SlideShare a Scribd company logo
1 of 24
“Proteomics”
Sami Mohamed Nasr
Associate Professor
This course will give an introduction to the
field of proteomic and Genomics and the
available proteomic technologies and the
data mining tools.
14 Feb, 2024
Lecture 1
• Bioinformatics
• Areas of current and future development
of bioinformatics
• Genomics>>>>>>>>>>>>>>>>>>
• Transcriptomics
• Proteomics>>>>>>>>>>>>>>>>>
• Metabolomics
• Central Dogma of Molecular Biology
• Genetic Code
• “-ome”
• Protein Chemistry/Proteomics
• Proteomics and biology /Applications
Contents
Bioinformatics
•An Emerging Field
Where Biological/Biomedical and Mathematical/Computational
Disciplines Converge
•Computational biology – study of biological systems
using computational methods
•Bioinformatics – development of
computational tools and approaches
(Specific Bioinformatics software)
Optimize Bioinformatics Data
Mathematics
and Statistics
Biology
Computer
Science
Areas of current and future development of
bioinformatics
•1. Sequence analysis
•Genome projects -> Gene prediction
•Protein sequence analysis
•Comparative genomics
•Protein sequence and family databases (annotation and classification)
•2. Structural genomics
•3. Data analysis and integration for:
•Large scale gene expression analysis
•Protein-protein interaction
•Intracellular protein localization
•4. Integration of all data on proteins to reconstruct pathways and cellular systems,
make predictions and discover new knowledge
Raising bioinformatics…!
• Exponential growth of investments
• Bio-projects
• World class software companies
• Replace Constant deficient of trained professionals
• Diversification of bioinformatics applications
• health
• industry
• Combined courses of different types of bioinformatics,
Mathematics and biological activities
Genomics
• Focusing on the sequence, structure, function, evolution,
mapping, and editing of DNA genomes.
• Conventional sequencing Sanger tech.
• NGS
• High-throughput sequencing
• Sequencing pipelines and databases hubs
• Blast and verifications reveal genes variation
• Metagenomics “ full genetic material recovered directly
from environmental samples”
Transcriptomics
• mRNA serves as a transient intermediary molecule in the information
network, whilst non-coding RNAs perform additional diverse functions.
• A transcriptome captures a snapshot in time of the total transcripts
present in a cell.
• RNA-Seq (black)
• RNA microarray (red)
• Expressed sequence tag (blue),
Proteomics
• Is the large-scale study of proteins
• proteome is the entire set of proteins produced or modified by an
organism or system in the living cell.
• Complexity of the problem
• Refers specifically to protein purification and mass
spectrometry
• Post-translational modifications
• Phosphorylation
Metabolomics
• Is the scientific study of chemical processes involving metabolites ↕
Hormones, Enzymes etc…
• The metabolome refers to the complete set of small-molecule (<1.5
kDa) metabolites (such as metabolic intermediates, hormones and
other signaling molecules, and secondary metabolites)
• Exometabolomics
• Endometabolomics
Central Dogma of Molecular Biology
GENOTYPE (i.e. Aa)
PHENOTYPE (pink)
GENE (DNA)
MESSENGER (RNA)
PROTEIN
TRAIT
ATGCAAGTCCACTGTATTCCA
UACGUUCAGGUGACAUAAGGG
transcription reverse
translation
replication
Genetic Code
1. Amino acids are coded by codons – triplets of nucleotides, e.g. |ACG|TAT|….
2. There are 43 = 64 codons for ~20 amino acids.
3. Codons do not overlap
4. Deletions or insertions of one or few nucleotides (not equal to 3 x N) usually
destroy a message by shifting a reading frame
5. Three specific codons (stop codons) do not code any amino acid and are
always located at the very end of the protein coding part of a gene
The genetic code
Frame shift a.a !!!
DNA Genome “Genomics”
Proteins
Cell
functions
Proteome
“Proteomics”
DNA sequencing
cDNA arrays
2D PAGE, HPLC
CGTCCAA
CTGACGT
CTACAAG
TTCCTAA
GCT
RNA
Transcriptome
“-ome”
Reactome, the chemical reactions involving a nucleotide
Protein Chemistry/Proteomics
Protein Chemistry
• Individual proteins
• Complete sequence analysis
• Emphasis on structure and
function
• Structural biology
Proteomics
• Complex mixtures
• Partial sequence analysis
• Emphasis in identification by
database matching
• System biology
• Proteins are the mediators of functions in the cell
• Deviations from normal status denotes disease
• Proteins are drug/therapeutic targets
Why are we studying proteins?
Proteome Mining
Identifying as many as
possible of the proteins in
your sample
Protein Expression Profiling
Identification of proteins in a particular
sample as a function of a particular
state of the organism or cell
Functional
proteomics
Post-translational
modifications
Identifying how and
where the proteins are
modified
Protein-protein
interactions Protein-
network mapping
Determining how the
proteins interact with
each other in living
systems
Structural
Proteomics
Protein quantitation
or differential
analysis
Proteomics and biology /Applications
Expectations and performance in Proteomics
• Basic understanding of general principles of molecular biology
• Some mathematical and computer science background
• Focus on using computational methods and understanding
general ideas of analysis used in bioinformatics
• Formal description of algorithms and complex methodology
will be the core elements of this field
https://blast.ncbi.nlm.nih.gov/Blast.cgi https://www.ncbi.nlm.nih.gov/tools/primer-
blast/index.cgi?LINK_LOC=BlastHome
https://web.expasy.org/translate/
https://web.expasy.org/translate/
https://www.ddbj.nig.ac.jp/services/index-e.html
DNA Data Bank of Japan
https://www.ebi.ac.uk/Tools/msa/clustalo/
European Bioinformatics
Institute
National Center for Biotechnology Information
Human interferon-gamma gene, complete cds
proteomic and Genomics and the available proteomic technologies and the data mining tools. .pptx
proteomic and Genomics and the available proteomic technologies and the data mining tools. .pptx

More Related Content

Similar to proteomic and Genomics and the available proteomic technologies and the data mining tools. .pptx

genomics proteomics metbolomics.pptx
genomics proteomics metbolomics.pptxgenomics proteomics metbolomics.pptx
genomics proteomics metbolomics.pptxRajesh Yadav
 
Introduction to Bioinformatics
Introduction to BioinformaticsIntroduction to Bioinformatics
Introduction to Bioinformaticsjaumebp
 
BioInformatics Tools -Genomics , Proteomics and metablomics
BioInformatics Tools -Genomics , Proteomics and metablomicsBioInformatics Tools -Genomics , Proteomics and metablomics
BioInformatics Tools -Genomics , Proteomics and metablomicsAyeshaYousaf20
 
Proteomics, techniques, applications.pdf
Proteomics, techniques, applications.pdfProteomics, techniques, applications.pdf
Proteomics, techniques, applications.pdfshinycthomas
 
Genomics and bioinformatics
Genomics and bioinformatics Genomics and bioinformatics
Genomics and bioinformatics Senthil Natesan
 
Predictive Models for Mechanism of Action Classification from Phenotypic Assa...
Predictive Models for Mechanism of Action Classification from Phenotypic Assa...Predictive Models for Mechanism of Action Classification from Phenotypic Assa...
Predictive Models for Mechanism of Action Classification from Phenotypic Assa...Ellen Berg
 
Genes, Genomics and Proteomics
Genes, Genomics and Proteomics Genes, Genomics and Proteomics
Genes, Genomics and Proteomics Garry D. Lasaga
 
Molecular analysis of Microbial Community
Molecular analysis of Microbial CommunityMolecular analysis of Microbial Community
Molecular analysis of Microbial CommunityRinaldo John
 
Proteomics in VSC for crop improvement programme
Proteomics in VSC for crop improvement programmeProteomics in VSC for crop improvement programme
Proteomics in VSC for crop improvement programmeSumanthBT1
 
metabolomics_techniques_approaches_methods
metabolomics_techniques_approaches_methodsmetabolomics_techniques_approaches_methods
metabolomics_techniques_approaches_methodsSachin Teotia
 
Molecular pathology in microbiology and metagenomics
Molecular pathology in microbiology and metagenomicsMolecular pathology in microbiology and metagenomics
Molecular pathology in microbiology and metagenomicsCharithRanatunga
 
Bioinformatics, comparative genemics and proteomics
Bioinformatics, comparative genemics and proteomicsBioinformatics, comparative genemics and proteomics
Bioinformatics, comparative genemics and proteomicsjuancarlosrise
 
Integrative omics approches
Integrative omics approches   Integrative omics approches
Integrative omics approches Sayali Magar
 
Mapping protein to function
Mapping protein to functionMapping protein to function
Mapping protein to functionAbhik Seal
 

Similar to proteomic and Genomics and the available proteomic technologies and the data mining tools. .pptx (20)

genomics proteomics metbolomics.pptx
genomics proteomics metbolomics.pptxgenomics proteomics metbolomics.pptx
genomics proteomics metbolomics.pptx
 
Introduction to Bioinformatics
Introduction to BioinformaticsIntroduction to Bioinformatics
Introduction to Bioinformatics
 
BioInformatics Tools -Genomics , Proteomics and metablomics
BioInformatics Tools -Genomics , Proteomics and metablomicsBioInformatics Tools -Genomics , Proteomics and metablomics
BioInformatics Tools -Genomics , Proteomics and metablomics
 
Plant metabolomics
Plant metabolomicsPlant metabolomics
Plant metabolomics
 
Introduction
IntroductionIntroduction
Introduction
 
Proteomics, techniques, applications.pdf
Proteomics, techniques, applications.pdfProteomics, techniques, applications.pdf
Proteomics, techniques, applications.pdf
 
Proteomics
ProteomicsProteomics
Proteomics
 
Genomics and bioinformatics
Genomics and bioinformatics Genomics and bioinformatics
Genomics and bioinformatics
 
Predictive Models for Mechanism of Action Classification from Phenotypic Assa...
Predictive Models for Mechanism of Action Classification from Phenotypic Assa...Predictive Models for Mechanism of Action Classification from Phenotypic Assa...
Predictive Models for Mechanism of Action Classification from Phenotypic Assa...
 
OMICS.pptx
OMICS.pptxOMICS.pptx
OMICS.pptx
 
Proteomics
ProteomicsProteomics
Proteomics
 
Genes, Genomics and Proteomics
Genes, Genomics and Proteomics Genes, Genomics and Proteomics
Genes, Genomics and Proteomics
 
Molecular analysis of Microbial Community
Molecular analysis of Microbial CommunityMolecular analysis of Microbial Community
Molecular analysis of Microbial Community
 
Proteomics in VSC for crop improvement programme
Proteomics in VSC for crop improvement programmeProteomics in VSC for crop improvement programme
Proteomics in VSC for crop improvement programme
 
Systems biology
Systems biologySystems biology
Systems biology
 
metabolomics_techniques_approaches_methods
metabolomics_techniques_approaches_methodsmetabolomics_techniques_approaches_methods
metabolomics_techniques_approaches_methods
 
Molecular pathology in microbiology and metagenomics
Molecular pathology in microbiology and metagenomicsMolecular pathology in microbiology and metagenomics
Molecular pathology in microbiology and metagenomics
 
Bioinformatics, comparative genemics and proteomics
Bioinformatics, comparative genemics and proteomicsBioinformatics, comparative genemics and proteomics
Bioinformatics, comparative genemics and proteomics
 
Integrative omics approches
Integrative omics approches   Integrative omics approches
Integrative omics approches
 
Mapping protein to function
Mapping protein to functionMapping protein to function
Mapping protein to function
 

Recently uploaded

Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safenarwatsonia7
 
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safenarwatsonia7
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...narwatsonia7
 
Call Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
Call Girl Chennai Indira 9907093804 Independent Call Girls Service ChennaiCall Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
Call Girl Chennai Indira 9907093804 Independent Call Girls Service ChennaiNehru place Escorts
 
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...narwatsonia7
 
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...Miss joya
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Miss joya
 
Aspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliAspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliRewAs ALI
 
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...Miss joya
 
Low Rate Call Girls Ambattur Anika 8250192130 Independent Escort Service Amba...
Low Rate Call Girls Ambattur Anika 8250192130 Independent Escort Service Amba...Low Rate Call Girls Ambattur Anika 8250192130 Independent Escort Service Amba...
Low Rate Call Girls Ambattur Anika 8250192130 Independent Escort Service Amba...narwatsonia7
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableNehru place Escorts
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune) Girls Service
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune)  Girls ServiceCALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune)  Girls Service
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune) Girls ServiceMiss joya
 
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...Miss joya
 
Call Girls Service Pune Vaishnavi 9907093804 Short 1500 Night 6000 Best call ...
Call Girls Service Pune Vaishnavi 9907093804 Short 1500 Night 6000 Best call ...Call Girls Service Pune Vaishnavi 9907093804 Short 1500 Night 6000 Best call ...
Call Girls Service Pune Vaishnavi 9907093804 Short 1500 Night 6000 Best call ...Miss joya
 
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on DeliveryCall Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Deliverynehamumbai
 
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment BookingHousewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Bookingnarwatsonia7
 
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...narwatsonia7
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...Garima Khatri
 

Recently uploaded (20)

Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
 
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
 
Call Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
Call Girl Chennai Indira 9907093804 Independent Call Girls Service ChennaiCall Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
Call Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
 
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
 
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
 
Aspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliAspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas Ali
 
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
 
Low Rate Call Girls Ambattur Anika 8250192130 Independent Escort Service Amba...
Low Rate Call Girls Ambattur Anika 8250192130 Independent Escort Service Amba...Low Rate Call Girls Ambattur Anika 8250192130 Independent Escort Service Amba...
Low Rate Call Girls Ambattur Anika 8250192130 Independent Escort Service Amba...
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
 
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune) Girls Service
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune)  Girls ServiceCALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune)  Girls Service
CALL ON ➥9907093804 🔝 Call Girls Hadapsar ( Pune) Girls Service
 
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
 
Call Girls Service Pune Vaishnavi 9907093804 Short 1500 Night 6000 Best call ...
Call Girls Service Pune Vaishnavi 9907093804 Short 1500 Night 6000 Best call ...Call Girls Service Pune Vaishnavi 9907093804 Short 1500 Night 6000 Best call ...
Call Girls Service Pune Vaishnavi 9907093804 Short 1500 Night 6000 Best call ...
 
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on DeliveryCall Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
 
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Servicesauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
 
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment BookingHousewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
 
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
 

proteomic and Genomics and the available proteomic technologies and the data mining tools. .pptx

  • 1. “Proteomics” Sami Mohamed Nasr Associate Professor This course will give an introduction to the field of proteomic and Genomics and the available proteomic technologies and the data mining tools. 14 Feb, 2024 Lecture 1
  • 2. • Bioinformatics • Areas of current and future development of bioinformatics • Genomics>>>>>>>>>>>>>>>>>> • Transcriptomics • Proteomics>>>>>>>>>>>>>>>>> • Metabolomics • Central Dogma of Molecular Biology • Genetic Code • “-ome” • Protein Chemistry/Proteomics • Proteomics and biology /Applications Contents
  • 3. Bioinformatics •An Emerging Field Where Biological/Biomedical and Mathematical/Computational Disciplines Converge •Computational biology – study of biological systems using computational methods •Bioinformatics – development of computational tools and approaches (Specific Bioinformatics software)
  • 4. Optimize Bioinformatics Data Mathematics and Statistics Biology Computer Science
  • 5. Areas of current and future development of bioinformatics •1. Sequence analysis •Genome projects -> Gene prediction •Protein sequence analysis •Comparative genomics •Protein sequence and family databases (annotation and classification) •2. Structural genomics •3. Data analysis and integration for: •Large scale gene expression analysis •Protein-protein interaction •Intracellular protein localization •4. Integration of all data on proteins to reconstruct pathways and cellular systems, make predictions and discover new knowledge
  • 6. Raising bioinformatics…! • Exponential growth of investments • Bio-projects • World class software companies • Replace Constant deficient of trained professionals • Diversification of bioinformatics applications • health • industry • Combined courses of different types of bioinformatics, Mathematics and biological activities
  • 7. Genomics • Focusing on the sequence, structure, function, evolution, mapping, and editing of DNA genomes. • Conventional sequencing Sanger tech. • NGS • High-throughput sequencing • Sequencing pipelines and databases hubs • Blast and verifications reveal genes variation • Metagenomics “ full genetic material recovered directly from environmental samples”
  • 8. Transcriptomics • mRNA serves as a transient intermediary molecule in the information network, whilst non-coding RNAs perform additional diverse functions. • A transcriptome captures a snapshot in time of the total transcripts present in a cell. • RNA-Seq (black) • RNA microarray (red) • Expressed sequence tag (blue),
  • 9. Proteomics • Is the large-scale study of proteins • proteome is the entire set of proteins produced or modified by an organism or system in the living cell. • Complexity of the problem • Refers specifically to protein purification and mass spectrometry • Post-translational modifications • Phosphorylation
  • 10. Metabolomics • Is the scientific study of chemical processes involving metabolites ↕ Hormones, Enzymes etc… • The metabolome refers to the complete set of small-molecule (<1.5 kDa) metabolites (such as metabolic intermediates, hormones and other signaling molecules, and secondary metabolites) • Exometabolomics • Endometabolomics
  • 11. Central Dogma of Molecular Biology GENOTYPE (i.e. Aa) PHENOTYPE (pink) GENE (DNA) MESSENGER (RNA) PROTEIN TRAIT ATGCAAGTCCACTGTATTCCA UACGUUCAGGUGACAUAAGGG transcription reverse translation replication
  • 12. Genetic Code 1. Amino acids are coded by codons – triplets of nucleotides, e.g. |ACG|TAT|…. 2. There are 43 = 64 codons for ~20 amino acids. 3. Codons do not overlap 4. Deletions or insertions of one or few nucleotides (not equal to 3 x N) usually destroy a message by shifting a reading frame 5. Three specific codons (stop codons) do not code any amino acid and are always located at the very end of the protein coding part of a gene
  • 13. The genetic code Frame shift a.a !!!
  • 14. DNA Genome “Genomics” Proteins Cell functions Proteome “Proteomics” DNA sequencing cDNA arrays 2D PAGE, HPLC CGTCCAA CTGACGT CTACAAG TTCCTAA GCT RNA Transcriptome “-ome” Reactome, the chemical reactions involving a nucleotide
  • 15. Protein Chemistry/Proteomics Protein Chemistry • Individual proteins • Complete sequence analysis • Emphasis on structure and function • Structural biology Proteomics • Complex mixtures • Partial sequence analysis • Emphasis in identification by database matching • System biology
  • 16. • Proteins are the mediators of functions in the cell • Deviations from normal status denotes disease • Proteins are drug/therapeutic targets Why are we studying proteins?
  • 17. Proteome Mining Identifying as many as possible of the proteins in your sample Protein Expression Profiling Identification of proteins in a particular sample as a function of a particular state of the organism or cell Functional proteomics Post-translational modifications Identifying how and where the proteins are modified Protein-protein interactions Protein- network mapping Determining how the proteins interact with each other in living systems Structural Proteomics Protein quantitation or differential analysis Proteomics and biology /Applications
  • 18. Expectations and performance in Proteomics • Basic understanding of general principles of molecular biology • Some mathematical and computer science background • Focus on using computational methods and understanding general ideas of analysis used in bioinformatics • Formal description of algorithms and complex methodology will be the core elements of this field
  • 20. https://www.ddbj.nig.ac.jp/services/index-e.html DNA Data Bank of Japan https://www.ebi.ac.uk/Tools/msa/clustalo/ European Bioinformatics Institute
  • 21. National Center for Biotechnology Information