Recommended
More Related Content
Viewers also liked
Viewers also liked (9)
Similar to Synthetic Biology beyond the bench: Biosafety & biosecurity
Similar to Synthetic Biology beyond the bench: Biosafety & biosecurity (20)
Recently uploaded
Recently uploaded (20)
Synthetic Biology beyond the bench: Biosafety & biosecurity
- 1. Drew Endy Stanford & BioBricks for Stanford Public Policy 122 (Biosecurity and Bioterrorism Response) aka Bioengineering 122 aka Emergency Medicine 122 13 April 2016 Aspects of synthetic biology “beyond the bench” (safety & security) 1
- 2. Cure diseases. Understand & “debug” natural biological systems. I (we) want to... Save environments. Design & build organisms. Make doing the above easier. 2
- 3. 3 http://en.wikipedia.org/wiki/Discourse_on_Inequality “The two fundamental principles of Rousseau's natural man are his natural, non-destructive love of self (amour de soi meme), and pity/compassion for the suffering of others.”
- 4. Create diseases. Misunderstand & abuse natural biology & ecology. He (they) want(s) to... Destroy environments. Deceive & bias political systems. Make doing the above easier. 4
- 5. 5 http://ontologicalstatus.blogspot.com/2011/03/what-does-hobbes-have-to-do-with-french.html http://en.wikipedia.org/wiki/Leviathan_%28book%29 “Hereby it is manifest that during the time men live without a common Power to keep them all in awe, they are in that condition which is called War; and such a war as is of every man against every man. [...] In such condition there is no place for Industry, because the fruit thereof is uncertain: and consequently no Culture of the Earth; no Navigation, nor use of the commodities that may be imported by Sea; no commodious Building; no Instruments of moving and removing such things as require much force; no Knowledge of the face of the Earth; no account of Time; no Arts; no Letters; no Society; and which is worst of all, continual Fear, and danger of violent death; And the life of man solitary, poor, nasty, brutish, and short.” — Hobbes, Leviathan
- 6. 6 “In the new biology world, scientists can now create life themselves and learn about it from the inside,” writes Garrett, CFR senior fellow for global health, in the cover story of the November/ December issue. She explains the scientific breakthroughs that have led to a revolution in synthetic biology. It is now possible to manufacture living organisms, including viruses and bacteria not yet seen in nature. Moreover, Garrett writes, such synthetic organisms can self-assemble and self-replicate, a process called 4-D printing. “What begins as a human idea, hammered out intellectually on a computer, is then sent to a 3-D printer, resulting in a creation capable of making copies of and transforming itself.” Synthetic biology creates a “dual-use dilemma”: it is a boon to both terrorists and scientists. “What all this means is that the dual-use dilemma that first hit chemistry a century ago, and then hit physics a generation later, is now emerging with special force in contemporary biology.”
- 7. Goals for today Develop sense for how, as the process of engineering living matter improves, old and new issues “beyond the bench” require sustained attention. Become capable of teaching others the difference between “safety” and “security.” Begin to think about what a plan for biological security might look like... 7 Escape “half pipe of salvation/doom” framing.
- 8. 8Free .PDF of full briefing via DOI 1721.1/38455
- 10. 10Free .PDF of full briefing via DOI 1721.1/38455
- 11. 11 Graphic from "Synthetic Aesthetics" MIT Press (2014)
- 12. I.e., keep improving the engineering cycle DNA Sequencing Read Out the Genetic Code Recombinant DNA Basic “Cut” & “Paste” Polymerase Chain Reaction Amplify & Make Simple Changes First Gen. Biotech = ... Synth. Bio. = 12
- 13. TAATACGACTCACTATAGGGAGA Gene & Genome Constr. = #1 Tech. of 21st Ctry. From abstract information to physical, living DNA designs. 2003: $4/bp 2015: $0.04/bp 2027: $0.0004/bp? 13
- 14. 14
- 15. Mutalik et al. 2013 By 2013, standard bioparts shown to be possible
- 16. 16 By 2013, abstracted DNA flippers realize genetic logic (all genetic designs work on first attempt) Bonnet et al. 2013
- 17. Systems = One or more devices encoding a human defined function(s). Note that my system your device, and so on. Devices = One or more parts encoding a human defined function(s). Parts = Basic biological functions encoded via molecules. DNA = Material encoding moleculesCTATAGGGAGA 8-bit counter Abstraction barrier! Do not cross! Abstraction barrier! Do not cross! Abstraction barrier! Do not cross! 17
- 18. Question What will be the impact(s) of making biology easy to engineer? 18
- 19. 000000 00001 00010 00110 00000 100000 http://en.wikipedia.org/wiki/Machine_language 19
- 21. [X,Y] = meshgrid(-8:.5:8); R = sqrt(X.^2 + Y.^2)+eps; Z = sin(R)./R; surf(X,Y,Z) http://en.wikipedia.org/wiki/Matlab#Code_snippets 21
- 22. Possible answers... And do so more quickly More people will engineer biology Making more powerful systems 22
- 23. 23 MIT 2003
- 24. 24 iGEM Giant Jamboree 2015
- 25. Who will lead biosafety into the future? 4 What is our strategy for biological security? 8-10 How much can we make in partnership with biology? 2-8 What is the best balance of private and common wealth? 4-6 Who will choose what problems and opportunities are explored, pursued, and realized? 7-9 How can we best work together? ? ... to benefit all people & the planet? degreeofdifficulty(1=easy,10=impossible) Can we biologize industry, not industrialize biology? 4-6
- 26. Hypothesis If we can answer the bottom five questions on previous slide we will have greater positive impacts on biosafety and security than anyone working directly on regulating biology. 26 w/ thanks toTim O’Reilly
- 27. 27
- 28. Left to right: Philip Sharp, David Baltimore, unidentified (c/o US NAS Archives) c/o http://cr4.globalspec.com/blogentry/8698 rDNA & biosafety ~1975 Asilomar 28
- 29. http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4toc.htm Biosafety Level 1 practices, safety equipment, and facility design and construction are appropriate for undergraduate and secondary educational training and teaching laboratories, and for other laboratories in which work is done with defined and characterized strains of viable microorganisms not known to consistently cause disease in healthy adult humans. Biosafety Level 1 represents a basic level of containment that relies on standard microbiological practices with no special primary or secondary barriers recommended, other than a sink for handwashing. Biosafety Level 2 practices, equipment, and facility design and construction are applicable to clinical, diagnostic, teaching, and other laboratories in which work is done with the broad spectrum of indigenous moderate-risk agents that are present in the community and associated with human disease of varying severity. With good microbiological techniques, these agents can be used safely in activities conducted on the open bench, provided the potential for producing splashes or aerosols is low. Hepatitis B virus, HIV, the salmonellae, and Toxoplasma spp. are representative of microorganisms assigned to this containment level. Biosafety Level 3 practices, safety equipment, and facility design and construction are applicable to clinical, diagnostic, teaching, research, or production facilities in which work is done with indigenous or exotic agents with a potential for respiratory transmission, and which may cause serious and potentially lethal infection. Mycobacterium tuberculosis, St. Louis encephalitis virus, and Coxiella burnetii are representative of the microorganisms assigned to this level. Primary hazards to personnel working with these agents relate to autoinoculation, ingestion, and exposure to infectious aerosols. At Biosafety Level 3, more emphasis is placed on primary and secondary barriers to protect personnel in contiguous areas, the community, and the environment from exposure to potentially infectious aerosols. Biosafety Level 4 practices, safety equipment, and facility design and construction are applicable for work with dangerous and exotic agents that pose a high individual risk of life-threatening disease, which may be transmitted via the aerosol route and for which there is no available vaccine or therapy. Agents with a close or identical antigenic relationship to Biosafety Level 4 agents also should be handled at this level. When sufficient data are obtained, work with these agents may continue at this level or at a lower level. Viruses such as Marburg or Congo-Crimean hemorrhagic fever are manipulated at Biosafety Level 4. The primary hazards to personnel working with Biosafety Level 4 agents are respiratory exposure to infectious aerosols, mucous membrane or broken skin exposure to infectious droplets, and autoinoculation. All manipulations of potentially infectious diagnostic materials, isolates, and naturally or experimentally infected animals, pose a high risk of exposure and infection to laboratory personnel, the community, and the environment. 29
- 32. 32
- 33. http://www.mercurynews.com/breaking-news/ci_20531408/meningitis-claims-san-francisco-va-lab-worker Deadly infection claims San Francisco VA lab worker By Matt O'Brien Bay Area News Group San Jose Mercury News Posted: MercuryNews.com State and federal health officials are investigating how a rare and virulent bacteria strain appears to have killed a young researcher at a VA Hospital's infectious diseases lab in San Francisco, setting off alarms that the man's friends and fellow researchers also may have been exposed. The 25-year-old laboratory researcher at San Francisco Veterans Affairs Medical Center died Saturday morning shortly after asking friends to take him to the hospital. For the week and months before his death, he had been handling a bacteria linked to deadly bloodstream infections at the VA Hospital's Northern California Institute for Research and Education, said Peter Melton, a spokesman for the California Occupational Safety and Health Administration. The man, whose name has not been released, was working with fellow researchers to develop a vaccine for a bacterial strain that causes septicemia and meningitis. Hours after he left work, however, the germ that he was studying took his own life. "He left the lab around 5 p.m. (Friday)," said Harry Lampiris, chief of the VA Hospital's infectious diseases division. "He had no symptoms at all." Two hours later, however, the Treasure Island resident reported to his girlfriend he was feeling sick with a headache, fever and chills, Lampiris said. Not until Saturday morning did the symptoms grow worse with a body rash. He asked friends to take him to the hospital but fell unconscious in the car and had no pulse by the time he arrived. He died later in the morning. "It starts out so non-specifically, people don't think it's anything serious," Lampiris said. "Obviously, he didn't suspect it." The San Francisco Department of Public Health is trying to identify everyone who had close contact with the worker
- 34. Can you catalyze a renewal of biosafety leadership? Who will lead biosafety in 2030? 34
- 35. What’s the difference between safety & security? Hint: Safety belts vs. security locks in a car. 35
- 36. 1. Databases populated with sequence information. 2.The internet. 3. Ongoing improvements in automated DNA construction technology. 4. Overnight shipping. 5. Expanded concern re: active misapplication of biotech. What’s changed since the 1970s? 36
- 38. 38
- 40. 40
- 43. Should the DNA sequences encoding human pathogens be freely available online? 43
- 44. Doom! 44
- 45. 45 Salvation!
- 47. 47 Free .PDF of full briefing via DOI 1721.1/38455 47
- 48. 48 Free .PDF of full briefing via DOI 1721.1/38455 48
- 49. 49 Free .PDF of full briefing via DOI 1721.1/38455 49
- 50. Self check-in … Develop sense for how, as the process of engineering living matter improves, old and new issues “beyond the bench” require sustained attention. Become capable of teaching others the difference between “safety” and “security.” Begin to think about what a plan for biological security might look like... 50 Escape “half pipe of salvation/doom” framing.
- 51. Growing is Forever, a film by Jesse Rosten
- 52. 52
- 53. http://www.livingplanetindex.org/projects?main_page_project=AboutTheIndex&home_flag=1 Past ~45 years, humans x 2, animals / 2
- 54. The living bridges of Cherrapunji, India are made from the roots of the Ficus elastica tree. (http://rootbridges.blogspot.com/) Reproducing, growing, & healing materials ~90 terawatts; pre-distributed Massively functional Living ramifications Biology is nature’s nanotechnology Take infectious & other diseases off the table Provide for all of humanity Stabilize & recover natural biodiversity Enable a culture of citizenship Understand life by building
- 55. Working backwards… When we have made living matter fully engineerable… Imagine… What is happening? How might things be different from today? What are the main types of transactions? How do people make money? What platforms and tools are being used? What’s needed that nobody is working on now? Consider & act accordingly… What do we wish to be true about this future world & how can what is unique to biology help? 55
- 56. “Today we are introducing three revolutionary products…” Apple iDNA your personal DNA printer; aquatic eco-friendly chemistry; light powered
- 57. People could make much more locally Imagine all organisms shown below fully programmable. 57
- 58. Requires content, markets, & platforms download your favorite DNA encoding the latest perfumes for only $0.99 from iFumes 58
- 59. Question What if we regulated biotechnology like we regulate poetry? 59
- 60. 60 “I shall not today attempt further to define the kinds of material I understand to be embraced within that shorthand description ["hard-core pornography"], and perhaps I could never succeed in intelligibly doing so. But I know it when I see it, and the motion picture involved in this case is not that.” — USSC Justice Potter Stewart
- 61. 61 “The Court held that government cannot punish inflammatory speech unless that speech is directed to inciting, AND is likely to incite, imminent lawless action.” https://en.wikipedia.org/wiki/Brandenburg_v._Ohio
- 62. Everything goes unless It’s obscene It’s intending AND likely to incite lawlessness 62