Detection and quantification of viruses, Research paper is discussed here.. how study carried out and results of the study

1. Swati Tyagi

2. Impact factor- 3.9

3. Healthy Sugar beet
Infected Sugar beet
(A) BNYVV symptoms
(B). BSBV symptoms

4.  Beet necrotic yellow vein virus ( BNYVV)
 Beet soil borne virus ( BSBV)
 Beet virus Q
Vector - Polymyxa batae

5. Material and method
Sugarbeet seeds were grown in disease unfested soil collected from different countries
RNA was isolated by using
commercial kit (Qiagen)
ELISA extract prepared by grounding 100
gm of roots in 750 µL of ELISA extraction
buffer.
BNYVV2(1)for, - ACATTTCTATCCTCCTCCAC;
BNYVV2(1)rev-ACCCCAACAAACTCTCTAAC;
BSBV2for- CTTACGCTGTTCACTTTTATGCC;
BSBV2rev- GTCCGCACTCTTTTCAACTGTTC;
BVQ1(1)for- GCTGGAGTATATCACCGATGAC;
BVQ1(1)rev-AAAATCTCGGATAGCATCCAAC;
PB4for- CAAACGCCTGAAATCATCTAAC; and
PB4rev - GATGGCCCAATTCCTTACAC
Pimers used for detection PRIME program of the Genetics Computer group

7.  RT rxn- MMLV reverse
transcriptase, by
following manufacturers
instruction (Promega)
 dNTPs- 20 pmol/20 µL
 Primers - 20 pmol/20 µL
 PCR rxn- Taq Polymerase
(promega)
 dNTPs- 15 pmol/50 µL
 Primers - 20 pmol/50 µL

8.  RT rxn-
 Primers- 10 pmol
(reverse primers)
 RNA- 1.2 µl + 7.3 µl of
DEPC water
 dNTPS- 2 µl
 MMLV RT buffer- 5X
 MMLV transcriptase-
0.25 µl
 Incubated at 65 and
transferred into ice.
 PCR rxn-
 Primers- 18 pmol
 DEPC water- 23.3 µl
 MgCl2 (25 mM) - 10µl ,
 Taq polymerase buffer
10x – 3.5µl
 dNTPs (10 mM each)- 1.5
µl
 Taq polymerase- 0.5µl
 cDNA- 4µl

9.  a first denaturation for 3 min at 94°C
 35 cycles of denaturation for 30 s at 94°C,
 annealing for 30 s at 63°C,
 and elongation for 2 min at 72°C.
 A final elongation for 7 min at 72°C was added.

10. The selected primer pairs gave the expected
-545-bp (BNYVV),
-399-bp (BSBV),
-291-bp (BVQ),
-and 170-bp (P.betae) fragments for RT-PCR.
-BNYVV primers gave the amplification profiles for strains of
types A, B, and P (Table 1).

13.  Detection of the P. betae repetitive EcoRI like fragment
(GenBank accession number X83745) directly in an
RNA extract is feasible.
 We suggest that this EcoRI-like fragment is amplified
from mRNA and DNA, as observed from results of
DNase or RNase treatments of RNA extract (Fig. 1).

14. Compared with double-antibody-sandwich ELISA

15. One hundred milligrams of BNYVV-infected rootlets was ground in ELISA grinding buffer (Sanofi
Diagnostics Pasteur). The sample was diluted to 1/2, 1/4, 1/8, 1/16, 1/32, 1/64, 1/128, 1/256, 1/512, and
1/1,024 and tested according to the kit protocol. OD405 was plotted against the dilutions. The grey
line represents two times the average OD of the negative control.

17.  Figure 3 illustrates the different patterns that were
observed for 11 different samples.
 An interesting point is the systematic association in
our samples of BNYVV with BSBV or of BSBV and
BVQ.
 The most frequently detected virus was BSBV, followed
by BVQ and then BNYVV.
 In no case was BVQ found alone.

19. -Simultaneous detection, allowing insights into benyvirus and
pomovirus epidemiologies
-facilitating studies of recombination between viruses when
the technique -is combined with sequencing.
-a new tool to test soils for the presence of different soilborne
viruses.
-Sensitivity is much higher than DAS-ELISA and highly
similar to that of RT-PCR.
-No RT-PCR technique has been described for the detection
of BSBV and BVQ.

20. Thank You