SlideShare a Scribd company logo

Session 5.3: Levy

•Download as PPT, PDF•
•
Albert Einstein Cancer Center
Albert Einstein Cancer Center
Health & MedicineTechnologyBusiness
1 of 20
Levy Lab Matthew Levy Department of Biochemistry Albert Einstein College of Medicine Targeting cells with aptamers
Aptamers ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Aptamers exist naturally ,[object Object]
In vitro selection of aptamers Constant regions Random region Of 40 nucleotides Library size = ~10 14-15
Aptamers that target cell surface receptors can be used for delivery of cargoes to cells ,[object Object],[object Object],[object Object],Hicke et al. J Nucl Med. 2006 Apr;47(4):668-78 Anti-PSMA aptamer Anti-hTfR aptamer Anti-Tenascin C aptamer Aptamers can be used to target in vivo
Cancer/Aptamer projects underway in my lab ,[object Object],[object Object],[object Object],[object Object],[object Object]
The transferrin receptor (TfR, CD71) ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Selection for aptamers targeting the transferrin receptor ,[object Object],[object Object]
Anti-TfR aptamers label multiple human cancer cell lines FACs based analysis using AF488 labeled aptamer
Minimization eliminates more than half of the c2 sequence. c2 c2.min.2 c2.min.6 c2.min.9.1 38.6 kDa 14.0 kDa Brian Wengerter
Prostate-specific membrane antigen ,[object Object],[object Object],[object Object],[object Object],[object Object],Using a library based on the A9 aptamer we have now performed a ‘doped’ selection Cytoplasmic domain Transmembrane domain Extracellular domain NH 2 COOH Catalytic domain NH 2 COOH Catalytic domain
Doped A9 selection GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly Heavily mutagenize (30%) Reselect (HeLa-PSMA cells)
Minimization of the anti-PSMA A9 aptamer GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly
[object Object]
Targeting DEC 205 ,[object Object],[object Object],[object Object],[object Object]
Targeting cell surface receptors with aptamers anti-DEC205 ,[object Object],[object Object]
[object Object],Brian Wengerter Anti-DEC205 aptamers bind CHO cells that express DEC205
[object Object],[object Object],Brian Wengerter
Summary ,[object Object],[object Object],[object Object],[object Object]
Acknowledgements ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]

Recommended

Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...ponenciasexpoquim11
 
Aptamer Mediated siRNA Delivery
Aptamer Mediated siRNA DeliveryAptamer Mediated siRNA Delivery
Aptamer Mediated siRNA DeliverySaw Yi
 
Selection and application of ssDNA aptamers to detect active TB from sputum s...
Selection and application of ssDNA aptamers to detect active TB from sputum s...Selection and application of ssDNA aptamers to detect active TB from sputum s...
Selection and application of ssDNA aptamers to detect active TB from sputum s...Saw Yi
 
Aptamer Hari pankaj vanam aptamer a plethora of opportunities
Aptamer Hari pankaj vanam aptamer a plethora of opportunitiesAptamer Hari pankaj vanam aptamer a plethora of opportunities
Aptamer Hari pankaj vanam aptamer a plethora of opportunitiesVanam Hari Pankaj
 
Aptamer presentation version 4
Aptamer presentation version 4Aptamer presentation version 4
Aptamer presentation version 4Aparna Krishnamurthy
 
Antibody and Aptamer, Choose Which One?
Antibody and Aptamer, Choose Which One?Antibody and Aptamer, Choose Which One?
Antibody and Aptamer, Choose Which One?creative biogene
 
White Paper Aptamer Applications
White Paper Aptamer ApplicationsWhite Paper Aptamer Applications
White Paper Aptamer Applicationsiceninebio
 
Aptamers
AptamersAptamers
AptamersRakhi Gangil
 

Recommended

Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...ponenciasexpoquim11
 
Aptamer Mediated siRNA Delivery
Aptamer Mediated siRNA DeliveryAptamer Mediated siRNA Delivery
Aptamer Mediated siRNA DeliverySaw Yi
 
Selection and application of ssDNA aptamers to detect active TB from sputum s...
Selection and application of ssDNA aptamers to detect active TB from sputum s...Selection and application of ssDNA aptamers to detect active TB from sputum s...
Selection and application of ssDNA aptamers to detect active TB from sputum s...Saw Yi
 
Aptamer Hari pankaj vanam aptamer a plethora of opportunities
Aptamer Hari pankaj vanam aptamer a plethora of opportunitiesAptamer Hari pankaj vanam aptamer a plethora of opportunities
Aptamer Hari pankaj vanam aptamer a plethora of opportunitiesVanam Hari Pankaj
 
Aptamer presentation version 4
Aptamer presentation version 4Aptamer presentation version 4
Aptamer presentation version 4Aparna Krishnamurthy
 
Antibody and Aptamer, Choose Which One?
Antibody and Aptamer, Choose Which One?Antibody and Aptamer, Choose Which One?
Antibody and Aptamer, Choose Which One?creative biogene
 
White Paper Aptamer Applications
White Paper Aptamer ApplicationsWhite Paper Aptamer Applications
White Paper Aptamer Applicationsiceninebio
 
Aptamers
AptamersAptamers
AptamersRakhi Gangil
 
Arsenic Biosensor
Arsenic BiosensorArsenic Biosensor
Arsenic BiosensorWaliullah Wali
 
Aptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic Use
Aptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic UseAptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic Use
Aptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic Useajithnandanam
 
Aptamers as targeted therapeutics
Aptamers as targeted therapeuticsAptamers as targeted therapeutics
Aptamers as targeted therapeuticsDibya Sundar
 
Aptamer and its applications
Aptamer and its applicationsAptamer and its applications
Aptamer and its applicationsAchyut Bora
 
targeting
targetingtargeting
targetingFisiopatologia Bicocca
 
3targeting
3targeting3targeting
3targetingFisiopatologia Bicocca
 
Aptamers based drug delivery
Aptamers based drug deliveryAptamers based drug delivery
Aptamers based drug deliveryInstitute of Pharmacy, Nirma University
 
Aptamers
AptamersAptamers
AptamersArif Nadaf
 
Antisense technology
Antisense technologyAntisense technology
Antisense technologyLalitaShahgond
 
Microarray @ujjwal sirohi
Microarray @ujjwal sirohiMicroarray @ujjwal sirohi
Microarray @ujjwal sirohiujjwal sirohi
 
MICROARRAY
MICROARRAYMICROARRAY
MICROARRAYSanjay Sinhmar
 
nanoparticles in cancer treatment /therpy
nanoparticles in cancer treatment /therpy nanoparticles in cancer treatment /therpy
nanoparticles in cancer treatment /therpy Manisha371125
 
Site directed mutagenesis by pcr
Site directed mutagenesis by pcrSite directed mutagenesis by pcr
Site directed mutagenesis by pcrpooranachithra flowry
 
(050407)protein chip
(050407)protein chip(050407)protein chip
(050407)protein chipnamvgta
 
DNA Microarray and Analysis of Metabolic Control
DNA Microarray and Analysis of Metabolic ControlDNA Microarray and Analysis of Metabolic Control
DNA Microarray and Analysis of Metabolic Controlshilpa sharma
 
Multiplex analysis as tools in Biological science research
Multiplex analysis as tools in Biological science researchMultiplex analysis as tools in Biological science research
Multiplex analysis as tools in Biological science researchGourab Ray
 
SPR for Aptamer-Based Molecular Interactions in Programmable Materials
SPR for Aptamer-Based Molecular Interactions in Programmable MaterialsSPR for Aptamer-Based Molecular Interactions in Programmable Materials
SPR for Aptamer-Based Molecular Interactions in Programmable MaterialsReichertSPR
 
Aptamers and antisense oligonucleotides
Aptamers and antisense oligonucleotidesAptamers and antisense oligonucleotides
Aptamers and antisense oligonucleotidesSagugowda
 
Protein microarray Preparation of protein microarray Different methods of arr...
Protein microarray Preparation of protein microarray Different methods of arr...Protein microarray Preparation of protein microarray Different methods of arr...
Protein microarray Preparation of protein microarray Different methods of arr...naveed ul mushtaq
 
Nucleic acid microarray
Nucleic acid microarrayNucleic acid microarray
Nucleic acid microarrayDRx Priya Shukla
 
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...Thermo Fisher Scientific
 
PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISHtcha163
 

More Related Content

What's hot

Aptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic Use
Aptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic UseAptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic Use
Aptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic Useajithnandanam
 
Aptamers as targeted therapeutics
Aptamers as targeted therapeuticsAptamers as targeted therapeutics
Aptamers as targeted therapeuticsDibya Sundar
 
Aptamer and its applications
Aptamer and its applicationsAptamer and its applications
Aptamer and its applicationsAchyut Bora
 
Microarray @ujjwal sirohi
Microarray @ujjwal sirohiMicroarray @ujjwal sirohi
Microarray @ujjwal sirohiujjwal sirohi
 
nanoparticles in cancer treatment /therpy
nanoparticles in cancer treatment /therpy nanoparticles in cancer treatment /therpy
nanoparticles in cancer treatment /therpy Manisha371125
 
(050407)protein chip
(050407)protein chip(050407)protein chip
(050407)protein chipnamvgta
 
DNA Microarray and Analysis of Metabolic Control
DNA Microarray and Analysis of Metabolic ControlDNA Microarray and Analysis of Metabolic Control
DNA Microarray and Analysis of Metabolic Controlshilpa sharma
 
Multiplex analysis as tools in Biological science research
Multiplex analysis as tools in Biological science researchMultiplex analysis as tools in Biological science research
Multiplex analysis as tools in Biological science researchGourab Ray
 
SPR for Aptamer-Based Molecular Interactions in Programmable Materials
SPR for Aptamer-Based Molecular Interactions in Programmable MaterialsSPR for Aptamer-Based Molecular Interactions in Programmable Materials
SPR for Aptamer-Based Molecular Interactions in Programmable MaterialsReichertSPR
 
Aptamers and antisense oligonucleotides
Aptamers and antisense oligonucleotidesAptamers and antisense oligonucleotides
Aptamers and antisense oligonucleotidesSagugowda
 
Protein microarray Preparation of protein microarray Different methods of arr...
Protein microarray Preparation of protein microarray Different methods of arr...Protein microarray Preparation of protein microarray Different methods of arr...
Protein microarray Preparation of protein microarray Different methods of arr...naveed ul mushtaq
 

What's hot (20)

Arsenic Biosensor
Arsenic BiosensorArsenic Biosensor
Arsenic Biosensor
 
Aptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic Use
Aptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic UseAptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic Use
Aptamers - New Class of Oligonucleotide for Therapeutic and Diagnostic Use
 
Aptamers as targeted therapeutics
Aptamers as targeted therapeuticsAptamers as targeted therapeutics
Aptamers as targeted therapeutics
 
Aptamer and its applications
Aptamer and its applicationsAptamer and its applications
Aptamer and its applications
 
targeting
targetingtargeting
targeting
 
3targeting
3targeting3targeting
3targeting
 
Aptamers based drug delivery
Aptamers based drug deliveryAptamers based drug delivery
Aptamers based drug delivery
 
Aptamers
AptamersAptamers
Aptamers
 
Antisense technology
Antisense technologyAntisense technology
Antisense technology
 
Microarray @ujjwal sirohi
Microarray @ujjwal sirohiMicroarray @ujjwal sirohi
Microarray @ujjwal sirohi
 
MICROARRAY
MICROARRAYMICROARRAY
MICROARRAY
 
nanoparticles in cancer treatment /therpy
nanoparticles in cancer treatment /therpy nanoparticles in cancer treatment /therpy
nanoparticles in cancer treatment /therpy
 
Site directed mutagenesis by pcr
Site directed mutagenesis by pcrSite directed mutagenesis by pcr
Site directed mutagenesis by pcr
 
(050407)protein chip
(050407)protein chip(050407)protein chip
(050407)protein chip
 
DNA Microarray and Analysis of Metabolic Control
DNA Microarray and Analysis of Metabolic ControlDNA Microarray and Analysis of Metabolic Control
DNA Microarray and Analysis of Metabolic Control
 
Multiplex analysis as tools in Biological science research
Multiplex analysis as tools in Biological science researchMultiplex analysis as tools in Biological science research
Multiplex analysis as tools in Biological science research
 
SPR for Aptamer-Based Molecular Interactions in Programmable Materials
SPR for Aptamer-Based Molecular Interactions in Programmable MaterialsSPR for Aptamer-Based Molecular Interactions in Programmable Materials
SPR for Aptamer-Based Molecular Interactions in Programmable Materials
 
Aptamers and antisense oligonucleotides
Aptamers and antisense oligonucleotidesAptamers and antisense oligonucleotides
Aptamers and antisense oligonucleotides
 
Protein microarray Preparation of protein microarray Different methods of arr...
Protein microarray Preparation of protein microarray Different methods of arr...Protein microarray Preparation of protein microarray Different methods of arr...
Protein microarray Preparation of protein microarray Different methods of arr...
 
Nucleic acid microarray
Nucleic acid microarrayNucleic acid microarray
Nucleic acid microarray
 

Similar to Session 5.3: Levy

An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...Thermo Fisher Scientific
 
PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISHtcha163
 
Avs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogensAvs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogensAMOL SHITOLE
 
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Thermo Fisher Scientific
 
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative BiolabsChimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative BiolabsCreative-Biolabs
 
Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013Elsa von Licy
 
Discover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And EgfrDiscover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And EgfrJessica Myers
 
NEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptxNEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptxmadurai
 
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Thermo Fisher Scientific
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3Michael Powell
 
Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287Beth Salazar
 
6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptxArdiansyahPrayitno2
 
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Thermo Fisher Scientific
 
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Thermo Fisher Scientific
 
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...QIAGEN
 
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMSequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
 

Similar to Session 5.3: Levy (20)

An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
 
PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISH
 
Avs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogensAvs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogens
 
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
 
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative BiolabsChimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
 
Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013
 
IJAA
IJAAIJAA
IJAA
 
Discover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And EgfrDiscover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And Egfr
 
NEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptxNEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptx
 
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3
 
3targeting
3targeting3targeting
3targeting
 
Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287
 
ICAAC 2013: Resumen
ICAAC 2013: ResumenICAAC 2013: Resumen
ICAAC 2013: Resumen
 
6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx
 
EACR-P0ster-17
EACR-P0ster-17EACR-P0ster-17
EACR-P0ster-17
 
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
 
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
 
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
 
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMSequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
 

More from Albert Einstein Cancer Center

More from Albert Einstein Cancer Center (20)

Advances Agenda Slide 2016
Advances Agenda Slide 2016Advances Agenda Slide 2016
Advances Agenda Slide 2016
 
Nciccwithsocialmedia
NciccwithsocialmediaNciccwithsocialmedia
Nciccwithsocialmedia
 
000 agenda
000 agenda000 agenda
000 agenda
 
The Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paperThe Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paper
 
Using MyNCBI & My Bibliography
Using MyNCBI & My BibliographyUsing MyNCBI & My Bibliography
Using MyNCBI & My Bibliography
 
Using MyNCBI & My Bibliography
Using MyNCBI & My BibliographyUsing MyNCBI & My Bibliography
Using MyNCBI & My Bibliography
 
The Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paperThe Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paper
 
Using My NCBI & My Bibliography
Using My NCBI & My BibliographyUsing My NCBI & My Bibliography
Using My NCBI & My Bibliography
 
Nih public access_policy
Nih public access_policyNih public access_policy
Nih public access_policy
 
Guide for My Bibliography and Compliance
Guide for My Bibliography and ComplianceGuide for My Bibliography and Compliance
Guide for My Bibliography and Compliance
 
Nciccwithsocialmedia
NciccwithsocialmediaNciccwithsocialmedia
Nciccwithsocialmedia
 
NCICC with socialmedia
NCICC with socialmediaNCICC with socialmedia
NCICC with socialmedia
 
04.2 kurland pc
04.2 kurland pc04.2 kurland pc
04.2 kurland pc
 
03.1 libutti pc
03.1 libutti pc03.1 libutti pc
03.1 libutti pc
 
02.3 gabeau mac
02.3 gabeau mac02.3 gabeau mac
02.3 gabeau mac
 
02.2 kaubisch pc
02.2 kaubisch pc02.2 kaubisch pc
02.2 kaubisch pc
 
02.1 kinkhabwala
02.1 kinkhabwala02.1 kinkhabwala
02.1 kinkhabwala
 
01.5 belbin aecc advances 2010 for web
01.5 belbin aecc advances 2010 for web01.5 belbin aecc advances 2010 for web
01.5 belbin aecc advances 2010 for web
 
01.4 steidl pc for upload
01.4 steidl pc for upload01.4 steidl pc for upload
01.4 steidl pc for upload
 
01.3 klampfer pc
01.3 klampfer pc01.3 klampfer pc
01.3 klampfer pc
 

Recently uploaded

(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...indiancallgirl4rent
 
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...Arohi Goyal
 
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Servicevidya singh
 
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...astropune
 
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Call Girls in Nagpur High Profile
 
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...perfect solution
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Top Rated Bangalore Call Girls Mg Road ⟟ 8250192130 ⟟ Call Me For Genuine Sex...
Top Rated Bangalore Call Girls Mg Road ⟟ 8250192130 ⟟ Call Me For Genuine Sex...Top Rated Bangalore Call Girls Mg Road ⟟ 8250192130 ⟟ Call Me For Genuine Sex...
Top Rated Bangalore Call Girls Mg Road ⟟ 8250192130 ⟟ Call Me For Genuine Sex...narwatsonia7
 
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...aartirawatdelhi
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...vidya singh
 
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiRussian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiAlinaDevecerski
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escortsvidya singh
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...Taniya Sharma
 
Chandrapur Call girls 8617370543 Provides all area service COD available
Chandrapur Call girls 8617370543 Provides all area service COD availableChandrapur Call girls 8617370543 Provides all area service COD available
Chandrapur Call girls 8617370543 Provides all area service COD availableDipal Arora
 

Recently uploaded (20)

(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
 
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
 
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
 
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
 
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
 
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
 
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
 
Top Rated Bangalore Call Girls Mg Road ⟟ 8250192130 ⟟ Call Me For Genuine Sex...
Top Rated Bangalore Call Girls Mg Road ⟟ 8250192130 ⟟ Call Me For Genuine Sex...Top Rated Bangalore Call Girls Mg Road ⟟ 8250192130 ⟟ Call Me For Genuine Sex...
Top Rated Bangalore Call Girls Mg Road ⟟ 8250192130 ⟟ Call Me For Genuine Sex...
 
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
 
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiRussian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
Chandrapur Call girls 8617370543 Provides all area service COD available
Chandrapur Call girls 8617370543 Provides all area service COD availableChandrapur Call girls 8617370543 Provides all area service COD available
Chandrapur Call girls 8617370543 Provides all area service COD available
 

Session 5.3: Levy

  • 1. Levy Lab Matthew Levy Department of Biochemistry Albert Einstein College of Medicine Targeting cells with aptamers
  • 2.
  • 3.
  • 4. In vitro selection of aptamers Constant regions Random region Of 40 nucleotides Library size = ~10 14-15
  • 5.
  • 6.
  • 7.
  • 8.
  • 9. Anti-TfR aptamers label multiple human cancer cell lines FACs based analysis using AF488 labeled aptamer
  • 10. Minimization eliminates more than half of the c2 sequence. c2 c2.min.2 c2.min.6 c2.min.9.1 38.6 kDa 14.0 kDa Brian Wengerter
  • 11.
  • 12. Doped A9 selection GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly Heavily mutagenize (30%) Reselect (HeLa-PSMA cells)
  • 13. Minimization of the anti-PSMA A9 aptamer GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly
  • 14.
  • 15.
  • 16.
  • 17.
  • 18.
  • 19.
  • 20.

Editor's Notes

  1. 20070212 combination of all data
  2. 20070212 combination of all data