This presentation aims at giving a vivid knowledge about Nucleoli, a sub organelle of Nucleus, its role in protein formation. control, localization ad how specifically it is involved in Single Nucleotide polymorphism. The slide also discusses about the involvement of SNPs in Alzheimer’s Disease.
A methyl group from S-adenosyl-methionine (SAM) is transferred to the C5 position of the pyrimidine ring of cytosine residues by DNMTs in genomic CpG dinucleotides.
https://www.creative-biogene.com/Services/Drug-Discovery-Services/DNA-Methyltransferase-Screening-and-Profiling.html
This presentation aims at giving a vivid knowledge about Nucleoli, a sub organelle of Nucleus, its role in protein formation. control, localization ad how specifically it is involved in Single Nucleotide polymorphism. The slide also discusses about the involvement of SNPs in Alzheimer’s Disease.
A methyl group from S-adenosyl-methionine (SAM) is transferred to the C5 position of the pyrimidine ring of cytosine residues by DNMTs in genomic CpG dinucleotides.
https://www.creative-biogene.com/Services/Drug-Discovery-Services/DNA-Methyltransferase-Screening-and-Profiling.html
In this presentation, i have described how defects in DNA repair results in cancer and various DNA repair genes which are involved in the repair of damaged DN
-Basic Concepts in Genetics
-What is Epigenetic?
-History of Epigenetic
-How do epigenetics work?
-Epigenetics and the Environment
-Epigenetic Inheritance
-Epigenetics in Psychiatry
The Role of DNA Methylation in Coronary Artery DiseaseBardia Farivar
Epigenetic studies have identified DNA methylation in coronary artery disease (CAD). How the critical genes interact at the cellular level to cause CAD is still unknown. The discovery of DNA methylation inspired researchers to explore relationships in genomic coding and disease phenotype. In the past two decades, there have been many findings regarding the relationship between DNA methylation and CAD development, and the DNA methylation of critical genes have been found to be significantly changed during CAD, including DNA methylation at homocysteine, Alu and long Interspersed Element 1 (LINE-1) repetitive elements.
Proteins adopt beautiful shapes that enable them to perform an incredible array of tasks. But these wiggly little creatures cannot stay still. Is this a nuisance or a blessing?
Xavier Salvatella discusses where the limit is: can proteins be completely disorganised? Can we study and understand intrinsically disordered proteins from a structural point of view? How can this class proteins perform functions if they have no structure? Why have they evolved? Is it ever going to be possible to modify the function of this class of proteins with small molecules, as we have learned to do with proteins that fold?
How different diseases originate with slightest changes in proteins. Understanding ALS , Parkinson, Alzhiemer , Taupathies development which may lead to their treatment!
In this presentation, i have described how defects in DNA repair results in cancer and various DNA repair genes which are involved in the repair of damaged DN
-Basic Concepts in Genetics
-What is Epigenetic?
-History of Epigenetic
-How do epigenetics work?
-Epigenetics and the Environment
-Epigenetic Inheritance
-Epigenetics in Psychiatry
The Role of DNA Methylation in Coronary Artery DiseaseBardia Farivar
Epigenetic studies have identified DNA methylation in coronary artery disease (CAD). How the critical genes interact at the cellular level to cause CAD is still unknown. The discovery of DNA methylation inspired researchers to explore relationships in genomic coding and disease phenotype. In the past two decades, there have been many findings regarding the relationship between DNA methylation and CAD development, and the DNA methylation of critical genes have been found to be significantly changed during CAD, including DNA methylation at homocysteine, Alu and long Interspersed Element 1 (LINE-1) repetitive elements.
Proteins adopt beautiful shapes that enable them to perform an incredible array of tasks. But these wiggly little creatures cannot stay still. Is this a nuisance or a blessing?
Xavier Salvatella discusses where the limit is: can proteins be completely disorganised? Can we study and understand intrinsically disordered proteins from a structural point of view? How can this class proteins perform functions if they have no structure? Why have they evolved? Is it ever going to be possible to modify the function of this class of proteins with small molecules, as we have learned to do with proteins that fold?
How different diseases originate with slightest changes in proteins. Understanding ALS , Parkinson, Alzhiemer , Taupathies development which may lead to their treatment!
1 At least 2 questions from this section will be on the .docxmercysuttle
1
At least 2 questions from this section will be on the final exam
SAMPLE QUESTIONS FOR THE FINAL EXAM
Question 1. Ferritin is a protein involved in the storage of iron inside cells. To prevent toxic accumulation of
too much iron inside cells, the intracellular level of ferritin is tightly regulated. To study the regulation of
ferritin synthesis, mammalian cells are grown with or without iron in the culture medium. Note that iron in the
culture medium is rapidly transported inside cells.
a) Upon addition of iron to the culture medium, the intracellular concentration of ferritin mRNA is unchanged
but the concentration of ferritin protein increases. How do you think ferritin expression is regulated? Briefly
explain.
The regulatory sequence given below is found in the ferritin mRNA between the cap structure and the start
codon.
5’-GGGUUUCCGUUCAACAGUGCUUGGACGGAAACCC-3’
Mutations within in this sequence are used to study the regulation of ferritin expression. The following
observation are made:
• ferritin expression is high, independent of the iron concentration, when (i) the entire region is deleted, or
(ii) the region located upstream of the underlined sequence is deleted or (iii) the underlined sequence is
replaced with a random sequence.
• ferritin expression remains iron-dependent when this region is replaced by the following sequence:
5’-GGGCUCAGGUUCAACAGUGCUUGGACCUGAGCCC-3’.
Note that the sequence differences are indicated in bold.
b) Explain why these observations suggest that both sequence and structure of the 5’ end of ferritin mRNA are
important for the regulation of ferritin expression.
c) Ferritin translation becomes iron-independent when the regulatory sequence is moved from the 5’ side
(upstream of the open reading frame) to the 3’ side (downstream of the open reading frame) of ferritin mRNA.
Which step of ferritin translation do you think is affected by the intracellular level of iron?
d) IRP is a protein involved in the regulation of ferritin expression. Anti-IRP antibodies attached to sepharose
beads are added to a cell extract, then the extract is centrifuged to separate the pellet fraction (containing the
sepharose beads ) from the supernatant fraction.
If the cells are cultured in the absence of iron, ferritin mRNA is found together with IRP in the pellet. In
contrast when cells are cultured in the presence of iron ferritin mRNA remains in the supernatant fraction while
IRP alone is found in the pellet. Briefly explain the likely role of IRP in the regulation of ferritin expression.
Question 2. You are studying the development of a newly discovered insect. Like drosophila, it undergoes a
stage in early larval development where the eve gene is expressed in a pattern of 7 stripes. You are particularly
interested in stripes 2 and 5. The following figures show the organization of the cis-acting elements that control
the expression o ...
Mutations in the gene encoding Lamin B receptor (LBR), a nuclear-membrane protein with
sterol reductase activity, have been linked to rare human disorders. Phenotypes range from a
benign blood disorder, such as Pelger-Huet anomaly (PHA), affecting the morphology and
chromatin organization of white blood cells, to embryonic lethality as for Greenberg dysplasia
(GRBGD). Existing PHA mouse models do not fully recapitulate the human phenotypes,
hindering efforts to understand the molecular etiology of this disorder. Here we show, using
CRISPR/Cas-9 gene editing technology, that a 236bp N-terminal deletion in the mouse Lbr
gene, generating a protein missing the N-terminal domains of LBR, presents a superior model
of human PHA. Further, we address recent reports of a link between Lbr and defects in
X chromosome inactivation (XCI) and show that our mouse mutant displays minor
X chromosome inactivation defects that do not lead to any overt phenotypes in vivo. We
suggest that our N-terminal deletion model provides a valuable pre-clinical tool to
the research community and will aid in further understanding the etiology of PHA and the
diverse functions of LBR.
Urbach-Wiethe Syndrome Associated Fear Processing DefectShalimar Shadeed
Urbach-Wiethe or Lipoid proteinosis, is a rare hereditary disorder transmitted by an autosomal recessive gene located on chromosome 1q21 encoding extracellular protein one (ECM1).The cumulative total of 250 – 300 cases have been reported in literature since it was officially reported in 1929.
The answers can be found below as discussedPart 1)The human gen.pdfaravlitraders2012
The answers can be found below as discussed:
Part 1)
The human genome is highly vast in nature and hence there are some complicating factors in the
study of human genetics:
1: Size and packing: The human genome is enoromously large in linear seqeunce which makes it
highly difficult to be analysed as a whole. Moreover, the DNA is wounded in complex primary,
secondary and tertiary structures which makes is difficult to isolate intact i.e. formation of
nucleosomes over histones, solenoid formation, high writhe and twist etc. The human genome is
highly compact and along with it, chemical modifications such as
acetylation/methylation/sumoylation/phosphorylation of the DNA-associated proteins also occur.
Similarly, post-transcriptional modifications of mRNA also occur only in eukaryotes.
Compensation: These structural features of the human genome have been well exploited for their
analysis. The size cannot be reduced directly but the complexity of packing can be used by
action of relaxation enzymes such as topoisomerases.
Part 2)
The coding sequences: The human genome is not continuously coding in nature, but it has been
differentiated into stretches of coding euchromatin exons and non-coding intervening
heterochromatin intron sequences. This makes the linearity of the coding sequence highly
compromised and a single mechanism of linear transcription or translation cannot take place.
Compensation: The human genome contains the intron sequences only in the DNA. These
sequences are effectively removed out of the DNA after transcription by mRNA splicing and
thus only exons are remained in the mRNA. Thus, this ensures that only exons can reach the
translation process.
3. Polymorphism: The human genome shows very high degree of single nucleotide
polymorphism (SNP) which shows pattern of inheritance and can be transitted form one person
to another genetically. These SNPs are crucial for providing discrete phenotypic features to
individuals which can be difficult to assess and identify due to large size of human genome.
Compensation: Although there occur SNPs in human genome, the modern techniques such as
next-generation seqeuncing have made it possible to effectively, efficiently and quickly screen
the whole genome for such targets.
Answer part 2)
Variations in Mendelian genetics in humans can be described as below:
1. Co-dominance: Unlike Mendelian genetics, the blood group system of humans show co-
dominance between the allele A and allele B and both of these alleles are completely dominant
over the allele O. This makes occurance of various phenotypes in blood groups i.e. A, B, AB and
O.
2. Incomplete dominance: On contrary to Mendel\'s pattern of inheritance, the texture of hair in
human is inherited genetically following a pattern of incomplete dominance. This deciphers that
an offspring of parents having straight and curly hair will have softly curled hair.
3. Quantitative traits: Unlike Mendel\'s patterns of inheritance, some genes show quantitative.
Se han hecho públicos los resultados de un prometedor trabajo encabezado por investigadores del Hospital Infantil de Boston y la Facultad de Medicina de Harvard, que ha conseguido recuperar, utilizando terapia génica, parte de la audición de ratones sordos. El artículo, que ha merecido la portada de la prestigiosa revista Science Translational Medicine, promete abrir un abanico terapéutico para el tratamiento de la sordera genética en los seres humanos.
Genes, Genomics, and Chromosomes computational biology introduction .pptMohamedHasan816582
The 5 ß-globin genes are derived from an ancestral ß-globin gene via gene duplication. Over time, these genes accumulated adaptive mutations via sequence drift resulting in the specialized species of ß-globin proteins. Genomic DNA also contains nonfunctional DNA sequences called pseudogenes that are derived from gene duplication or reverse transcription and integration of cDNA sequences made from mRNA (covered below). ß-globin pseudogenes contain introns and thus were derived by gene duplication. Over time these genes became nonfunctional also due to sequence drift. Because they are not harmful, pseudogenes remain in the genome, marking a gene duplication event in an earlier ancestor.
The ß-globin gene cluster on chromosome 11 is shown in Fig. 6.4a. The ß-globin genes are expressed in different stages of life. , Ag, and Gg are expressed during different trimesters of fetal development (next slide). ß expression begins around birth & continues throughout adult life. Fetal hemoglobin molecules made with the d and G or A polypeptides have a higher affinity for O2 than maternal hemoglobin, facilitating O2 transfer to the fetus.
Higher eukaryotes contain far more noncoding DNA between genes than bacteria and simple eukaryotes (Fig. 6.4). The region of human genomic DNA containing the ß-globin gene cluster shown in the figure actually is a relatively "gene-rich" region of human DNA. Some regions known as gene-poor "deserts" also occur. Higher eukaryotes also contain a larger amount of intron DNA. Although one-third of human DNA is transcribed into pre-mRNA, 95% ends up being degraded after RNA splicing reactions. On average, the typical exon is 50-200 bp in length, while the median length of introns is 3.3 kb in human genes.
DNA fingerprinting is a method for identifying individuals based on their minisatellite DNA (Fig. 6.7). It was developed in the mid-80s and is widely used in forensics, paternity analysis, and for research purposes. In the method, minisatellite DNA from a genomic DNA specimen is amplified by PCR using primers that bind to unique sequences flanking minisatellite repeat units. Bands corresponding to each minisatellite locus then are separated on gels. Although satellite DNA is highly conserved in sequence, the number of tandem copies at each loci is highly variable between individuals. This results from unequal crossing over during formation of gametes in meiosis. Due to the variation in the number of repeats at each locus, different individuals can be readily distinguished based on banding patterns.
Interspersed repeat DNA comprises the largest fraction of repetitious DNA in eukaryotic genomes. This DNA, which is also called moderately repeated DNA makes up ~45% of human genomic DNA. Interspersed repeat DNA is composed of partial and complete transposon sequences or "mobile DNA". Mobile DNAs were discovered by Barbara McClintock in the 1940s. These sequences move by "transposition". Transpositions in germ line cells are inhe
Human pigmentation genes: identification, structure and consequences of polym...José Luis Moreno Garvayo
En este estudio se constata que las mutaciones en el gen que codifica el receptor de la melanotropina de tipo 1 (MC1R) afectan el patrón de la melanogénesis resultando en la pérdida o disminución de la expresión del gen, lo que conduce a una mayor síntesis de feomelaninas en detrimento de las eumelaninas
Nutraceutical market, scope and growth: Herbal drug technologyLokesh Patil
As consumer awareness of health and wellness rises, the nutraceutical market—which includes goods like functional meals, drinks, and dietary supplements that provide health advantages beyond basic nutrition—is growing significantly. As healthcare expenses rise, the population ages, and people want natural and preventative health solutions more and more, this industry is increasing quickly. Further driving market expansion are product formulation innovations and the use of cutting-edge technology for customized nutrition. With its worldwide reach, the nutraceutical industry is expected to keep growing and provide significant chances for research and investment in a number of categories, including vitamins, minerals, probiotics, and herbal supplements.
Introduction:
RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) is an important biological process for modulating eukaryotic gene expression.
It is highly conserved process of posttranscriptional gene silencing by which double stranded RNA (dsRNA) causes sequence-specific degradation of mRNA sequences.
dsRNA-induced gene silencing (RNAi) is reported in a wide range of eukaryotes ranging from worms, insects, mammals and plants.
This process mediates resistance to both endogenous parasitic and exogenous pathogenic nucleic acids, and regulates the expression of protein-coding genes.
What are small ncRNAs?
micro RNA (miRNA)
short interfering RNA (siRNA)
Properties of small non-coding RNA:
Involved in silencing mRNA transcripts.
Called “small” because they are usually only about 21-24 nucleotides long.
Synthesized by first cutting up longer precursor sequences (like the 61nt one that Lee discovered).
Silence an mRNA by base pairing with some sequence on the mRNA.
Discovery of siRNA?
The first small RNA:
In 1993 Rosalind Lee (Victor Ambros lab) was studying a non- coding gene in C. elegans, lin-4, that was involved in silencing of another gene, lin-14, at the appropriate time in the
development of the worm C. elegans.
Two small transcripts of lin-4 (22nt and 61nt) were found to be complementary to a sequence in the 3' UTR of lin-14.
Because lin-4 encoded no protein, she deduced that it must be these transcripts that are causing the silencing by RNA-RNA interactions.
Types of RNAi ( non coding RNA)
MiRNA
Length (23-25 nt)
Trans acting
Binds with target MRNA in mismatch
Translation inhibition
Si RNA
Length 21 nt.
Cis acting
Bind with target Mrna in perfect complementary sequence
Piwi-RNA
Length ; 25 to 36 nt.
Expressed in Germ Cells
Regulates trnasposomes activity
MECHANISM OF RNAI:
First the double-stranded RNA teams up with a protein complex named Dicer, which cuts the long RNA into short pieces.
Then another protein complex called RISC (RNA-induced silencing complex) discards one of the two RNA strands.
The RISC-docked, single-stranded RNA then pairs with the homologous mRNA and destroys it.
THE RISC COMPLEX:
RISC is large(>500kD) RNA multi- protein Binding complex which triggers MRNA degradation in response to MRNA
Unwinding of double stranded Si RNA by ATP independent Helicase
Active component of RISC is Ago proteins( ENDONUCLEASE) which cleave target MRNA.
DICER: endonuclease (RNase Family III)
Argonaute: Central Component of the RNA-Induced Silencing Complex (RISC)
One strand of the dsRNA produced by Dicer is retained in the RISC complex in association with Argonaute
ARGONAUTE PROTEIN :
1.PAZ(PIWI/Argonaute/ Zwille)- Recognition of target MRNA
2.PIWI (p-element induced wimpy Testis)- breaks Phosphodiester bond of mRNA.)RNAse H activity.
MiRNA:
The Double-stranded RNAs are naturally produced in eukaryotic cells during development, and they have a key role in regulating gene expression .
THE IMPORTANCE OF MARTIAN ATMOSPHERE SAMPLE RETURN.Sérgio Sacani
The return of a sample of near-surface atmosphere from Mars would facilitate answers to several first-order science questions surrounding the formation and evolution of the planet. One of the important aspects of terrestrial planet formation in general is the role that primary atmospheres played in influencing the chemistry and structure of the planets and their antecedents. Studies of the martian atmosphere can be used to investigate the role of a primary atmosphere in its history. Atmosphere samples would also inform our understanding of the near-surface chemistry of the planet, and ultimately the prospects for life. High-precision isotopic analyses of constituent gases are needed to address these questions, requiring that the analyses are made on returned samples rather than in situ.
This pdf is about the Schizophrenia.
For more details visit on YouTube; @SELF-EXPLANATORY;
https://www.youtube.com/channel/UCAiarMZDNhe1A3Rnpr_WkzA/videos
Thanks...!
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Sérgio Sacani
We characterize the earliest galaxy population in the JADES Origins Field (JOF), the deepest
imaging field observed with JWST. We make use of the ancillary Hubble optical images (5 filters
spanning 0.4−0.9µm) and novel JWST images with 14 filters spanning 0.8−5µm, including 7 mediumband filters, and reaching total exposure times of up to 46 hours per filter. We combine all our data
at > 2.3µm to construct an ultradeep image, reaching as deep as ≈ 31.4 AB mag in the stack and
30.3-31.0 AB mag (5σ, r = 0.1” circular aperture) in individual filters. We measure photometric
redshifts and use robust selection criteria to identify a sample of eight galaxy candidates at redshifts
z = 11.5 − 15. These objects show compact half-light radii of R1/2 ∼ 50 − 200pc, stellar masses of
M⋆ ∼ 107−108M⊙, and star-formation rates of SFR ∼ 0.1−1 M⊙ yr−1
. Our search finds no candidates
at 15 < z < 20, placing upper limits at these redshifts. We develop a forward modeling approach to
infer the properties of the evolving luminosity function without binning in redshift or luminosity that
marginalizes over the photometric redshift uncertainty of our candidate galaxies and incorporates the
impact of non-detections. We find a z = 12 luminosity function in good agreement with prior results,
and that the luminosity function normalization and UV luminosity density decline by a factor of ∼ 2.5
from z = 12 to z = 14. We discuss the possible implications of our results in the context of theoretical
models for evolution of the dark matter halo mass function.
4. INTRODUCTION
AMMECR1
Is a protein encoded by the
AMMECR1 gene on human
chromosome Xq22.3. Is localized
in the critical region of contiguous
deletion syndrome implicated in
Alport syndrome, mental
retardation, midface hypoplasia,
and elliptocytosis chromosomal
region gene 1.
5. INTRODUCTION
RELATION
A truncating mutation in AMME chromosomal
region gene 1 (AMMECR1) gene is leading
candidate due to X-linked inheritance that is
characterized by the presence of elliptocytosis
and midface hypoplasia in the proband.
6. OBJETIVE
Provide further evidence that
mutated AMMECR1 gene is
responsible for the clinically
recognizable X-linked condition
with variable expressivity.
7. MÉTODOS
1. Sujetos: Niño de 4 años nacido de padres no
consanguíneos y no afectados, de origen judío , libio,
yemenita y turco; hermana no afectada y tio materno
afectado.
9. MÉTODOS
2. Secuenciación:
Extracción de DNA Fragmentación
por sonicación
Centrifugación
PurificaciónLimpieza
Procesamiento
de muestras
alineación del genoma y
selección de variantes
Lectura
10. 2. Secuenciación:
Utilización del método enzimático o de Sanger,
en el cual no se degrada el DNA sino que se
interrumpe de forma controlada de la síntesis
de una hebra complementaria.
Forward: 5'- cccgtggacatttggtcattgg-3 ', Reverse 5'-ggcacctaacctagcagacagtcaatactc-3'.
MÉTODOS
11. MÉTODOS
3. PCR
➝Se extrajo RNA de la sangre periférica de el
niño y la madre.
➝ Se sintetizó ADN complementario y se
amplifico el AMMERC1 con RT PCR:
Forward: 5'-GATGGTGGTGTCAGCAGAGAT -3'.
Reverse: 5'- CAGGAATAATGGTTGTATGGCGG -
3'.
➝ se cargó y pasó por un gel de agarosa al 1.5%.
14. RESULTADOS
Fig. 3. Alternative splicing ofAMMECR1. (A)AMMECR1 schematic representation of exons, numbered 1 to 6, in theWild-type(WT) isoforms
and Patient (II-2) isoforms. Themutation in the patient transcript is indicated on alternative exon 2.
(B) PCR amplification and separation in Agarose gel of AMMECR1 from proband and mother. Upper bands represent the exon 2
inclusion events, while the lower represent the exon 2 skipping events. Bands were excised, extracted and sequenced for confirmation.
15. RESULTADOS
Fig. 3. (C) AMMECR1 isoforms (taken from UCSC Genome Browser website; https://genome.ucsc.edu/) show that in one out of the three
isoforms exon 2 is skipped (missing box, indicated by arrow). The horizontal line represents the introns while the vertical boxed indicate the
exons. The image is drawn to scale. Note that the bottom isoform starts further upstream to this current view.
(D) PCR amplification as in B on eight healthy individuals.
16. RESULTADOS
Fig. 4. AMMECR1 protein model demonstrating the structural importance of position R45 on exon 2 of the protein. (A) AMMECR1 protein ribbon is colored by conservation (maroonwhite-
cyan scale from most conserved to least conserved positions) and R45 is shown in CPK representation, with the nitrogen atoms in blue and the carbons in conserve colors. R45
is located on a loop between two beta sheets that interact with an alpha helix on the core of a subdomain. (B) R45 is close to a 6-amino-acid motif (LRGCIG), colored in maroon, that is
highly conserved throughout evolution and is thus probably functionally important. (C) A change on a nearby loop, or skipping of this region which is located on exon 2 of the gene,
will lead to protein complete destabilization and probably lack of this entire protein. (For interpretation of the references to color in this figure legend, the reader is referred to the
web version of this article.)
17. DISCUSSION
ACTOR WHAT SAID YES OR NOT
Vitelli et al AMMECR1 gene encodes a
protein with a nuclear
localization and presently
unknown function, yet was
suggested to play a role as a
regulatory protein.
Meloni et al FACL4 gene has been
implicated in intellectual
disability in patients with
deletions including this gene.
18. DISCUSSION
ACTOR WHAT SAID YES OR NOT
Andreoletti et al Clinical features shared by the
individuals escribed in this report and
individuals described by Andreoletti et
al. include cleft palate, club feet, a flat
facial profile with a flat nasal bridge,
thin lips micrognathia,hearing loss and
eliptocytosis.
Balaji and Aravind AMMECR1 has previously been linked
to involvement in an uncharacterized
RNA base modification, potentially
entailing the transfer of a modifying
group onto an RNA base via a
conserved cysteine.
19. CONCLUSION
• It is a dissease that can be treated but not cured,
since we can improve the patient's lifestyle but not
prevent the gene from expressing itself.
• This disease is little previous and the largest number
of cases have been recorded in central and western
Africa.
• With the RT PCR the expression of the mutated gene
in the proband could be determined.
• The clinical characteristics of patients with
AMMECR1 gene mutation are not always the same.