are the products of a humoral
response to M. leprae. However, the possibility cannot be
excluded that a portion of the antibodies is directed to
cross-reactive determinants and results from a response to
other mycobacteria. The established DNA sequences had a
G+C content that was much higher than that reported for the
M. leprae genome and more comparable to those of a
number of other mycobacteria (10, 17). Although the se-
quenced parts of the genes may not be representative for the
complete genes, this might indicate that the expressed M.
leprae determinants are not specific for this bacillus but
could be common in a number of other pathogenic and
nonpathogenic mycobacteria.
The contacts used in this study have not yet developed
leprosy, which suggests that they have some form of immu-
nity to the disease. As a continuation of this study, complete
genes of contact antigens will be selected from a cosmid
library. Reactivity patterns of sera of leprosy patients and
their contacts with the complete recombinant antigens, as
well as T-cell responses to these antigens, will be deter-
mined.
The available methodology for the study of infection with
M. leprae and immunity to such infection is inadequate. The
recent development of a polymerase chain reaction for the
sensitive and specific detection of M. leprae (15) has opened
wider perspectives for the future. In this report we describe
previously unidentified antigens, which may be relevant to
immune responses during the early phase of infection. The
combination of studies of infection and immunity should
provide valuable information and contribute to the develop-
ment of tools necessary for the eradication of leprosy.
ACKNOWLEDGMENTS
We thank Caroline Hermans for her assistance in part of the work,
Jelle Thole for his advice, R. V. Cellona (Leonard Wood Memorial
Center for Leprosy Research, Cebu City, The Philippines) for his
generous gift of the sera, and Pamela Wright for critically reading
the manuscript.
This investigation received financial support from the Netherlands
Leprosy Relief Association and from the Commission of European
Communities Directorate General for Science, Research and Devel-
opment (grant TS2-0111-NL).
LITERATURE CITED
1. Andersen, A. B., and E. B. Hansen. 1989. Structure and mapping
of antigenic domains of protein antigen b, a 38,000-molecular-
weight protein of Mycobacterium tuberculosis. Infect. Immun.
57:2481-2488.
2. Anonymous. 1986. Serological tests for leprosy (editorial). Lan-
cet i:533-535.
3. Ashbridge, K. R., R. J. Booth, J. D. Watson, and R. B. Lathigra.
1989. Nucleotide sequence of the 19 kDa antigen from Myco-
bacterium tuberculosis. Nucleic Acids Res. 17:1249.
4. Baird, P. N., M. C. Hall, and A. R. M. Coates. 1988. A major
antigen from Mycobacterium tuberculosis which is homologous
to the heat shock proteins groES from E. coli and the hptA gene
product of Coxiella burneti. Nucleic Acids Res. 16:9047.
5. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction
procedure for screening recombinant plasmid DNA. Nucleic
Acids Res. 7:1513-1524.
6. Booth, R. J., D. P. Harris, J. M. Love, and J. D. Watson. 1988.
Antigenic proteins of Mycobacterium leprae: complete se-
quence of the gene for the 18-kDa protein. J. Immunol. 140:597-
601.
7. Burnette, W. N. 1981. "Western-blotting": electrophoretic
transfer of proteins from sodium dodecyl sulfate-polyacryl-
amide gels to unmodified nitrocellulose and radiographic detec-
tion with antibody and radioiodinated protein A. Anal. Bio-
chem. 112:195-203.
8. Chakrabarty, A. K., M. Maire, and P.-H. Lambert. 1982.
SDS-PAGE analysis of M. leprae protein antigens reacting with
antibodies from the sera from lepromatous patients and infected
armadillos. Clin. Exp. Immunol. 49:523.
9. Cherayil, B. J., and R. A. Young. 1988. A 28-kDA protein from
Mycobacterium leprae is a target of the human antibody re-
sponse in lepromatous leprosy. J. Immunol. 141:4370-4375.
10. Clark-Curtiss, J. E., W. R. Jacobs, M. A. Docherty, L. R.
Ritchie, and R. Curtiss III. 1985. Molecular analysis ofDNA and
construction of genomic libraries of Mycobacterium leprae. J.
Bacteriol. 161:1093-1102.
11. Converse, P. J., T. H. M. Ottenhoff, N. Gebre, J. P. Ehrenberg,
and R. Kiessling. 1988. Cellular, humoral, and gamma interferon
responses to Mycobacterium leprae and BCG antigens in
healthy individuals exposed to leprosy. Scand. J. Immunol.
27:515-525.
12. Douglas, J. T., R. V. Cellona, R. M. Abalos, M. G. Madarang,
and T. T. Fajardo. 1987. The serological reactivity and early
detection of leprosy among contacts of lepromatous patients in
Cebu, Philippines. Int. J. Lepr. 55:718-721.
13. Fine, P. E. M., J. M. Ponnighaus, P. Burgess, J. A. Clarkson,
and C. C. Draper. 1988. Seroepidemiological studies of leprosy
in northern Malawi based on an enzyme-linked immunosorbent
assay using synthetic glycoconjugate antigen. Int. J. Lepr.
56:243-254.
14. Garsia, R. J., L. Hellqvist, R. J. Booth, A. J. Radford, W. J.
Britton, L. Astbury, R. J. Trent, and A. Basten. 1989. Homology
of the 70-kilodalton antigens from Mycobacterium leprae and
Mycobacterium bovis with the Mycobacterium tuberculosis
71-kilodalton antigen and with the conserved heat shock protein
70 of eucaryotes. Infect. Immun. 57:204-212.
15. Hartskeerl, R. A., M. Y. L. de Wit, and P. R. Klatser. 1989.
Polymerase chain reaction for the detection of Mycobacterium
leprae. J. Gen. Microbiol. 135:2357-2364.
16. Hartskeerl, R. A., L. F. E. M. Stabel, C. J. Hermans, P. R.
Klatser, and J. E. R. Thole. 1990. Nucleotide and deduced
amino acid sequence of a Mycobacterium leprae 12K protein.
Nucleic Acids Res. 18:1294.
17. Imaeda, T., W. F. Kirchheimer, and L. Barksdale. 1982. DNA
isolated from Mycobacterium leprae: genome size, base ratio,
and homology with other related bacteria as determined by
optical DNA-DNA reassociation. J. Bacteriol. 150:414-417.
18. Kalnins, A., K. Otto, U. Ruther, and B. Muller-Hill. 1983.
Sequence of the lacZ gene of Escherichia coli. EMBO J.
2:593-597.
19. Klatser, P. R., M. M. van Rens, and T. A. Eggelte. 1984.
Immunochemical characterization of Mycobacterium leprae an-
tigens by the SDS-polyacrylamide gel electrophoresis immuno-
peroxidase technique (SGIP) using patients' sera. Clin. Exp.
Immunol. 56:537-544.
INFECT. IMMUN.
onFebruary16,2017byTamilNaduVeterinary&AnimalScienceUniversityhttp://iai.asm.org/Downloadedfrom

7. M. LEPRAE ANTIGENS RECOGNIZED BY CONTACTS' SERA 2827
20. Kuwabara, S. 1975. Amino acid sequence of tuberculin-active
protein from Mycobacterium tuberculosis. J. Biol. Chem. 250:
2563-2568.
21. Laemmli, U. K. 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature (London)
226:680-685.
22. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular
cloning: a laboratory manual. Cold Spring Harbor Laboratory,
Cold Spring Harbor, N.Y.
23. Matsuo, K., R. Yamaguchi, A. Yamazaki, H. Tasaka, K.
Terasaka, and T. Yamada. 1990. Cloning and expression of the
gene for the cross-reactive a antigen of Mycobacterium kan-
sasii. Infect. Immun. 58:550-556.
24. Matsuo, K., R. Yamaguchi, A. Yamazaki, H. Tasaka, and T.
Yamada. 1988. Cloning and expression of the Mycobacterium
bovis BCG gene for extracellular a antigen. J. Bacteriol. 170:
3847-3854.
25. Meeker, H. C., D. L. Williams, D. C.Anderson, T. P. Gills, G.
Schuller-Levis, and W. R. Levis. 1989. Analysis of human
antibody epitopes on the 65-kilodalton protein of Mycobacte-
rium leprae by using synthetic peptides. Infect. Immun. 57:
3689-3694.
26. Mehra, V., D. Sweetser, and R. A. Young. 1986. Efficient
mapping of protein antigenic determinants. Proc. Natl. Acad.
Sci. USA 83:7013-7017.
27. Radford, A. J., B. J. Duffield, and P. Plackett. 1988. Cloning of
a species-specific antigen of Mycobacterium bovis. Infect. Im-
mun. 56:921-925.
28. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-
ing with chain terminating inhibitors. Proc. Natl. Acad. Sci.
USA 74:5463-5467.
29. Sathish, M., R. E. Esser, J. E. R. Thole, and J. E. Clark-Curtiss.
1990. Identification and characterization of antigenic determi-
nants of Mycobacterium leprae that react with antibodies in
leprosy patients' sera. Infect. Immun. 58:1327-1336.
30. Shinnick, T. M. 1987. The 65-kilodalton antigen of Mycobacte-
rium tuberculosis. J. Bacteriol. 169:1080-1088.
31. Shinnick, T. M., B. B. Plikaytis, A. D. Hyche, R. M. van
Landingham, and L. L. Walker. 1989. The Mycobacterium
tuberculosis BCG-a protein has homology with the Escherichia
coli GroES protein. Nucleic Acids Res. 17:1254.
32. Shinnick, T. M., D. Sweetser, J. Thole, J. van Embden, and
R. A. Young. 1987. The etiological agents of leprosy and
tuberculosis share an immuno-reactive protein antigen with the
vaccine strain Mycobacterium bovis BCG. Infect. Immun. 55:
1932-1935.
33. Shinnick, T. M., M. H. Vodkin, and J. C. Williams. 1988. The
Mycobacterium tuberculosis 65-kilodalton antigen is a heat
shock protein which corresponds to common antigen and to the
Escherichia coli GroEL protein. Infect. Immun. 56:446-451.
34. Stanley, K. K., and J. P. Luzio. 1984. Construction of a new
family of high efficiency bacterial expression vectors: identifi-
cation of cDNA clones coding for human liver proteins. EMBO
J. 6:1429-1434.
35. Thangaraj, H. S., F. I. Lamb, E. 0. Davis, and M. J. Colston.
1989. Nucleotide and deduced amino acid sequence of Myco-
bacterium leprae manganese superoxide dismutase. Nucleic
Acids Res. 17:8378.
36. Thole, J. E. R., P. Hindersson, J. de Bruyn, F. Cremers, J. van
der Zee, H. de Cock, J. Tommassen, W. van Eden, and J. D. A.
van Embden. 1988. Antigenic relatedness of a strongly immuno-
genic 65 kDa mycobacterial protein antigen with a similar sized
ubiquitous bacterial common antigen. Microb. Pathogen. 4:71-
83.
37. Thole, J. E. R., L. F. E. M. Stabel, M. E. G. Suykerbuyk,
M. Y. L. de Wit, P. R. Klatser, and R. A. Hartskeerl. 1990. A
major immunogenic 36,000-molecular-weight antigen from My-
cobacterium leprae contains an immunoreactive region of pro-
line-rich repeats. Infect. Immun. 58:80-87.
38. Van Embden, J. D. A., H. J. van Donk, R. V. van Eijk, H. G. van
der Heide, J. A. de Jong, M. F. van Olderen, A. D. Osterhaus,
and L. M. Schouls. 1983. Molecular cloning and expression of
Treponema pallidum DNA in Escherichia coli K-12. Infect.
Immun. 42:187-196.
39. Watson, J. D. 1989. Leprosy: understanding protective immu-
nity. Immunol. Today 10:218-221.
40. World Health Organization. 1980. Purification of M. leprae.
Report of the 5th meeting of the scientific working group on the
immunology of leprosy (IMMLEP). TDR/IMMLEP-SGW(5)/
80.3. World Health Organization, Geneva.
41. World Health Organization. 1988. WHO Expert Committee on
Leprosy: sixth report. Technical report series, no. 768. World
Health Organization, Geneva.
42. Yamaguchi, R., K. Matsuo, A. Yamazaki, C. Abe, S. Nagai, K.
Terasaka, and T. Yamada. 1989. Cloning and characterization of
the gene for immunogenic protein MPB64 of Mycobacterium
bovis BCG. Infect. Immun. 57:283-288.
43. Yamaguchi, R., K. Matsuo, A. Yamazaki, S. Nagai, T. Terasaka,
and T. Yamada. 1988. Immunogenic protein MPB57 from My-
cobacterium bovis BCG: molecular cloning, nucleotide se-
quence and expression. FEBS Lett. 240:115-117.
44. Young, D., R. Lathigra, R. Hendrix, D. Sweetser, and R. A.
Young. 1988. Stress proteins are immune targets in leprosy and
tuberculosis. Proc. Natl. Acad. Sci. USA 85:4267-4270.
45. Young, R. A., V. Mehra, D. Sweetser, T. Buchanan, J. Clark-
Curtiss, R. W. Davis, and B. R. Bloom. 1985. Genes for the
major protein antigens of the leprosy parasite Mycobacterium
leprae. Nature (London) 316:450452.
VOL. 58, 1990
onFebruary16,2017byTamilNaduVeterinary&AnimalScienceUniversityhttp://iai.asm.org/Downloadedfrom