1. Template provided by: “posters4research.com”
Total of 32 surgically removed human lung cancer specimens were evaluated for the expression of 11
selected genes. The pathological evaluation confirmed that majority of our specimens were NSCLC,
most of which were adenocarcinoma subtypes (60%). The gene expression signature results are
shown in Table 1. Ras family genes (ki-ras and c-ha-ras) are overexpressed in over 70% of
cancerous tissues. C-myc oncogene seems to play a major role in lung cancer as well (~50%). More
than 50% of adenocarcinoma cases show a moderate expression of both TGF-α and HER2, while
30% of carcinoid tissues had over-expression of these genes. Expression of k-ras, c-ha-ras and c-
myc were significantly high in SCC specimens.
Gene expression profiling is being proposed to address some of the very important clinical issues
such as therapeutic decisions based on molecular cause of cancers. Real-time RT-PCR is a new
technology used to precisely quantitate gene expression levels1. This technology is now
recognized as the technology of choice for the precise measurement of gene expression levels2.
Thus we can identify genes that affect disease prognosis and could serve as therapeutic targets
for personalized therapy. Gene expression profiling examines the composition of cellular
messenger RNA populations. The identity and the number of these transcripts in the cell provide
information about the global activity of genes that give rise to them. RT-PCR is a molecular biology
technique that combines reverse transcription with real-time PCR. This technology allows the
quantification of a defined RNA molecule. Complimentary DNA is made from a specific RNA by
reverse transcription and amplified using PCR. The quantification of the DNA produced, is
accomplished by the use of fluorescent dyes. The traditional RT-PCR is a semi-quantitative
technique and is more likely to produce false positive results3-12. Real-time RT-PCR on the other
hand, can precisely quantitate gene expression levels13. This technique is proven to be extremely
sensitive and it is widely used as the method of choice for quantifying absolute changes in gene
expression. This technique is also the preferred method for validating microarray analyses and
other techniques that evaluate gene expression profiling. We have used this technique to evaluate
the levels of gene expression in surgically removed human lung normal and cancerous tissues.
Our hypothesis was that real-time RT-PCR is reliable to differentiate gene expression levels in
normal and cancer tissues. This eleven gene panel may serve as a guide to personalized therapy.
ABSTRACT
INTRODUCTION
CONCLUSIONS
REFERENCES
TITLE: An Eleven Gene Signature Of Normal & Cancerous Lung Tissues
Authors: Sheikhnejad1 Reza, Shadmehr2 M.Behgam, Turkinejad1 Fahimeh, Zohri1 Mastaneh
Affiliations: 1Molecular and Cancer Biology, TOFIGH DARU, Research and Drug Engineering Company Tehran/Iran
2Trachial Disease Research Center, NRITLD, Masih Daneshvari Hospital, Shahid Beheshti University of Medical
Sciences, Tehran/Iran
Current paradigms suggest lung cancers are caused by gene transcriptional
activation/or progression events. Gene expression profiling has been used as molecular
diagnostic tool for classification and staging of cancers. It can be also effectively used to
determine the molecular targets for personalized treatment. We have used a panel of 11
genes expression signature to characterize surgically removed human lung cancers
specimens as well as patient’s noncancerous lung tissues. The panel includes 6 well
studied oncogenes such as bcl-2, c-myc, ki-ras, c-ha-ras, her-2/neu and Tgf-α that
represent excellent therapeutic targets. Other genes are, p53 (best known tumor
suppressor), MDM2 (known for regulating p53), Mmp1 and Mmp14 (metastatic genes) and
MDR1 (a well known drug resistant gene). We have evaluated 32 pairs of noncancerous
lung tissue and corresponding primary lung tumor tissues from lung cancer patients
who had undergone surgical resection from 2008 to 2009. All tissues were collected
fresh, snap-frozen and stored at -80 0C. Total RNA was isolated from all tissues with
RNeasy mini kit (Qiagen) according to manufacturer’s instructions. The cDNAs were then
used for qRT-PCR analysis using, Step OnePlusTM (ABI). The expression profile of 11
genes was quantified with the use of Power SYBR Green PCR master Mix (ABI). Human
b-actin was used as an endogenous control. Relative quantitation of gene expression
was determined, using comparative CT method of (DDCT). Roughly over 70% of lung
cancer patients show elevation in the expression of at least one apoptotic target genes
(ki-ras, bcl2 and c-myc) with k-ras being overexpressed in about 50% of our patients. In
conclusion specific inhibitors of k-ras, c-myc and bcl-2 could provide more effective
tools to combat lung cancer with little or no side effect.
Tissue Specimens
Lung Cancerous and normal tissues were obtained from patients who underwent surgery with
informed consent approved by Institutional Review Board (Medical University of Shahid Beheshti).
Fresh tissue specimens were immediately placed in RNAlater solution to protect against RNase
activity prior to RNA extraction. Routine histopathology analysis was performed at the hospital
(Masihe Daneshvari) and the clinical data was received after RT-PCR was performed for all specimens.
RNA Isolation
The tissues were homogenized in1ml of Tripure isolation reagent (Roche) using IKA-ULTRA-TURRAX®
T25 basic. Total RNA extraction was carried out using the RNeasy plus Mini Kit (Qiagen). Pelleted RNA
was resuspended in DEPC-treated water and RNA yield was determined by spectroscopy. RNA quality
was also evaluated by denaturing formaldehyde agarose gel electrophoresis. In an attempt to reduce
product degradation, we introduced a two-step protocol, i.e., cDNA synthesis and PCR amplification in
separate tubes. First strand cDNA was synthesized from one microgram of DNase-I-treated total RNA,
using random hexamers and RevertAidTM M-MuLV Reverse Transcriptase according to the
manufacturer (Fermentase). Complementary DNA was made from 1 µg of total RNA using M-MuLV
Reverse Transcriptase according to the manufacturer (Fermentase).
Real-time RT-PCR
Real-time RT-PCR was performed on a StepOnePlusTM ABI system. Power SYBR ® Green PCR Master
Mix is optimized for real-time PCR analysis using SYBR ® Green 1 Dye, AmpliTaq Gold ® DNA
Polymerase LD, dNTPs with dUTP/dTTP blend, Passive Reference 1 and optimized buffer components.
Each reaction (20 µl) contained 2 µl of the respective cDNA dilution, primers at 10pmol/µl, and MgCl2
at4 µmol/µl. The amplification program consisted of 1 cycle of 95°C with 10 min hold (“hot start”)
followed by 40 cycles of 95°C with 15-second hold, specified annealing temperature with 1 min hold,
60°C with1 min hold. Amplification was followed by melting curve analysis using the program run for
one cycle at 95°C with 15-second hold, 60°C with1 min hold, and 95°C with 15-second hold at the step
acquisition mode. All reactions were performed in triplicates. Threshold for cycle of threshold (Ct)
analysis of all samples were set at 0.1 relative fluorescence units. Real-time PCR efficiencies were
calculated from the given slopes in ABI Step one plus software. The corresponding real-time PCR
efficiency (E) of one cycle in the exponential phase was calculated according to: E = 10[–1/slope].
Investigated transcripts showed high real-time PCR efficiency rates; for each assay, we analyzed 5
serial dilution from 0.001 to 10 cDNA (n = 12) with high linearity (correlation coefficient r > 0.95).
METHODS RESULTS
Martell M, Gomez J, Esteban JI, Sauleda S, Quer J, Cabot B, et al. High-throughput real-time reverse
transcription-PCR quantitation of
hepatitis C virus RNA. J Clin Microbiol; 37:327–32,1999
Bieche I, Olivi M, Champeme MH, Vidaud D, Lidereau R, Vidaud M. Novel approach to quantitative
polymerase chain reaction using realtime detection: application to the detection of gene
amplification inbreast cancer. Int J Cancer;78:661– 6, 1998.
Datta YH, Adams PT, Drobyski WR, Ethier SP, Terry VH, Roth MS. Sensitive detection of occult breast
cancer by the reverse transcriptase polymerase chain reaction. J Clin Oncol;12:475– 82,1994.
Bostick PJ, Chatterjee S, Chi DD, Huynh KT, Giuliano AE, Cote R, et al. Limitations of specific
reverse-transcriptase polymerase chain
reaction markers in the detection of metastases in the lymph nodes and blood of breast cancer
patients. J Clin Oncol;16:2632– 40,1998.
Eltahir EM, Mallinson DS, Birnie GD, Hagan C, George WD, Purushotham AD. Putative markers for
the detection of breast carcinoma cells in blood. Br J Cancer;77:1203–7, 1998.
Giesing M, Austrup F, Bockmann B, Driesel G, Eder C, Kusiak I, et al. Independent prognostication
and therapy monitoring of breast
cancer patients by DNA/RNA typing of minimal residual cancer cells.
Int J Biol Markers;15:94 –9, 2000.
Goeminne JC, Guillaume T, Salmon M, Machiels JP, D’Hondt V, Symann M. Unreliability of
carcinoembryonic antigen (CEA) reverse
transcriptase-polymerase chain reaction (RT-PCR) in detecting contaminating breast cancer cells in
peripheral blood stem cells due to induction of CEA by growth factors. Bone Marrow
Transplant;24:769 –75, 1999.
Gunn J, McCall JL, Yun K, Wright PA. Detection of micrometastases in colorectal cancer patients by
K19 and K20 reverse-transcription
polymerase chain reaction. Lab Invest;75:611– 6, 1996.
Lopez-Guerrero JA, Gilabert PB, Gonzalez EB, Sanz Alonso MA, Perez JP, Talens AS, et al. Use of
reverse-transcriptase polymerase
chain reaction (RT-PCR) for carcinoembryonic antigen, cytokeratin19, and maspin in the detection of
tumor cells in leukapheresis
products from patients with breast cancer: comparison with immunocytochemistry. J
Hematother;8:53– 61, 1999.
Merrie AE, Yun K, Gunn J, Phillips LV, McCall JL. Analysis of potential markers for detection of
submicroscopic lymph node metastases in breast cancer. Br J Cancer;80:2019 –24, 1999.
Zach O, Kasparu H, Krieger O, Hehenwarter W, Girschikofsky M, Lutz D. Detection of circulating
mammary carcinoma cells in the peripheral blood of breast cancer patients via a nested reverse
transcriptase polymerase chain reaction assay for mammaglobin mRNA. J Clin Oncol;17:2015–9,
1999.
Zhong XY, Kaul S, Diel I, Eichler A, Bastert G. Analysis of sensitivity and specificity of cytokeratin 19
reverse transcriptase/polymerase chain reaction for detection of occult breast cancer in bone
marrow and leukapheresis products. J Cancer Res Clin Oncol;125:286 –91, 1999.
Nakao M, Janssen JW, Flohr T, Bartram CR. Rapid and reliable quantification of minimal residual
disease in acute lymphoblastic
leukemia using rearranged immunoglobulin and T-cell receptor loci by LightCycler technology.
Cancer Res;60:3281–9, 2000.
Due to the small number of specimens and lack of exclusive pathological information,
our results are not statistically significant. However our main goal was to determine if
11 gene expression signatures can provide us with a useful tool to identify specific
molecular and/or pharmaceutical targets for personalized therapy. Based on our
reliable and repeatable RT-PCR technique, we have shown that each cancer patient
has a unique gene expression signature. Our selected 6 oncogenes are known to be
valuable therapeutical targets. More than 70% of our lung cancer patients have at least
one such oncogene, over-expressed that may serve as a therapeutical target. This
test can be used to screen lung cancer patients to identify any specific target if a
specific gene targeted drug is available. Molecular diagnostic is a prerequisite for our
future molecular therapy of cancers.
Table1. 32 surgically removed lung cancer tissues were examined by real-time RT-PCR for
the expression of 11 genes to evaluate disease prognosis and molecular therapy targets.
Genes Highly
Expressed
(% of tissues )
Moderately
Expressed
(% of tissues )
Low
Expression
(% of tissues )
Ki-Ras 42 28 17
C-Ha-Ras 38.5 24.5 31.5
BCL2 21 24.5 24.5
C-MYC 49 14 24.5
HER-2 21 56 7
TGF-alpha 24.5 21 38.5
MmP1 10.5 10.5 28
MmP14 17.5 24.5 7
MDM2 14 10.5 28
P53 35 42 14
MDR1 0 3.5 42
GENES Forward Primers Reverse Primers
K-Ras TTCCTCAGGGCTCAAGAGAA ATTGGGCAGCAAAGAGATGT
H-Ras TGCCATCAACAACACCAAGT AGCCAGGTCACACTTGTTCC
BCL2 GTCTGGGAATCGATCTGGAA CATAAGGCAACGATCCCATC
C-MYC TAGTGGAAAACCAGCAGCCT GTGGAAAACCAGCAGCCT
HER2 AGTACCTGGGTCTGGACGTG AGCCAGGTCACACTTGTTCC
TGF-α TAGGCATTTCAGGCCAAATC TTAATAAAGCCGGCATCCTG
MmP1 CTTTTGATGGACCTGGAGGA AGTTCATGAGCTGCAACACG
MmP14 ACACAAACGAGGAATGAGGG CACTGGTGAGACAGGCTTGA
MDM2 CCAGCTTCGGAACAAGAGAC TTTCACAGAGAAGCTTGGCA
P53 GGCCCACTTCACCGTACTAA GTGGTTTCAAGGCCAGATGT
MDR1 GTGGGGCAAGTCAGTTCATT TTCCAATGTGTTCGGCATTA
β-Actin CCACACCTTCTACAATGAGC CATGATCTGGGTCATCCTCTCG
Gene-specific sequences were obtained from NCBI. All primers were designed to be intron-spaning
to preclude amplification of genomic DNA using primer3 software. The size of the amplicon was
restricted to 100-250 bp. The best primer was selected by NCBI primer design blast program for
covering all alternative splicing. To normalized relative levels of expression, ß-actin was used as a
reliable internal reference control for this analysis.
0
50
100
150
200
250
BAC BCL2 C-MYC HER2 H-RAS K-RAS MDM2 MMP1 MMP14 P53 TGF
Figure 4. Gene Expression of Cancer/Normal
Patient # 28
Change