Download as PDF, PPTX
![Patents as property rights - USA
• Patent Act 1790
– “the sole and exclusive right and liberty of making, constructing, using
and vending to others to be used” [said invention or discovery]
http://ipmall.info/hosted_resources/lipa/patents/Patent_Act_of_1790.pdf
Property = ownership based on the application of human labor to nature
• 1908, Prindle, EJ
– Patents “are the best and most effective means of
controlling competition”
– Occasionally, they grant absolute control of the market, “enabling their
owner to name the price without regard to cost of production”
• Patent Act 1952,
– “the right to exclude others from making, using, offering for sale, or
selling” the invention in the United States or “importing” the invention into
the United States.](https://image.slidesharecdn.com/ac5a7521-d0ff-4d1c-b02f-d6598ca97b1b-151110072040-lva1-app6892/85/QUTGP20151102Patentpremise-8-320.jpg)
Uploaded byOsmat Azzam Jefferson
QUTGP20151102Patentpremise
The document discusses the history and evolution of patent systems from their origins as exclusive privileges granted by governments to recent issues and debates around their role in promoting innovation. It notes shifts from individual inventors to corporations obtaining most patents and the growth in patenting of genetic sequences. It acknowledges criticisms of the current system as being "broken" and promoting excessive litigation. The document advocates for more transparency and flexibility in patent systems to better balance exclusive rights with the public interest.
QUTGP20151102Patentpremise
- 1. Back to thedrawing board: How will the patent system achieve its premise? Osmat A. Jefferson November 2, 2015
- 2. Acknowledgments • Arun Sharma(financial support from QUT) • The Lens team and Richard Jefferson – With Funding from Bill & Melinda Gates Foundation, Gordon and Betty Moore Foundation, Lemelson Foundation, NCBI/NIH, USPTO, Qualcomm, NICTA, and Syngenta • Deniz Kӧllhofer • Thomas Ehrich • Small Multiples • Lance De Vine, Ben Warren, Nina Prasolova, Prabha Ajjikuttira, Research assistants and volunteers • Ignacio Medina Castello www.genomemaps.org • Patent offices who responded to our questionnaire. • Philip Howard, Michigan State University • USDA
- 3. Patents as socialcontracts Right to exclude Obligation to share
- 4. The Patent system withina jurisdiction https://susandayley.files.wordpress.com/2011/12/balancing-act-0013.jpg Public interest Exclusive rights 1) Investment, 2) Technology transfer, and 3) employment
- 5. Patent-based innovation Invention Revolutionary Evolutionary Benefitto Society Patent Use in markets Innovation Exclusive rights? Government
- 6. Patents as privileges • 1474, the Venetian Republic enacted the first patent statute – exclusive privileges granted to make and use an invention within a limited time period • 1623, the Parliament of England enacted Statute of Monopolies – abolished all monopolies except one: letters patent for the term of 14 years • First and true inventor • Novel manufactures • Must not be contrary to the Law • Necessary and with some utility • Must not hurt trade or be inconvenient http://www.alrc.gov.au/publications/6-patentability-genetic-materials-and-technologies/patentable-subject-matter
- 7. 19th century -patent controversy Should ideas/inventions that benefit society belong to individuals or be considered a common property? While patents motivate inventors (the lure of success and power), are they effective in “the progress of production and the common welfare”?
- 8. Patents as propertyrights - USA • Patent Act 1790 – “the sole and exclusive right and liberty of making, constructing, using and vending to others to be used” [said invention or discovery] http://ipmall.info/hosted_resources/lipa/patents/Patent_Act_of_1790.pdf Property = ownership based on the application of human labor to nature • 1908, Prindle, EJ – Patents “are the best and most effective means of controlling competition” – Occasionally, they grant absolute control of the market, “enabling their owner to name the price without regard to cost of production” • Patent Act 1952, – “the right to exclude others from making, using, offering for sale, or selling” the invention in the United States or “importing” the invention into the United States.
- 9. 20th century-USA • Therewas a shift from an individual inventor to corporations patent applicants. By 1950, 75% of the patents were owned by giant corporations. • The industrial changes along with the emergence of new forms of capital markets meant that patents can also be a strategic instrument to enter or maintain a dominant position in such markets and in a concerned industry (locally and globally). • With increased litigations, broad claims and exclusive licensing, a few giant corporations became too powerful not only in controlling industry standards but also participating in setting the rules of the game. http://altlawforum.org/publications/a-history-of-patent-law/
- 10. Chien, C 2015at file:///Users/osmat/Downloads/SSRN-id2624692..pdf
- 11. 21st Century Patent systemis broken! – Almost every corner around the globe has a patent law and a system of patent administration – 148 states ratified and signed Patent Cooperation Treaty (Harmonization) – Multilateral and bilateral trade treaties – Race to invent and patent – Inefficiency and uncertainty – Right to try to exclude – Opaque “legalese” claim language – Lack of flexibilities – Consolidation and concentration – Social and moral concerns
- 12. Exclusion or inclusion? “WhenI started out with my first company, Zip2, I thought patents were a good thing and worked hard to obtain them. And maybe they were good long ago, but too often these days they serve merely to stifle progress, entrench the positions of giant corporations and enrich those in the legal profession, rather than the actual inventors. After Zip2, when I realized that receiving a patent really just meant that you bought a lottery ticket to a lawsuit, I avoided them whenever possible.” http://www.teslamotors.com/blog/all-our-patent-are-belong-you Elon Musk, CEO Tesla Motors, June 2014
- 13.
- 14. “Patents are protectedby governments because they are held to promote innovation. But there is plenty of evidence that they do not"
- 15. Growth in thenumber of patents (http://www.uspto.gov/web/offices/ac/ido/oeip/taf/us_stat.htm) 0 100 200 300 400 500 600 700 1963 1966 1969 1972 1975 1978 1981 1984 1987 1990 1993 1996 1999 2002 2005 2008 2011 2014 Thousands Total Patent Applications Total Patent Grants (Economist, August 8th, 2015)
- 16. 1980- • Recombinant DNAtechnologies – New ways to solve old problems – Disruptive enough to change structure of society and business • Breakthroughs in technologies that read, analyze, and interpret genetic information • Information technologies • Broad scope of patenting strategy-Patents as regulatory instruments – living organisms and process-based inventions – Exceptions: Laws of nature, natural phenomena, and abstract ideas • Novel business models/licensing mechanisms (public-private partnerships, small with big private partnerships) • The business of science
- 17. 439,000 patents containing sequencelistings (processed on October 1, 2015) > 244 million sequence listings 2015 Genetic sequences and patents First patent on a genetic sequence, US 4,322,499_ A 1982
- 18. AU_686004_B2, Claim 1 • “An isolated nucleic acid coding for a mutant or polymorphic BRCA1 polypeptide, said nucleic acid containing in comparison to the BRCA1 polypeptide encoding sequence set forth in SEQ.ID No:l one or more mutations or polymorphisms selected from the mutations set forth in Tables 12,12A and 14 and the polymorphisms set forth in Tables 18 and 19.” (https://www.lens.org/lens/patent/AU_686004_B2 ) Gene patenting
- 19. “Claims 1-3 areto any and every isolated example of the BRCA1 gene, or a portion of the BRCA1 gene, which discloses the existence of one or more specific mutations or polymorphisms. Therefore, the question in this appeal is whether an isolated nucleic acid which has one or more specific mutations or polymorphisms in the BRCA1 gene is a proper subject for the grant of a patent under s 18(1)(a) of the Patents Act 1990 (Cth) ("the Act"). The answer is no” “……Myriad cannot monopolise the many iterations of the claimed product but it can exploit the applications that have been constructed to take advantage of the knowledge it has about the location and identity of some of the mutations and polymorphisms in the BRCA1 gene that indicate a predisposition to breast cancer and ovarian cancer.” paragraph 178 Judge Gordon at http://eresources.hcourt.gov.au/downloadPdf/2015/HCA/35 paragraph 264 D’Arcy v. Myriad Genetics & Anor, October 7, 2015
- 20. Narrow claim • US7,074,915_B2, claim 2, is for “A synthetic nuclease resistant antisense oligodeoxynucleotide, the nucleotide sequence of which is: 5′ CTGCCACGTTCTCCTGCACC 3′ (SEQ ID NO:1).
- 21. Gene patents arecomplex • Our scientific and technological understanding of genetic information is expanding • Each gene patent is required to have a sequence listings section for any disclosed sequence in the invention, be it used for reference only, be it to constitute or support the invention • The patents could target structure (chemical compound), function of a genetic sequence, or methods of use and comparison. • They encompass disruptive and sustaining technologies – Ability to change the structure of society versus incremental changes • Business, workplace, and global economy
- 22. Patenting categories overtime 0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Numberofsequencesintheclaims Year Alter phenotype Artificial Comparison/Target Peptide Probe or primer used in a method claim Reference RNA/Double stranded Sequence claimed Subpart
- 23. Parts of abiological patent • Title/cover page • Specification – Review of literature (prior art) – Objects of the Invention – A summary of the Invention – Detailed information – “Invention” – Working Examples • Claims • Drawings • Sequence Listing
- 24. Survey of patentoffices • Most patent offices offer the sequence listings information as part of the patent document and a few also provide it to the public through a 3rd party; GenBank, EBI, DDBJ. • Public databases cover only a small portion of the disclosed sequence information • Sequence listings from patent offices are mostly in pdf or image format NOT machine readable or searchable! • Compliance with the standards or rules is not consistent among jurisdictions. • Most patent offices do not keep track of the number of sequence listings.
- 25. Raw data processing .Sequence listings extracted . Format checked and harmonised . Each sequence fingerprinted . Metadata collected, if available (organism, sequence length, type, etc) . Spellchecking of organism names and assignment of taxonomic id WIPO Full-text GBPAT_NCBI 1981-2014 PSIPS 2001-2015 Greenbook data 1992-2001 Red book data 2001-2015 USPTO EBI 1980-2015 Mega listings FTdata? National offices EPO DDJB 2001-2015 Bulk data National office JPO, KIPO Other patent offices Germany Canada Data merging multiple data sources per sequence listing are being tracked. Redundancy analysis for uniqueness . within patent documents . across entire corpus . within patent families (both simple and extended/inpadoc family definitions) Homology based clustering Public download and sequence search BLAST Sequence search Taxonomy-based sequence search Patent Search Index Frontpage, Assignment, etc Patent Data SEQ ID NO Full-text locations Database Storage Facetted analysis index PatSeq Data Inventory Non Redundant View Genome Mappings BWA / BLAT Alignment Datastore PatSeq Explorer PatSeq Analyzer PatSeq Data UI NCBI RefSeq Homology Screening Sequence Annotation PatSeq Finder UI PatSeq Finder Server
- 26.
- 27. Innovation Cartography “Checks &balances, Transparency, and Accountability”