VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
proteomic and Genomics and the available proteomic technologies and the data mining tools. .pptx
1. “Proteomics”
Sami Mohamed Nasr
Associate Professor
This course will give an introduction to the
field of proteomic and Genomics and the
available proteomic technologies and the
data mining tools.
14 Feb, 2024
Lecture 1
2. • Bioinformatics
• Areas of current and future development
of bioinformatics
• Genomics>>>>>>>>>>>>>>>>>>
• Transcriptomics
• Proteomics>>>>>>>>>>>>>>>>>
• Metabolomics
• Central Dogma of Molecular Biology
• Genetic Code
• “-ome”
• Protein Chemistry/Proteomics
• Proteomics and biology /Applications
Contents
3. Bioinformatics
•An Emerging Field
Where Biological/Biomedical and Mathematical/Computational
Disciplines Converge
•Computational biology – study of biological systems
using computational methods
•Bioinformatics – development of
computational tools and approaches
(Specific Bioinformatics software)
5. Areas of current and future development of
bioinformatics
•1. Sequence analysis
•Genome projects -> Gene prediction
•Protein sequence analysis
•Comparative genomics
•Protein sequence and family databases (annotation and classification)
•2. Structural genomics
•3. Data analysis and integration for:
•Large scale gene expression analysis
•Protein-protein interaction
•Intracellular protein localization
•4. Integration of all data on proteins to reconstruct pathways and cellular systems,
make predictions and discover new knowledge
6. Raising bioinformatics…!
• Exponential growth of investments
• Bio-projects
• World class software companies
• Replace Constant deficient of trained professionals
• Diversification of bioinformatics applications
• health
• industry
• Combined courses of different types of bioinformatics,
Mathematics and biological activities
7. Genomics
• Focusing on the sequence, structure, function, evolution,
mapping, and editing of DNA genomes.
• Conventional sequencing Sanger tech.
• NGS
• High-throughput sequencing
• Sequencing pipelines and databases hubs
• Blast and verifications reveal genes variation
• Metagenomics “ full genetic material recovered directly
from environmental samples”
8. Transcriptomics
• mRNA serves as a transient intermediary molecule in the information
network, whilst non-coding RNAs perform additional diverse functions.
• A transcriptome captures a snapshot in time of the total transcripts
present in a cell.
• RNA-Seq (black)
• RNA microarray (red)
• Expressed sequence tag (blue),
9. Proteomics
• Is the large-scale study of proteins
• proteome is the entire set of proteins produced or modified by an
organism or system in the living cell.
• Complexity of the problem
• Refers specifically to protein purification and mass
spectrometry
• Post-translational modifications
• Phosphorylation
10. Metabolomics
• Is the scientific study of chemical processes involving metabolites ↕
Hormones, Enzymes etc…
• The metabolome refers to the complete set of small-molecule (<1.5
kDa) metabolites (such as metabolic intermediates, hormones and
other signaling molecules, and secondary metabolites)
• Exometabolomics
• Endometabolomics
11. Central Dogma of Molecular Biology
GENOTYPE (i.e. Aa)
PHENOTYPE (pink)
GENE (DNA)
MESSENGER (RNA)
PROTEIN
TRAIT
ATGCAAGTCCACTGTATTCCA
UACGUUCAGGUGACAUAAGGG
transcription reverse
translation
replication
12. Genetic Code
1. Amino acids are coded by codons – triplets of nucleotides, e.g. |ACG|TAT|….
2. There are 43 = 64 codons for ~20 amino acids.
3. Codons do not overlap
4. Deletions or insertions of one or few nucleotides (not equal to 3 x N) usually
destroy a message by shifting a reading frame
5. Three specific codons (stop codons) do not code any amino acid and are
always located at the very end of the protein coding part of a gene
15. Protein Chemistry/Proteomics
Protein Chemistry
• Individual proteins
• Complete sequence analysis
• Emphasis on structure and
function
• Structural biology
Proteomics
• Complex mixtures
• Partial sequence analysis
• Emphasis in identification by
database matching
• System biology
16. • Proteins are the mediators of functions in the cell
• Deviations from normal status denotes disease
• Proteins are drug/therapeutic targets
Why are we studying proteins?
17. Proteome Mining
Identifying as many as
possible of the proteins in
your sample
Protein Expression Profiling
Identification of proteins in a particular
sample as a function of a particular
state of the organism or cell
Functional
proteomics
Post-translational
modifications
Identifying how and
where the proteins are
modified
Protein-protein
interactions Protein-
network mapping
Determining how the
proteins interact with
each other in living
systems
Structural
Proteomics
Protein quantitation
or differential
analysis
Proteomics and biology /Applications
18. Expectations and performance in Proteomics
• Basic understanding of general principles of molecular biology
• Some mathematical and computer science background
• Focus on using computational methods and understanding
general ideas of analysis used in bioinformatics
• Formal description of algorithms and complex methodology
will be the core elements of this field