This document summarizes a study that aimed to identify common foodborne pathogens in food samples collected in Khartoum state, Sudan using PCR. A total of 207 food samples including milk, cheese, eggs, fish, sausage, and mortadella were tested. Multiplex PCR was used to detect Escherichia coli O157:H7, Listeria monocytogenes, Salmonella species, Vibrio cholerae, V. parahaemolyticus, and Staphylococcus aureus. The study found L. monocytogenes in 5 samples, V. cholerae and V. parahaemolyticus together in 1 sample, and S. aureus in 1 sample, for a total of 7 positive samples
Prevalence and Antibiotic sensitivity pattern of Salmonella isolates from mil...IOSRJAVS
This study found a prevalence of Salmonella in milk and water samples collected in Maiduguri, Nigeria. Specifically:
1) The overall prevalence of Salmonella in milk samples was 10%, with the highest prevalence of 24% found in skimmed milk samples from Maiduguri Monday market.
2) The prevalence of Salmonella in water reservoir samples was 40%, with the highest prevalence of 75% found in worship center reservoirs.
3) Antibiotic resistance testing of 15 Salmonella isolates found 100% resistance to amoxicillin, ceftriaxone, and erythromycin, while isolates were most sensitive to ofloxacin (86.67% sensitive).
The document discusses a study examining the prevalence of Salmonella typhi carriers and intestinal parasites among 315 food handlers in Ibb City, Yemen. It finds a 7.3% prevalence of S. typhi and 20% prevalence of intestinal parasites. Higher rates of both were associated with younger age groups of food handlers, indicating their role in transmission.
Investigation of a community outbreak of typhoid feverXia Mujahid
1) An investigation was conducted into an outbreak of typhoid fever in a remote village in Pakistan where over 300 people were infected and 3 died within a week.
2) Laboratory analysis found Salmonella enterica serovar Typhi in all water samples from the village well, which was suspected to be the source of contamination.
3) Clinical samples from 22 patients tested positive for multidrug-resistant Salmonella typhi, confirming it as the cause of the outbreak. The contaminated village well was identified as the source of the outbreak.
Staphylococcus aureus is a common cause of life-threatening bacterial infections, causing over 400,000 hospital patient infections per year and 100,000 deaths from complications. It is a gram-positive, non-motile bacterium that grows in clusters resembling grapes. This study compares the growth rate of S. aureus on soft and hard cheeses stored at different temperatures and times to assess the effect on bacterial growth. Methods describe culturing S. aureus on nutrient and selective agars to detect and isolate the bacteria from cheese samples stored at 20°C. Results show higher initial contamination on hard cheese compared to soft cheese and that storage conditions impact bacterial growth levels in cheese.
The present study was undertaken to investigate
microbiological quality of ready-to-eat street vended aloo-tikki
sold in Allahabad, city of Uttar Pradesh, India. A total of 36
samples were collected from 12 major areas which represented
whole city. All samples were collected from the vendors in
sterilized polythene bags and analyzed within an hour of
procurement. Bacterial pathogens were identified by standard
bacteriological techniques. Microbiological enumeration of ready
to eat street-vended aloo-tikki, revealed a standard plate count
ranging from 103.4-247.3×10-4 cfu/gm, and yeast and mould
ranging between 89-168.2×10-4 cfu/gm. The presumptive coliform
test was found to be 86.1% positive. Prominent bacterial
pathogens isolated were Styphylococcus aureus, Escherichia coli,
Bacillus sp., and Salmonella sp. The presence of such
microorganisms indicates poor handling practices, cross
contamination and aerial contamination which becomes reason
and sometimes important source of food borne illness to humans.
Food samples: African salad, fried yam, fried potato, fried plantain, bole and suya meat retailed in three locations along Choba, Aluu and Alakahia were analyzed for their microbial load. Analysis of the food samples revealed Total viable count ranging from 3.8×107 cfu/g to 5.2×107 cfu/g (African salad), 2.6×107 cfu/g to 3.3×107 cfu/g (Bole), 3.0×107 cfu/g to 3.4×107 cfu/g (Plantain), 3.4×107 cfu/g to 3.6×107 cfu/g (Potato), 2.9×107 cfu/g to 3.3×107 cfu/g (Yam) and 4.8×107 cfu/g to 5.1×107 cfu/g (Suya meat) from the various locations. The organism isolated includes, Staphylococcus aureus (25%), Escherichia coli (25%), Pseudomonas (15%), Streptococcus (15%), Bacillus cereus (12%) and Salmonella spp (8%). The TVC count in these food samples exceeds the standard set by International Commission for Microbiology Specification for Food (ICMSF) for ready-to-eat food which states that TVC count between 0-107 cfu/g is acceptable, 104 to 105 cfu/g is tolerable and >107 cfu/g is unacceptable. Therefore, these foods are not bacteriologically fit for consumption. The occurrence of these bacterial isolates in the foods constitutes public health risk to consumers as these pathogens have been associated with foodborne infections Therefore, government should enforce strong food safety regulations for street foods vendors. In addition, street food vendors need to be educated on food safety and hygienic practices
The document discusses antibiotic resistant bacteria and antibiotic residues found in chicken meat and eggs sold in Kenya. Some key points:
- 87.5% of meat and 100% of egg samples showed presence of antibiotic residues when tested against various bacteria.
- Bacterial counts were higher in meat samples from Kiwanja market compared to Kenyatta University, with mean counts of 190.25 x 102 CFU and 104.96 x 102 CFU respectively.
- Isolated bacteria like E. coli, Salmonella and Shigella from samples showed resistance to certain commonly used antibiotics like ampicillin and intermediate resistance to others.
- The study reveals the presence of antibiotic residues and resistant bacteria in chicken products in
The International Journal of Computational Science, Information Technology an...rinzindorjej
The International Journal of Computational Science, Information Technology and Control Engineering (IJCSITCE) is an open access peer-reviewed journal that publishes quality articles which make innovative contributions in all areas of Computational Science, Mathematical Modeling, Information Technology, Networks, Computer Science, Control and Automation Engineering. IJCSITCE is an abstracted and indexed journal that focuses on all technical and practical aspects of Scientific Computing, Modeling and Simulation, Information Technology, Computer Science, Networks and Communication Engineering, Control Theory and Automation. The goal of this journal is to bring together researchers and practitioners from academia and industry to focus on advanced techniques in computational science, information technology, computer science, chaos, control theory and automation, and establishing new collaborations in these areas.
Prevalence and Antibiotic sensitivity pattern of Salmonella isolates from mil...IOSRJAVS
This study found a prevalence of Salmonella in milk and water samples collected in Maiduguri, Nigeria. Specifically:
1) The overall prevalence of Salmonella in milk samples was 10%, with the highest prevalence of 24% found in skimmed milk samples from Maiduguri Monday market.
2) The prevalence of Salmonella in water reservoir samples was 40%, with the highest prevalence of 75% found in worship center reservoirs.
3) Antibiotic resistance testing of 15 Salmonella isolates found 100% resistance to amoxicillin, ceftriaxone, and erythromycin, while isolates were most sensitive to ofloxacin (86.67% sensitive).
The document discusses a study examining the prevalence of Salmonella typhi carriers and intestinal parasites among 315 food handlers in Ibb City, Yemen. It finds a 7.3% prevalence of S. typhi and 20% prevalence of intestinal parasites. Higher rates of both were associated with younger age groups of food handlers, indicating their role in transmission.
Investigation of a community outbreak of typhoid feverXia Mujahid
1) An investigation was conducted into an outbreak of typhoid fever in a remote village in Pakistan where over 300 people were infected and 3 died within a week.
2) Laboratory analysis found Salmonella enterica serovar Typhi in all water samples from the village well, which was suspected to be the source of contamination.
3) Clinical samples from 22 patients tested positive for multidrug-resistant Salmonella typhi, confirming it as the cause of the outbreak. The contaminated village well was identified as the source of the outbreak.
Staphylococcus aureus is a common cause of life-threatening bacterial infections, causing over 400,000 hospital patient infections per year and 100,000 deaths from complications. It is a gram-positive, non-motile bacterium that grows in clusters resembling grapes. This study compares the growth rate of S. aureus on soft and hard cheeses stored at different temperatures and times to assess the effect on bacterial growth. Methods describe culturing S. aureus on nutrient and selective agars to detect and isolate the bacteria from cheese samples stored at 20°C. Results show higher initial contamination on hard cheese compared to soft cheese and that storage conditions impact bacterial growth levels in cheese.
The present study was undertaken to investigate
microbiological quality of ready-to-eat street vended aloo-tikki
sold in Allahabad, city of Uttar Pradesh, India. A total of 36
samples were collected from 12 major areas which represented
whole city. All samples were collected from the vendors in
sterilized polythene bags and analyzed within an hour of
procurement. Bacterial pathogens were identified by standard
bacteriological techniques. Microbiological enumeration of ready
to eat street-vended aloo-tikki, revealed a standard plate count
ranging from 103.4-247.3×10-4 cfu/gm, and yeast and mould
ranging between 89-168.2×10-4 cfu/gm. The presumptive coliform
test was found to be 86.1% positive. Prominent bacterial
pathogens isolated were Styphylococcus aureus, Escherichia coli,
Bacillus sp., and Salmonella sp. The presence of such
microorganisms indicates poor handling practices, cross
contamination and aerial contamination which becomes reason
and sometimes important source of food borne illness to humans.
Food samples: African salad, fried yam, fried potato, fried plantain, bole and suya meat retailed in three locations along Choba, Aluu and Alakahia were analyzed for their microbial load. Analysis of the food samples revealed Total viable count ranging from 3.8×107 cfu/g to 5.2×107 cfu/g (African salad), 2.6×107 cfu/g to 3.3×107 cfu/g (Bole), 3.0×107 cfu/g to 3.4×107 cfu/g (Plantain), 3.4×107 cfu/g to 3.6×107 cfu/g (Potato), 2.9×107 cfu/g to 3.3×107 cfu/g (Yam) and 4.8×107 cfu/g to 5.1×107 cfu/g (Suya meat) from the various locations. The organism isolated includes, Staphylococcus aureus (25%), Escherichia coli (25%), Pseudomonas (15%), Streptococcus (15%), Bacillus cereus (12%) and Salmonella spp (8%). The TVC count in these food samples exceeds the standard set by International Commission for Microbiology Specification for Food (ICMSF) for ready-to-eat food which states that TVC count between 0-107 cfu/g is acceptable, 104 to 105 cfu/g is tolerable and >107 cfu/g is unacceptable. Therefore, these foods are not bacteriologically fit for consumption. The occurrence of these bacterial isolates in the foods constitutes public health risk to consumers as these pathogens have been associated with foodborne infections Therefore, government should enforce strong food safety regulations for street foods vendors. In addition, street food vendors need to be educated on food safety and hygienic practices
The document discusses antibiotic resistant bacteria and antibiotic residues found in chicken meat and eggs sold in Kenya. Some key points:
- 87.5% of meat and 100% of egg samples showed presence of antibiotic residues when tested against various bacteria.
- Bacterial counts were higher in meat samples from Kiwanja market compared to Kenyatta University, with mean counts of 190.25 x 102 CFU and 104.96 x 102 CFU respectively.
- Isolated bacteria like E. coli, Salmonella and Shigella from samples showed resistance to certain commonly used antibiotics like ampicillin and intermediate resistance to others.
- The study reveals the presence of antibiotic residues and resistant bacteria in chicken products in
The International Journal of Computational Science, Information Technology an...rinzindorjej
The International Journal of Computational Science, Information Technology and Control Engineering (IJCSITCE) is an open access peer-reviewed journal that publishes quality articles which make innovative contributions in all areas of Computational Science, Mathematical Modeling, Information Technology, Networks, Computer Science, Control and Automation Engineering. IJCSITCE is an abstracted and indexed journal that focuses on all technical and practical aspects of Scientific Computing, Modeling and Simulation, Information Technology, Computer Science, Networks and Communication Engineering, Control Theory and Automation. The goal of this journal is to bring together researchers and practitioners from academia and industry to focus on advanced techniques in computational science, information technology, computer science, chaos, control theory and automation, and establishing new collaborations in these areas.
International Journal of Computational Science, Information Technology and Co...rinzindorjej
The International Journal of Computational Science, Information Technology and Control Engineering (IJCSITCE) is an open access peer-reviewed journal that publishes quality articles which make innovative contributions in all areas of Computational Science, Mathematical Modeling, Information Technology, Networks, Computer Science, Control and Automation Engineering. IJCSITCE is an abstracted and indexed journal that focuses on all technical and practical aspects of Scientific Computing, Modeling and Simulation, Information Technology, Computer Science, Networks and Communication Engineering, Control Theory and Automation. The goal of this journal is to bring together researchers and practitioners from academia and industry to focus on advanced techniques in computational science, information technology, computer science, chaos, control theory and automation, and establishing new collaborations in these areas.
The International Journal of Computational Science, Information Technology an...rinzindorjej
The International Journal of Computational Science, Information Technology and Control Engineering (IJCSITCE) is an open access peer-reviewed journal that publishes quality articles which make innovative contributions in all areas of Computational Science, Mathematical Modeling, Information Technology, Networks, Computer Science, Control and Automation Engineering. IJCSITCE is an abstracted and indexed journal that focuses on all technical and practical aspects of Scientific Computing, Modeling and Simulation, Information Technology, Computer Science, Networks and Communication Engineering, Control Theory and Automation. The goal of this journal is to bring together researchers and practitioners from academia and industry to focus on advanced techniques in computational science, information technology, computer science, chaos, control theory and automation, and establishing new collaborations in these areas.
This document summarizes a study on the microbial quality of raw milk samples collected from four locations in Abia State, Nigeria. A variety of bacteria (Escherichia coli, Staphylococcus aureus, Streptococcus spp.) and fungi (Candida spp, Mucor spp.) were isolated from the milk samples. The total bacterial counts ranged from 9.88 x 107 to 1.26 x 108 cfu/ml across samples. The coliform, staphylococcal, and fungal counts also varied between locations. The milk from the university farm location had lower microbial loads compared to milk from other commercial sources, likely due to better hygienic practices on the university farm.
Shigellosis and Socio-Demography of hospitalized Patients in Kano, North-West...inventionjournals
Aim: The aim of the study was to determine the prevalent of Shigellosis in relation to socio-demographic characteristics of hospitalized patients in Kano metropolis. Study design: The study is a descriptive cross-sectional study. Place and duration of study: One milliliter of venous blood was collected from each patient with some or all clinical features of Shigellosis that sign a consent form and transfer into EDTA bottles. If daily is unavoidable blood samples were stored at 4 0C. Samples were analyzed at the both laboratories of the authors. This work was carried out between May, 2012 and March, 2014. Methodology: The blood specimens were cultured in thioglycollate broth and sub-cultured onto deoxycholate citrate agar (DCA), Salmonella-Shigella agar (SSA) and brilliant Green agar (BGA) followed by confirmation of presumptive colonies using different biochemical tests and analytical profile index 20E. Serologic identification of Shigella was performed by slide agglutination test using polyvalent O and H Shigella antisera. Results: Although, the relationship between different age groups was not significantly associated (P < 0.05), patients under age bracket of 21-30 years were found to be more susceptible to Shigella infections with 13 representing 2.6% followed in that order by 11-20 years (6), , ≤10 -years (4) 31-40 years (3) and >40 years (2) age groups, representing 1.2%, 0.8%, 0.6% and 0.4% respectively. The frequency of shigellosis was highest in other patients (without occupation), patients with informal level of education, using tap water as sources of drinking water, with more than one of all clinical manifestations of Salmonella infections and patients on treatment. However, there was a significant difference between the rate of Salmonella infections and sociodemographic characteristics of patients studied (p<0.05).> 0.05) in males than the females’ patients. However, Shigella flexneri was the most common among patients followed by Shigella dysenteriae, Shigella boydii and Shigella sonnei in decreasing order. The frequency of shigellosis was highest in other patients (without occupation), patients with informal level of education, using tap water as sources of drinking water, with more than one of all clinical manifestations of Salmonella infections and patients on treatment.
This study analyzed the microbiological quality of commonly consumed ready-to-eat foods (rice, beans, yam, fufu, and meat) obtained from food vendors at Ekiti State University in Nigeria. Aerobic plate counts and fungal counts were determined for the food samples, with mean plate counts ranging from 1.0 x 102 to 6.0 x 104 CFU/g and fungal counts ranging from 1.3 x 102 to 5.2 x 104 CFU/g. Eleven species of microorganisms were isolated including Bacillus cereus, Escherichia coli, Salmonella spp., and Aspergillus spp. Bacillus cereus was the most frequently isolated organism
Microbial Status and Identification with Antibiotic Susceptibility Patterns o...YogeshIJTSRD
There are various benefits offered by street vended foods, but street foods are contaminated with many foodborne pathogens includes enteric pathogenic bacteria like Escherichia coli and Vibrio cholerae has become a potential health hazard problem all over the world. The aim of this study was to evaluate the complete microbial status of common foodborne pathogens including enteric pathogen Escherichia coli and Vibrio cholerae and identify the presence and find out the contamination level of Escherichia coliand Vibrio cholerae with Antibiotic sensitivity status from different street foods in Dhaka City, Bangladesh. For this assessment, 42 street food samples of 6categories were collected from 7 different areas of Dhaka city. In all food samples, Total Viable Bacterial Count TVBC was Ranged from 1.3x107 to 8×107cfu g, Total Coliform Count TCC was Ranged from 1x107 to 4.5 x107cfu g, Total Escherichia coli Count TEC was Ranged from 2×104 to 7.9x106cfu g and Total Vibrio cholerae Count TVC was ranged from 1x102 to 5.3x106cfu g. In addition, out of the 42 analyzed food samples Escherichia coliwas found in 28 66.67 samples and Vibrio cholera was found in 26 61.90 samples. The isolated pathogenic Escherichia coli and Vibrio cholerae was identified by Cultural, Gram Staining, and Biochemical tests. The isolated pathogens were then tested for antibiotic sensitivity and the results revealed that isolated Escherichia coli were resistant against Streptomycin 85.71 , Ceftriaxone 100 , Erythromycin 100 , Cefixime 100 , Meropenem 100 , and Gentamycin 71.42 and isolated Vibrio cholerae were resistant against Streptomycin 84.62 , Erythromycin 100 , Cefixime 100 , Meropenem 100 , Amikacin 100 , and Gentamycin 57.69 areoutrageous. The results revealed that the contamination percentage of pathogenic Escherichia coli 22 and Vibrio cholerae 23 in Gulistanwas high than the other areas. Shanzida Sultana | Shamarjit Das | Prity Lata Chakraborty | Rajia Sultana "Microbial Status and Identification with Antibiotic Susceptibility Patterns of Enteric Pathogen Escherichia Coli and Vibrio Cholerae Isolated from Different Street Foods Sold in Dhaka City, Bangladesh" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-5 | Issue-3 , April 2021, URL: https://www.ijtsrd.com/papers/ijtsrd38759.pdf Paper URL: https://www.ijtsrd.com/biological-science/microbiology/38759/microbial-status-and-identification-with-antibiotic-susceptibility-patterns-of-enteric-pathogen-escherichia-coli-and-vibrio-cholerae-isolated-from-different-street-foods-sold-in-dhaka-city-bangladesh/shanzida-sultana
This document discusses viruses and other biohazards that can be transmitted through food. It begins by introducing the group members and their student numbers. It then discusses four main types of foodborne viruses including their characteristics. Specific viruses covered include hepatitis A virus, noroviruses, rotaviruses, and enteroviruses. The document also addresses the incidence of these viruses in foods and the environment, their modes of transmission, detection methods like RT-PCR, and ways to destroy viruses in foods like boiling. Scombroid poisoning caused by histamine in certain fish is also summarized.
International Journal of Pharmaceutical Science Invention (IJPSI)inventionjournals
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online.
This study analyzed 280 samples collected from the hands and mobile phones of 140 healthcare workers at a tertiary hospital to assess the role of poor hand hygiene and mobile phone use in transmitting hospital-acquired infections. Bacterial growth was detected in 220 samples, with pathogenic organisms found in 75 samples. Escherichia coli was the most common isolate, followed by Klebsiella species. Several isolates were found to be methicillin-resistant Staphylococcus aureus and extended-spectrum beta-lactamase producers. The results suggest that healthcare workers' hands and mobile phones can transmit pathogenic bacteria in hospitals and may contribute to the spread of antimicrobial resistance.
This study compared the use of real-time polymerase chain reaction (RT-PCR) and standard isolation techniques for detecting Salmonella in broiler chicks. The incidence of Salmonella was higher in local chicks (21.67%) than imported chicks (11.67%) using standard isolation. Salmonella enteritidis and S. typhimurium were common in local chicks, while S. newport was highest in imported chicks. RT-PCR detected Salmonella in 58.33% of imported and 66.67% of local chicks, higher than standard isolation. RT-PCR is a more rapid, effective method for Salmonella detection but should be used along with standard methods for accurate identification of different
People in a big city as Antananarivo, capital of Madagascar, have leads to take street foods for their daily nutritional needs. This food habits may be a risk for consumers due to contaminations from street environment and bad practices related to hygiene. This study aimed to examine the quality and safety of street vended foods in Antananarivo, on January 2016 to December 2017.Six hundred and sixty two samples including 126samples of melting salads, 70 beef skewers, 54 chicken skewers, and typical Malagasy foods as : mofoanana (67 samples), mofogasy (64 samples), ramanonaka (64), makasaoka (66), mofoakondro (62) and kobandravina(89);were randomly collected from the streetvendors in Antananarivo marketsto evaluate their bacteriological quality.International Methods (ISO) was adopted for to find the load of Total Aerobic Bacteria andEnterobateriaceae,Escherichia coli and to search pathogen bacteria as Salmonella, Campylobacter jejuni, Escherichia coli O157H7 and Bacillus cereus in these foods.The results revealed that the mean values ofthe Total Aerobic Bacteria count was 0.1x106- 4.8x106cfu/g. Enterobacteriaceaecount range from 0.4x102 to 1.9x102cfu/g. Escherichia coli count range from 0.04x102cfu/g. to 0.19 x102cfu/g.Salmonellawas only present in melting salads, beef skewers and chicken skewers samples. Bacillus cereus count range from 0,1x102 to 1,5x102cfu/g. Campylobacter jejuniwas only present in samples of ramanonaka and kobandravina. Two strains of presumptive Eschercichia coli O157 H7 (βglucuronidase -) were isolated. PCR method was used to confirm the identity of these two isolates. A high contamination above 106 cfu/g food and the presence of potential pathogens bacteria could be hazardous. Systematic inspections and training of food vendors on food hygiene and application of hazard analysis critical control point (HACCP) has been recognised as measures to guarantee improvement of the quality of street foods.
Bovine Mastitis due to Coliform Bacteria, and Susceptibility to Antibiotics, ...Premier Publishers
This study was aimed at determining the prevalence of coliform bacteria in bovine milk in Plateau State of Nigeria and their antibiotic susceptibility patterns. A total of 640 milk samples were collected aseptically and 160 questionnaires from where data such as breed, age, parity, lactation stage, floor type, and husbandry system were analyzed. Cows without clinical mastitis were subjected to California Mastitis Test to determine the presence of subclinical mastitis. Bacteriological assays and antibiotic susceptibility tests were conducted according to standard guidelines. Subclinical mastitis with a prevalence of 63.8% was more prevalent in cows than clinical mastitis. Overall, the Friesian breed had the highest mastitis prevalence of 85.7% compared to White Fulani (which is indigenous in Nigeria). Cows aged within 2-4 years old had the least mastitis prevalence of 55.2%. Coliforms isolated from milk samples included E coli, K. pneumoniae, K. oxytoca, C. freundii, E. aerogenes, E. cloacae, and S. marcescens, with E coli having the highest prevalence of 44.8%. The most resistant antimicrobial agent was Streptomycin with 79% prevalence. The principle of One Health approach which targets the environment, animals and humans should be considered important. Good hygienic measures should be intensified among pastoralists.
Microbial industrial accidents, prevention and preparednessjyotigoyal19
Microbial industrial accidents can occur due to unsafe conditions and the release of pathogens. Younger workers are more at risk of accidents than older workers. Prevention efforts include improving ventilation, isolation of contamination sources, proper training, and use of personal protective equipment. Accidents are investigated and lessons learned are implemented to minimize future risks.
International Journal of Pharmaceutical Science Invention (IJPSI)inventionjournals
This study examined 692 stool samples from patients at a tertiary care hospital in Uttar Pradesh, India. The samples were tested for intestinal parasites using microscopy. Of the samples, 116 (16.8%) tested positive for parasites. The most common parasite was Entamoeba histolytica at 42.24% of positive samples, followed by Giardia lamblia at 24.13%. Giardia infections were highest in the 21-40 age group. The study found a high prevalence of intestinal parasitic infections compared to other areas, indicating a need for better diagnostic methods, prevention strategies, and health education on environmental hygiene.
Prevalence of Staphylococcus aureus and Escherichia coli in Sun-cured Meat (J...BRNSSPublicationHubI
This document reports on a study that examined 81 samples of sun-cured meat called kilishi from 10 retail outlets in Sokoto, Nigeria to detect the presence of Staphylococcus aureus and Escherichia coli. Using bacterial culture and biochemical tests, S. aureus was found in 68 samples at a prevalence of 83.9%, while E. coli was not detected in any samples. The contamination rate of S. aureus was highest in 4 areas which all had 100% prevalence. Due to the high occurrence of enterotoxin-producing S. aureus isolated from the kilishi samples, the meat may serve as a source of staphylococcal infection for consumers. Standard hygienic practices throughout food production
This document summarizes a study that examined the prevalence of Staphylococcus aureus and Escherichia coli in sun-cured meat (jerky/kilishi) from retail outlets in Sokoto, Nigeria. A total of 81 meat samples were collected from 10 areas and tested for the presence of S. aureus and E. coli using bacterial culture and biochemical tests. S. aureus was found in 68 samples at a prevalence of 83.9%, while E. coli was not found in any samples (0% prevalence). The contamination rate of S. aureus was highest (100% prevalence) in samples from 4 areas, while other areas had rates of 25%, 60%, and 80%. Due to the high occurrence
Microbial industrial accidents, prevention and preparednessjyotigoyal19
This document discusses microbial industrial accidents, including causes and examples. It notes that unsafe conditions caused 80% of accidents and younger workers experienced more. Several case studies are presented, including foodborne outbreaks from Salmonella and E. coli. Prevention strategies are outlined like improved safety training, ventilation, personal protective equipment, and laboratory biosafety levels. Relevant legislation around biological and chemical safety in workplaces is also mentioned.
Bacteriological Assessment of Ready-to-Eat Bakery Products Sold in Zuru Metro...BRNSSPublicationHubI
This study assessed the bacteriological quality of ready-to-eat bakery products sold in Zuru, Nigeria. A total of 20 samples from bakeries and vendors were tested. The highest bacterial count was found in doughnut samples, while the lowest was in bread. Isolates from the samples included Salmonella, E. coli, Staphylococcus aureus, Bacillus cereus, and Pseudomonas aeruginosa. E. coli was the most frequently occurring isolate. The presence of pathogenic bacteria indicates potential health risks from improper food handling and highlights the need for increased hygiene during bakery product production and sale.
International Journal of Computational Science, Information Technology and Co...rinzindorjej
The International Journal of Computational Science, Information Technology and Control Engineering (IJCSITCE) is an open access peer-reviewed journal that publishes quality articles which make innovative contributions in all areas of Computational Science, Mathematical Modeling, Information Technology, Networks, Computer Science, Control and Automation Engineering. IJCSITCE is an abstracted and indexed journal that focuses on all technical and practical aspects of Scientific Computing, Modeling and Simulation, Information Technology, Computer Science, Networks and Communication Engineering, Control Theory and Automation. The goal of this journal is to bring together researchers and practitioners from academia and industry to focus on advanced techniques in computational science, information technology, computer science, chaos, control theory and automation, and establishing new collaborations in these areas.
The International Journal of Computational Science, Information Technology an...rinzindorjej
The International Journal of Computational Science, Information Technology and Control Engineering (IJCSITCE) is an open access peer-reviewed journal that publishes quality articles which make innovative contributions in all areas of Computational Science, Mathematical Modeling, Information Technology, Networks, Computer Science, Control and Automation Engineering. IJCSITCE is an abstracted and indexed journal that focuses on all technical and practical aspects of Scientific Computing, Modeling and Simulation, Information Technology, Computer Science, Networks and Communication Engineering, Control Theory and Automation. The goal of this journal is to bring together researchers and practitioners from academia and industry to focus on advanced techniques in computational science, information technology, computer science, chaos, control theory and automation, and establishing new collaborations in these areas.
This document summarizes a study on the microbial quality of raw milk samples collected from four locations in Abia State, Nigeria. A variety of bacteria (Escherichia coli, Staphylococcus aureus, Streptococcus spp.) and fungi (Candida spp, Mucor spp.) were isolated from the milk samples. The total bacterial counts ranged from 9.88 x 107 to 1.26 x 108 cfu/ml across samples. The coliform, staphylococcal, and fungal counts also varied between locations. The milk from the university farm location had lower microbial loads compared to milk from other commercial sources, likely due to better hygienic practices on the university farm.
Shigellosis and Socio-Demography of hospitalized Patients in Kano, North-West...inventionjournals
Aim: The aim of the study was to determine the prevalent of Shigellosis in relation to socio-demographic characteristics of hospitalized patients in Kano metropolis. Study design: The study is a descriptive cross-sectional study. Place and duration of study: One milliliter of venous blood was collected from each patient with some or all clinical features of Shigellosis that sign a consent form and transfer into EDTA bottles. If daily is unavoidable blood samples were stored at 4 0C. Samples were analyzed at the both laboratories of the authors. This work was carried out between May, 2012 and March, 2014. Methodology: The blood specimens were cultured in thioglycollate broth and sub-cultured onto deoxycholate citrate agar (DCA), Salmonella-Shigella agar (SSA) and brilliant Green agar (BGA) followed by confirmation of presumptive colonies using different biochemical tests and analytical profile index 20E. Serologic identification of Shigella was performed by slide agglutination test using polyvalent O and H Shigella antisera. Results: Although, the relationship between different age groups was not significantly associated (P < 0.05), patients under age bracket of 21-30 years were found to be more susceptible to Shigella infections with 13 representing 2.6% followed in that order by 11-20 years (6), , ≤10 -years (4) 31-40 years (3) and >40 years (2) age groups, representing 1.2%, 0.8%, 0.6% and 0.4% respectively. The frequency of shigellosis was highest in other patients (without occupation), patients with informal level of education, using tap water as sources of drinking water, with more than one of all clinical manifestations of Salmonella infections and patients on treatment. However, there was a significant difference between the rate of Salmonella infections and sociodemographic characteristics of patients studied (p<0.05).> 0.05) in males than the females’ patients. However, Shigella flexneri was the most common among patients followed by Shigella dysenteriae, Shigella boydii and Shigella sonnei in decreasing order. The frequency of shigellosis was highest in other patients (without occupation), patients with informal level of education, using tap water as sources of drinking water, with more than one of all clinical manifestations of Salmonella infections and patients on treatment.
This study analyzed the microbiological quality of commonly consumed ready-to-eat foods (rice, beans, yam, fufu, and meat) obtained from food vendors at Ekiti State University in Nigeria. Aerobic plate counts and fungal counts were determined for the food samples, with mean plate counts ranging from 1.0 x 102 to 6.0 x 104 CFU/g and fungal counts ranging from 1.3 x 102 to 5.2 x 104 CFU/g. Eleven species of microorganisms were isolated including Bacillus cereus, Escherichia coli, Salmonella spp., and Aspergillus spp. Bacillus cereus was the most frequently isolated organism
Microbial Status and Identification with Antibiotic Susceptibility Patterns o...YogeshIJTSRD
There are various benefits offered by street vended foods, but street foods are contaminated with many foodborne pathogens includes enteric pathogenic bacteria like Escherichia coli and Vibrio cholerae has become a potential health hazard problem all over the world. The aim of this study was to evaluate the complete microbial status of common foodborne pathogens including enteric pathogen Escherichia coli and Vibrio cholerae and identify the presence and find out the contamination level of Escherichia coliand Vibrio cholerae with Antibiotic sensitivity status from different street foods in Dhaka City, Bangladesh. For this assessment, 42 street food samples of 6categories were collected from 7 different areas of Dhaka city. In all food samples, Total Viable Bacterial Count TVBC was Ranged from 1.3x107 to 8×107cfu g, Total Coliform Count TCC was Ranged from 1x107 to 4.5 x107cfu g, Total Escherichia coli Count TEC was Ranged from 2×104 to 7.9x106cfu g and Total Vibrio cholerae Count TVC was ranged from 1x102 to 5.3x106cfu g. In addition, out of the 42 analyzed food samples Escherichia coliwas found in 28 66.67 samples and Vibrio cholera was found in 26 61.90 samples. The isolated pathogenic Escherichia coli and Vibrio cholerae was identified by Cultural, Gram Staining, and Biochemical tests. The isolated pathogens were then tested for antibiotic sensitivity and the results revealed that isolated Escherichia coli were resistant against Streptomycin 85.71 , Ceftriaxone 100 , Erythromycin 100 , Cefixime 100 , Meropenem 100 , and Gentamycin 71.42 and isolated Vibrio cholerae were resistant against Streptomycin 84.62 , Erythromycin 100 , Cefixime 100 , Meropenem 100 , Amikacin 100 , and Gentamycin 57.69 areoutrageous. The results revealed that the contamination percentage of pathogenic Escherichia coli 22 and Vibrio cholerae 23 in Gulistanwas high than the other areas. Shanzida Sultana | Shamarjit Das | Prity Lata Chakraborty | Rajia Sultana "Microbial Status and Identification with Antibiotic Susceptibility Patterns of Enteric Pathogen Escherichia Coli and Vibrio Cholerae Isolated from Different Street Foods Sold in Dhaka City, Bangladesh" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-5 | Issue-3 , April 2021, URL: https://www.ijtsrd.com/papers/ijtsrd38759.pdf Paper URL: https://www.ijtsrd.com/biological-science/microbiology/38759/microbial-status-and-identification-with-antibiotic-susceptibility-patterns-of-enteric-pathogen-escherichia-coli-and-vibrio-cholerae-isolated-from-different-street-foods-sold-in-dhaka-city-bangladesh/shanzida-sultana
This document discusses viruses and other biohazards that can be transmitted through food. It begins by introducing the group members and their student numbers. It then discusses four main types of foodborne viruses including their characteristics. Specific viruses covered include hepatitis A virus, noroviruses, rotaviruses, and enteroviruses. The document also addresses the incidence of these viruses in foods and the environment, their modes of transmission, detection methods like RT-PCR, and ways to destroy viruses in foods like boiling. Scombroid poisoning caused by histamine in certain fish is also summarized.
International Journal of Pharmaceutical Science Invention (IJPSI)inventionjournals
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online.
This study analyzed 280 samples collected from the hands and mobile phones of 140 healthcare workers at a tertiary hospital to assess the role of poor hand hygiene and mobile phone use in transmitting hospital-acquired infections. Bacterial growth was detected in 220 samples, with pathogenic organisms found in 75 samples. Escherichia coli was the most common isolate, followed by Klebsiella species. Several isolates were found to be methicillin-resistant Staphylococcus aureus and extended-spectrum beta-lactamase producers. The results suggest that healthcare workers' hands and mobile phones can transmit pathogenic bacteria in hospitals and may contribute to the spread of antimicrobial resistance.
This study compared the use of real-time polymerase chain reaction (RT-PCR) and standard isolation techniques for detecting Salmonella in broiler chicks. The incidence of Salmonella was higher in local chicks (21.67%) than imported chicks (11.67%) using standard isolation. Salmonella enteritidis and S. typhimurium were common in local chicks, while S. newport was highest in imported chicks. RT-PCR detected Salmonella in 58.33% of imported and 66.67% of local chicks, higher than standard isolation. RT-PCR is a more rapid, effective method for Salmonella detection but should be used along with standard methods for accurate identification of different
People in a big city as Antananarivo, capital of Madagascar, have leads to take street foods for their daily nutritional needs. This food habits may be a risk for consumers due to contaminations from street environment and bad practices related to hygiene. This study aimed to examine the quality and safety of street vended foods in Antananarivo, on January 2016 to December 2017.Six hundred and sixty two samples including 126samples of melting salads, 70 beef skewers, 54 chicken skewers, and typical Malagasy foods as : mofoanana (67 samples), mofogasy (64 samples), ramanonaka (64), makasaoka (66), mofoakondro (62) and kobandravina(89);were randomly collected from the streetvendors in Antananarivo marketsto evaluate their bacteriological quality.International Methods (ISO) was adopted for to find the load of Total Aerobic Bacteria andEnterobateriaceae,Escherichia coli and to search pathogen bacteria as Salmonella, Campylobacter jejuni, Escherichia coli O157H7 and Bacillus cereus in these foods.The results revealed that the mean values ofthe Total Aerobic Bacteria count was 0.1x106- 4.8x106cfu/g. Enterobacteriaceaecount range from 0.4x102 to 1.9x102cfu/g. Escherichia coli count range from 0.04x102cfu/g. to 0.19 x102cfu/g.Salmonellawas only present in melting salads, beef skewers and chicken skewers samples. Bacillus cereus count range from 0,1x102 to 1,5x102cfu/g. Campylobacter jejuniwas only present in samples of ramanonaka and kobandravina. Two strains of presumptive Eschercichia coli O157 H7 (βglucuronidase -) were isolated. PCR method was used to confirm the identity of these two isolates. A high contamination above 106 cfu/g food and the presence of potential pathogens bacteria could be hazardous. Systematic inspections and training of food vendors on food hygiene and application of hazard analysis critical control point (HACCP) has been recognised as measures to guarantee improvement of the quality of street foods.
Bovine Mastitis due to Coliform Bacteria, and Susceptibility to Antibiotics, ...Premier Publishers
This study was aimed at determining the prevalence of coliform bacteria in bovine milk in Plateau State of Nigeria and their antibiotic susceptibility patterns. A total of 640 milk samples were collected aseptically and 160 questionnaires from where data such as breed, age, parity, lactation stage, floor type, and husbandry system were analyzed. Cows without clinical mastitis were subjected to California Mastitis Test to determine the presence of subclinical mastitis. Bacteriological assays and antibiotic susceptibility tests were conducted according to standard guidelines. Subclinical mastitis with a prevalence of 63.8% was more prevalent in cows than clinical mastitis. Overall, the Friesian breed had the highest mastitis prevalence of 85.7% compared to White Fulani (which is indigenous in Nigeria). Cows aged within 2-4 years old had the least mastitis prevalence of 55.2%. Coliforms isolated from milk samples included E coli, K. pneumoniae, K. oxytoca, C. freundii, E. aerogenes, E. cloacae, and S. marcescens, with E coli having the highest prevalence of 44.8%. The most resistant antimicrobial agent was Streptomycin with 79% prevalence. The principle of One Health approach which targets the environment, animals and humans should be considered important. Good hygienic measures should be intensified among pastoralists.
Microbial industrial accidents, prevention and preparednessjyotigoyal19
Microbial industrial accidents can occur due to unsafe conditions and the release of pathogens. Younger workers are more at risk of accidents than older workers. Prevention efforts include improving ventilation, isolation of contamination sources, proper training, and use of personal protective equipment. Accidents are investigated and lessons learned are implemented to minimize future risks.
International Journal of Pharmaceutical Science Invention (IJPSI)inventionjournals
This study examined 692 stool samples from patients at a tertiary care hospital in Uttar Pradesh, India. The samples were tested for intestinal parasites using microscopy. Of the samples, 116 (16.8%) tested positive for parasites. The most common parasite was Entamoeba histolytica at 42.24% of positive samples, followed by Giardia lamblia at 24.13%. Giardia infections were highest in the 21-40 age group. The study found a high prevalence of intestinal parasitic infections compared to other areas, indicating a need for better diagnostic methods, prevention strategies, and health education on environmental hygiene.
Prevalence of Staphylococcus aureus and Escherichia coli in Sun-cured Meat (J...BRNSSPublicationHubI
This document reports on a study that examined 81 samples of sun-cured meat called kilishi from 10 retail outlets in Sokoto, Nigeria to detect the presence of Staphylococcus aureus and Escherichia coli. Using bacterial culture and biochemical tests, S. aureus was found in 68 samples at a prevalence of 83.9%, while E. coli was not detected in any samples. The contamination rate of S. aureus was highest in 4 areas which all had 100% prevalence. Due to the high occurrence of enterotoxin-producing S. aureus isolated from the kilishi samples, the meat may serve as a source of staphylococcal infection for consumers. Standard hygienic practices throughout food production
This document summarizes a study that examined the prevalence of Staphylococcus aureus and Escherichia coli in sun-cured meat (jerky/kilishi) from retail outlets in Sokoto, Nigeria. A total of 81 meat samples were collected from 10 areas and tested for the presence of S. aureus and E. coli using bacterial culture and biochemical tests. S. aureus was found in 68 samples at a prevalence of 83.9%, while E. coli was not found in any samples (0% prevalence). The contamination rate of S. aureus was highest (100% prevalence) in samples from 4 areas, while other areas had rates of 25%, 60%, and 80%. Due to the high occurrence
Microbial industrial accidents, prevention and preparednessjyotigoyal19
This document discusses microbial industrial accidents, including causes and examples. It notes that unsafe conditions caused 80% of accidents and younger workers experienced more. Several case studies are presented, including foodborne outbreaks from Salmonella and E. coli. Prevention strategies are outlined like improved safety training, ventilation, personal protective equipment, and laboratory biosafety levels. Relevant legislation around biological and chemical safety in workplaces is also mentioned.
Bacteriological Assessment of Ready-to-Eat Bakery Products Sold in Zuru Metro...BRNSSPublicationHubI
This study assessed the bacteriological quality of ready-to-eat bakery products sold in Zuru, Nigeria. A total of 20 samples from bakeries and vendors were tested. The highest bacterial count was found in doughnut samples, while the lowest was in bread. Isolates from the samples included Salmonella, E. coli, Staphylococcus aureus, Bacillus cereus, and Pseudomonas aeruginosa. E. coli was the most frequently occurring isolate. The presence of pathogenic bacteria indicates potential health risks from improper food handling and highlights the need for increased hygiene during bakery product production and sale.
1.) Introduction
Our Movement is not new; it is the same as it was for Freedom, Justice, and Equality since we were labeled as slaves. However, this movement at its core must entail economics.
2.) Historical Context
This is the same movement because none of the previous movements, such as boycotts, were ever completed. For some, maybe, but for the most part, it’s just a place to keep your stable until you’re ready to assimilate them into your system. The rest of the crabs are left in the world’s worst parts, begging for scraps.
3.) Economic Empowerment
Our Movement aims to show that it is indeed possible for the less fortunate to establish their economic system. Everyone else – Caucasian, Asian, Mexican, Israeli, Jews, etc. – has their systems, and they all set up and usurp money from the less fortunate. So, the less fortunate buy from every one of them, yet none of them buy from the less fortunate. Moreover, the less fortunate really don’t have anything to sell.
4.) Collaboration with Organizations
Our Movement will demonstrate how organizations such as the National Association for the Advancement of Colored People, National Urban League, Black Lives Matter, and others can assist in creating a much more indestructible Black Wall Street.
5.) Vision for the Future
Our Movement will not settle for less than those who came before us and stopped before the rights were equal. The economy, jobs, healthcare, education, housing, incarceration – everything is unfair, and what isn’t is rigged for the less fortunate to fail, as evidenced in society.
6.) Call to Action
Our movement has started and implemented everything needed for the advancement of the economic system. There are positions for only those who understand the importance of this movement, as failure to address it will continue the degradation of the people deemed less fortunate.
No, this isn’t Noah’s Ark, nor am I a Prophet. I’m just a man who wrote a couple of books, created a magnificent website: http://www.thearkproject.llc, and who truly hopes to try and initiate a truly sustainable economic system for deprived people. We may not all have the same beliefs, but if our methods are tried, tested, and proven, we can come together and help others. My website: http://www.thearkproject.llc is very informative and considerably controversial. Please check it out, and if you are afraid, leave immediately; it’s no place for cowards. The last Prophet said: “Whoever among you sees an evil action, then let him change it with his hand [by taking action]; if he cannot, then with his tongue [by speaking out]; and if he cannot, then, with his heart – and that is the weakest of faith.” [Sahih Muslim] If we all, or even some of us, did this, there would be significant change. We are able to witness it on small and grand scales, for example, from climate control to business partnerships. I encourage, invite, and challenge you all to support me by visiting my website.
Gamify it until you make it Improving Agile Development and Operations with ...Ben Linders
So many challenges, so little time. While we’re busy developing software and keeping it operational, we also need to sharpen the saw, but how? Gamification can be a way to look at how you’re doing and find out where to improve. It’s a great way to have everyone involved and get the best out of people.
In this presentation, Ben Linders will show how playing games with the DevOps coaching cards can help to explore your current development and deployment (DevOps) practices and decide as a team what to improve or experiment with.
The games that we play are based on an engagement model. Instead of imposing change, the games enable people to pull in ideas for change and apply those in a way that best suits their collective needs.
By playing games, you can learn from each other. Teams can use games, exercises, and coaching cards to discuss values, principles, and practices, and share their experiences and learnings.
Different game formats can be used to share experiences on DevOps principles and practices and explore how they can be applied effectively. This presentation provides an overview of playing formats and will inspire you to come up with your own formats.
Public Art Is (Re)connection: people, heritage and spacesMarta Pucciarelli
Keynote speech at the Public Art Inside Out Symposium, 7-8 May 2024, organized by Getty Conservation Center and MUDEC in Milan. “Public art is (re)connection” is co-authored with Princess Marilyn Douala Bell.
Kalyan chart satta matka guessing resultsanammadhu484
MATKASATTABOSS.COM IS INDIA'S MOST TRUSTED NO.1 WEBSITE. WE PROVIDE YOU EXACT GUESSING OF THE MATKA RESULT BY OUR TOP GUESSER, MATKASATTABOSS.COM ALWAYS PROVIDES EXACT AND FAST MATKA RESULTS. PLAY SATTA MATKA AND BECOME SATTA KING BY THE HELP OF MATKASATTABOSS.COM. INDIA'S TOP SATTA MATKA MARKET AND THEIR FAST MATKA RESULTS. GET ALL THE RESULTS AND WIN MONEY BY PERFECT KALYAN MATKA TIPS , MATKA GUESSING BY OUR TOP GUESSER AND KALYAN RAJSHREE RAJYOG SWASTIK NATRAAJ BANGLORE BIRLA RAJDHANI MILAN TIME BAZAAR MATKA CHART .
1. Original article
Detection and characterization of the most common foodborne
pathogens by using multiplex PCR procedure
Hisham N. Altayb a
, Rania M. Badri b
, Kamel Chaieb a
, Ehssan Moglad c,⇑
a
Department of Biochemistry, Faculty of Sciences, King Abdulaziz University, Jeddah 21589, Saudi Arabia
b
Department of Microbiology, College of Medical Laboratories Science, Sudan University of Science and Technology, Khartoum, 11111, Sudan
c
Department of Pharmaceutics, College of Pharmacy, Prince Sattam bin Abdulaziz University, P.O.Box 173, Alkharj 11942, Saudi Arabia
a r t i c l e i n f o
Article history:
Received 24 January 2023
Revised 18 March 2023
Accepted 9 April 2023
Available online 15 April 2023
Keywords:
Foodborne illness
Escherichia coli O157: H7
Listeria monocytogenes
Salmonella spp.
Vibrio cholerae
Vibrio parahaemolyticus
a b s t r a c t
Food Microbial contamination is one of the most serious problems. A large percentage of food-borne ill-
nesses are caused by food-borne pathogens, and diarrheal agents comprise more than half of the overall
prevalence of food-borne illnesses in the globe, and more commonly in developing countries. This study
aimed to identify the most-common foodborne organisms from foods in Khartoum state by PCR.
A total of 207 food samples (raw milk, fresh cheese, yogurt, fish, sausage, mortadella, and eggs) were
collected. DNA was extracted from food samples by guanidine chloride protocol, and then species-
specific primers were used to identify Escherichia coli O157: H7, Listeria monocytogenes, Salmonella spp.,
Vibrio cholerae, V. parahaemolyticus, and Staphylococcus aureus. Out of 207 samples, five (2.41%) were pos-
itive for L. monocytogenes, one (0.48%) was positive for S. aureus, and one (0.48%) was positive for both
Vibrio cholerae and Vibrio parahaemolyticus. From 91 fresh cheese samples, 2 (2.19%) were positive for
L. monocytogenes, and one (1.1%) sample was positive for two different foodborne pathogens (V. cholerae
and V. parahaemolyticus). Out of 43 Cow’s milk samples, three (7%) samples were positive for L. monocy-
togenes, and out of 4 sausage samples, one (25 %) was positive for S. aureus. Our study revealed the pres-
ence of L. monocytogenes and V. cholera in raw milk and fresh cheese samples. Their presence is
considered a potential problem and needs intensive hygiene efforts and standard safety measures before,
during, and after food processing operations.
Ó 2023 The Authors. Published by Elsevier B.V. on behalf of King Saud University. This is an open access
article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction
Millions of people worldwide suffer from diseases transmitted
through contaminated food and water (KAFERstEIN et al., 2019).
Transmission of foodborne pathogens causes annually about 600
million cases, and 420 000 deaths, 30% of deaths occur in children
less than five years old (Jaffee et al., 2018). In the past two to three
decades, there is an increase in the percentage of foodborne dis-
eases, with reports of serious outbreaks transmitted through con-
taminated foods and water such as cholera, listeriosis, and
salmonellosis (Heredia and García, 2018). It is estimated that annu-
ally there are about four million cases of cholera in the world,
which causes 21,000 to 143,000 deaths annually (Salcedo, 2018).
Unlike most bacteria, L. monocytogenes can survive and multiply
in low temperatures and can withstand acidity and salinity, which
enables them to contaminate many types of foods (Swaminathan
and Gerner-Smidt, 2007, de Noordhout et al., 2014). E. coli O157:
H7 is considered one of the most dangerous serotypes of E. coli,
in America alone, it causes 73,000 illnesses, more than two thou-
sand hospital stays, and 60 deaths annually, which costs the Amer-
ican economy 405 million dollars a year (Lim et al., 2010).
Salmonella species are considered one of the most important
microbes that cause foodborne infections in the world and cause
a group of diseases. The most important types are typhoid, paraty-
phoid, bacteremia, and gastroenteritis (Ibrahim et al., 2013). Annu-
ally 500,000 Salmonella-related death reported worldwide (Deng
et al., 2003). In Sudan, there is a continuous occurrence of
foodborne-related outbreaks such as cholera (Shanan et al.,
2011), the last cholera outbreakone was reported recently in
December 2019 (Moskvitina et al., 2020).
https://doi.org/10.1016/j.sjbs.2023.103653
1319-562X/Ó 2023 The Authors. Published by Elsevier B.V. on behalf of King Saud University.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
⇑ Corresponding author.
E-mail addresses: hdemmahom@kau.edu.sa (H.N. Altayb), ahmed.hassanab@-
sustech.edu (R.M. Badri), kalshaib@kau.edu.sa (K. Chaieb), e.moglad@psau.edu.sa
(E. Moglad).
Peer review under responsibility of King Saud University.
Production and hosting by Elsevier
Saudi Journal of Biological Sciences 30 (2023) 103653
Contents lists available at ScienceDirect
Saudi Journal of Biological Sciences
journal homepage: www.sciencedirect.com
2. Sudan is one of the African countries suffering from a substan-
tial internal conflict that has weakened the country’s health system
and affected the country’s overall stability (Sulieman et al., 2020).
Recently Khartoum and different parts of Sudan suffered from a
flash flood (Elsafi, 2021), and during and after the floods different
outbreaks were recorded (Ibrahim and Saeed, 2020, Abdelnabi
et al., 2022). contaminated water among the main sources of food
contamination (Abdelnabi et al., 2022). Bad hygiene and contami-
nation of slaughterhouses were reported in Khartoum, in which a
high percentage of E. coli, S. aureus, and Salmonella spp. were
reported (Salih, 2020). A high prevalence of Salmonella species
among food handlers was reported by Ahmed et al. (Ahmed
et al., 2019), they reported out of 387 healthy food handlers 17
(4.4%) were positive for Salmonella species. Different outbreaks of
cholera in Sudan were characterized as ‘‘watery diarrhea” recently
the Sudanese minister of health declared a cholera outbreak in
2019 (Kunna, 2020). Diarrhea is considered one of the leading
causes of hospital admission and death in Sudan, especially for
those under 5 years old children (Elmanssury et al., 2022), contam-
inated food and water are the major cause of diarrhea.
There is a lack regarding the prevalence and source of the com-
mon born food pathogens in foods, so this study aimed to detect
the presence of the most common foodborne pathogens from foods
(raw milk, fresh cheese, yogurt, fish, sausage, mortadella, and eggs)
collected in Khartoum state by using multiplex PCR.
2. Materials and methods
2.1. Samples collection and processing
This cross-sectional study was carried out in the Khartoum state
(Khartoum- Bahri- Omdurman) during the period from May to June
2018. The permission to do this study was obtained from the Khar-
toum state ministry of health. Different food samples were col-
lected as follows: Fresh cheese samples (n = 91) were collected
from containers used regularly for selling and storage of fresh
cheese at room temperature in shops. Milk samples (n = 54) were
milked directly by herders into sterile containers from cows and
goats (the cows’ samples were from the same farm). Eggs
(n = 29), fish (n = 20), locally prepared yogurt (n = 7), sausage
(n = 4), and mortadella (n = 2) samples were collected from differ-
ent markets and shops in Khartoum state (Khartoum, Bahri, and
Omdurman). All samples were collected using sterile gloves in
clean, sterile, and labeled containers, then immediately transferred
to the laboratory for further processing. Samples not processed
immediately were kept in 20 °C.
Ethical approval for sample collection was obtained from the
University Medical Science & Technology ethical committee and
the Khartoum state ministry of health.
2.2. DNA extraction
We used the guanidine chloride procedure for DNA extraction
as described previously (Sabeel et al., 2017). Five grams of fresh
cheese, fish, sausage, and mortadella samples, were used for DNA
extraction. Sterile Pasteur pipettes are used to transfer five ml of
milk, egg, and yogurt samples into sterile disposable falcon tubes
(15 ml). Furthermore, 20 ll of proteinase K, 350 ll of ammonium
acetate, 2 ml of cell lysis buffer, and 1 ml of guanidine chloride
were mixed. The mixture was mixed and incubated overnight (at
37℃). A vortex was used to thoroughly combine the tube content
after 2 ml of pre-chilled chloroform had been added. The mixture
was then centrifuged for 10 min (at 6000 RPM). The DNA was pre-
cipitated by the addition of 8 ml of cold ethanol to each falcon tube
while gently mixing after the supernatant was transferred into a
new 15 ml falcon tube. After being centrifuged for 10 min at
6000 RPM, the pellets were rinsed with 4 ml of 70% ethanol and
centrifuged for 10 min, then incubated at 20 °C overnight. The
tubes were centrifuged and were blotted on filter paper, and
allowed to air dry. Once the drying process was complete, 100 ll
of DW was added, and the DNA elution process was completed
and then stored at 4 °C for a short period until used for PCR.
2.3. Multiplex PCR
A set of primers were used to detect the Escherichia coli O157:
H7 verocytotoxin stx gene, the Listeria. monocytogenes hemolysin
hly gene, the Salmonella spp. invasion invA gene, the Vibrio cholerae
toxin ctx gene, the Vibrio parahaemolyticus thermolabile hemolysin
tlh gene, the S. aureus thermostable nuclease (nuc) gene (Lei et al.,
2008) (Table 1).
The Maxime PCR Pre-Mix kit was used to perform multiplex
PCR in a 25 ll volume (iNtRON Biotechnology, Seongnam, Korea).
The premix was dissolved in 16 ll of Distilled Water and trans-
ferred into a 0.2 ml PCR tube. For each tube, 0.6 ll of each primer
and 2 ll of DNA were added.
2.4. The protocol used for the amplification of the genes
A DNA thermal cycler was used to carry out each PCR reaction
(K960 Healforce, China). The template DNA was initially denatured
at 95 °C for 3 min, and the Taq polymerase was then activated.
Then, 35 times each of the following PCR temperature cycling set-
tings were used: primer annealing for 90 s at 55°Celsius, DNA
extension for 90 s at 72°Celsius, and denaturation for 60 s at 95°-
Celsius. After target amplification, the reaction warmed and was
held at 4 °C while the incompletely synthesized DNA underwent
one final extension at 72 °C for 10 min. Instead of template DNA,
a negative reaction control mixture including only sterile distilled
water was utilized (Lei et al., 2008).
Table 1
Primer sequences and expected size of PCR-amplified gene targets of six species of foodborne pathogens (Lei et al., 2008).
Pathogen Primer name DNA sequence (5ʼ to 3ʼ) Amplicons size (bp)
V. cholerae ctxAB _F
ctxAB _R
TGAAATAAAGCAGTCAGGTG
GGTATTCTGCACACAAATCAG
777
E. coli stx_F
stx_R
TGGGTTTTTCTTCGGTATCC
CCAGTTCAGAGTGAGGTCCA
632
Salmonella spp. invA_F
invA_R
TACTAACAGTGCTCGTTTAC
ATAAACTTCATCGCACCGTCA
570
V. parahaemolyticus tlh_F
tlh_R
CGGATTATGCAGAAGCACTG
ACTTTCTAGCATTTTCTCTGC
444
S. aureus nuc_F
nuc_R
GCGATTGATGGTGATACGGTT
AGCCAAGCCTTGACGAACTAAAGC
270
L. monocytogenes hly_F
hly_R
GCATCTGCATTCAATAAAGA
TGTCACTGCATCTCCGTGGT
174
H.N. Altayb, R.M. Badri, K. Chaieb et al. Saudi Journal of Biological Sciences 30 (2023) 103653
2
3. 2.5. Detection of PCR-amplified products
Using the electrophoresis apparatus, the amplified PCR products
were separated at 100 V for 30 min in a 1.5% (wt/vol) agarose gel
containing ethidium bromide. In order to identify the individual
amplified products, bands were compared with 100 bp of standard
ladders (INTRON biotechnology, Korea) using a UV transillumina-
tor (UVitec-UK).
3. Results
As shown in Table 2, the frequencies of collected (207) samples
were as follows; 43 (20.8%) cow’s milk, 11 (5.3%) goat’s milk, 91
(44%) fresh cheese, 29 (14%) of egg, 7 (3.4%) yogurt, 20 (9.7%) fish,
4 (1.9%) sausage and 2 (1%) mortadella. Samples were collected
from localities in Khartoum state as shown in Fig. 1.
Among all samples, eight foodborne pathogens were detected in
seven samples (3.4%): five samples (2.4%) were positive for L.
monocytogenes, one (0.48%) was positive for both V. cholerae, and
V. parahaemolyticus and one (0.48%) was positive for S. aureus.
From 91 fresh cheese samples, two (2.2%) were positive for L.
monocytogenes, and one (1.1%) was positive for both V. cholerae
and V. parahaemolyticus (Fig. 2). Out of 43 Cow’s milk samples,
three (7.0%) samples were positive for Listeria monocytogenes
(Fig. 3), and out of 4 sausage samples, one (25.0%) was positive
for S. aureus (Fig. 2), more details are in Table 3 and Table 4.
The detected organisms were from the Omdurman locality
(n = 4): Three were L. monocytogenes from fresh milk, V. cholerae,
and V. parahaemolyticus detected in one fresh cheese sample. In
the Khartoum locality, three samples were positive: one S. aureus
was detected in one sausage sample, and L. monocytogenes were
detected in two fresh cheese samples.
According to storage type, out of 22 samples that were stored in
the refrigerator (cooled) 1 (4.5%) sample was positive for Listeria
monocytogenes, out of 9 samples that were stored in a freezer 1
sample (11.1%) was positive with S. aureus, out of 38 fresh samples
3 (7.9%) samples were positive with Listeria monocytogenes, out of
138 samples which were stored at room temperature 1(0.7%) sam-
ple was positive for S. aureus and 1 (0.7%) sample was positive with
two organisms which were Vibrio cholera and Vibrio parahaemolyti-
cus as described in details in supplementary material Table S1.
No foodborne pathogens were found in Bahri and Khartoum
localities, while in the Omdurman locality three foodborne patho-
gens were found in different types of samples, Listeria monocyto-
genes were found in 3 fresh milk samples, V. cholerae and V.
parahaemolyticus were found in 1 cheese sample. While in the Jabal
Awleya locality two foodborne pathogens were found in different
types of samples, S. aureus found in 1 sausage sample and Listeria
monocytogenes found in 2 cheese samples.
4. Discussion
Foodborne infections are a serious problem affecting public
health worldwide (Odeyemi, 2016). A large percentage of food-
borne illnesses are caused by food-borne pathogens, and diarrheal
agents comprise more than half of the overall prevalence of food-
borne illnesses in the globe, the developing countries are more
affected (Donkor, 2020). In this study 207 food samples were
investigated for the presence of the commonly reported foodborne
pathogens; 5 samples (2.4%) were positive for L. monocytogenes,
one sample (0.48%) was positive for V. cholerae and V. para-
haemolyticus, and one sample (0.48%) was positive for S. aureus.
L. monocytogenes is a bacterium that can infect humans and ani-
mals and can cause an outbreak of listeriosis (Hunt et al., 2012). L.
monocytogenes was positive in three milk samples, and two fresh
cheese samples, the presence of this organism in milk samples
could be a result of these cows being infected with listeriosis or
from contaminated udders. This hypothesis is supported by that
all positive samples were collected from the same herd. Several
reports from different regions of the world have confirmed the
presence of L. monocytogenes in milk (Hunt et al., 2012, Olaimat
et al., 2018, Moosavy et al., 2014). In Sudan, L. monocytogenes
was detected previously in broiler chicken also (Alsheikh et al.,
2012). The presence of L. monocytogenes in fresh cheese may be a
result of the fact that fresh cheese is traditionally prepared from
fresh milk that could be contaminated with these bacteria, or the
contamination happened during the preparation of fresh cheese
(Moosavy et al., 2014). The presence of L. monocytogenes in fresh
cheese is more dangerous than in milk because fresh cheese is used
directly, while milk goes through a heating process before use.
One fresh cheese sample was positive for both V. cholerae and V.
parahaemolyticus. High temperatures will accelerate the growth of
Vibrio cholera species (Asadgol et al., 2019), and raw foods will
serve as good conditions for the growth and dissemination of these
species. Although fermented foods could hinder cholera progres-
sion here we reported the presence of V. cholera DNA, which may
be a part of a dead organism originating from a contaminated fresh
milk sample (Mao et al., 2018). Before a short time of sample col-
lection (in 2019), an outbreak of V. cholera hit Sudan mainly in
Khartoum (hit African, 2019), this could be a reason for the pres-
ence of this species in our sample.
Primers targeting the species-specific S. aureus nuc gene which
encodes for the extracellular thermostable nuclease protein
(TNase) proved to be a useful tool for the molecular identification
of S. aureus isolates (Javid et al., 2018). The presence of Staphylo-
coccal species in food is an indicator of food contamination, meat
suitable for human use must be Staphylococcus-free (Khalid
et al., 2019). Sausages are uncooked meat products and the chance
to get contaminated during preparation and processing is high
(Hassabo et al., 2012) (Khalid et al., 2019). In this study, S. aureus
Table 2
Distribution and frequencies of collected samples according to Khartoum state localities.
Samples Locality
Bahri Khartoum Omdurman Total
Fresh cheese 16 (59.3%) 27 (41%) 48 (41.7)% 91(44%)
Egg 6 (22.2%) 8 (12%) 15 (13%) 29 (14%)
Fish 3 (11%) 12 (19%) 5 (4.3%) 20 (9.7%)
Cow’s Milk 1(3.7%) 9 (14%) 33 (28.7%) 43(20.8%)
Goat’s Milk 0 0 11(9.6%) 11(5.3%)
Mortadella 0 2(3%) 0 2 (1%)
Sausage 1(3.7%) 2 (3%) 1 (0.9%) 4 (1.9%)
Yogurt 0 5 (8%) 2 (1.7%) 7 (3.4%)
Total 27 (100%) 65(100%) 115(100%) 207(100%)
H.N. Altayb, R.M. Badri, K. Chaieb et al. Saudi Journal of Biological Sciences 30 (2023) 103653
3
4. Fig. 1. Frequency of collected samples according to localities in Khartoum state.
Fig. 2. Multiplex PCR amplification on 1.5% agarose gel electrophoresis. Lane M is a DNA ladder: MW 100–1500 bp. Lane 7 shows a typical band size of (777 bp &444 bp)
corresponding to the molecular size of ctx and tlh genes of V. cholerae, and V. parahaemolyticus. Lanes 1, 2, 3, 4, and 5 are negative samples.
Fig. 3. Multiplex PCR amplification on 1.5% agarose gel electrophoresis. Lane 1 is a DNA ladder: MW 100–1500 bp. Lane 2 shows a typical band size of (270 bp) corresponding
to the molecular size of nuc gene of S. aureus. Lanes 3, 4, and 5 are negative samples. Lane 6 shows a typical band size of (174 bp) corresponding to the molecular size of hly
gene of L. monocytogenes.
H.N. Altayb, R.M. Badri, K. Chaieb et al. Saudi Journal of Biological Sciences 30 (2023) 103653
4
5. was detected in ¼ (25%) of the manufactured sausage samples, the
obtained result is lower than the result obtained by Nagwa et al.
(Nagwa, 2015), in which they found 50% of sausage samples col-
lected from Khartoum State were positive for S. aureus. While
our finding is higher than Khalid et al. (Khalid et al., 2019) who
zero reported S. aureus in investigated sausage samples from Khar-
toum State.
5. Limitations
Culturing of microorganisms was don’t performed due lack of
resources at the time of the study, we depend only on PCR to
screen a large number of different samples which required differ-
ent types of culture media. The presence S. aureus is only screened
by targeting the housekeeping gene (nuc), additional primers tar-
geting the enterotoxin will differentiate the commensals from
toxin strains.
6. Conclusion
This study revealed the presence of dangerous foodborne
pathogens such as L. monocytogenes (2.4%) and V. cholera (1.1%)
in raw milk and fresh cheese samples in Khartoum state. Their
presence is considered a potential problem and needs intensive
hygiene efforts and standard safety measures before, during, and
after processing operations. Among 43 samples of cow’s fresh milk,
3 of them (7%) tested positive for Listeria monocytogenes in samples
from the Omdurman locality from the same herd suggesting the
endemic presence of these bacteria in the herd.
7. Authors’ contributions
HNA, RMB and EHM conceived the study. KC and HNA did the
statistical analysis and drafted the manuscript. RMB did the inves-
tigations and sample collection. All authors contributed to the
writing of the paper and approved it.
Data Availability
All data used in this study are included in the manuscript.
Declaration of Competing Interest
The authors declare that they have no known competing finan-
cial interests or personal relationships that could have appeared
to influence the work reported in this paper.
Acknowledgment
The authors acknowledge the Deanship of Scientific Research
(DSR), King Abdulaziz University, Jeddah for funding this work
under Grant No. D-302-130-1441.
Appendix A. Supplementary material
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.sjbs.2023.103653.
References
Abdelnabi, G.H., Abdelaziz, S.A., Alia, O., Abeer, A., Hind, E., Sabiel, Y., Muna, E.,
Abass, A.M., 2022. Assessment of bacterial contamination in drinking water
sources in Khartoum/Sudan. J. Adv. Microbiol., 50–56
Ahmed, N.E.M.A., Hassan, A.N., Holi, M.A.I., Galander, I., 2019. Prevalence and
antibiotic susceptibility of salmonella species among food handlers in
Khartoum-State (Sudan). Prevalence 35.
Alsheikh, A., Mohammed, G., Abdalla, M., 2012. First isolation and identification of
listeria monocytogenes from fresh raw dressed broiler chicken in Sudan. Res. J.
Microbiol. 7, 319–326.
Table 3
Frequencies of detected foodborne pathogens on different foods samples.
sample Foodborne pathogens
L. monocytogenes S. aureus V. cholerae V. parahaemolyticus Total
Fresh cheese (n = 91) 2 (2.2%) 0 1(1.1%) 1(1.1%) 4(4.4%)
Egg (n = 29) 0 0 0 0 0
Fish (n = 20) 0 0 0 0 0
Cow’s Milk (n = 43) 3 (7 %) 0 0 0 3 (7%)
Goat’s Milk (n = 11) 0 0 0 0 0
Mortedella (n = 2) 0 0 0 0 0
Sausage (n = 4) 0 1 (25%) 0 0 1 (25%)
Yogurt (n = 7) 0 0 0 0 0
Total (n = 207) 5 (2.4%) 1 (0.48%) 1 (0.48%) 1 (0.48%) 8 (3.9%)
Table 4
Frequencies of positive samples according to storage type.
Storage Results Total
-ve Lm S. aureus V. cholerae V. haemolyticus
Cooled 21 1 0 0 0 22
95.5% 4.5% 0.0% 0.0% 0.0% 100.0%
Freeze 8 0 1 0 0 9
88.9% 0.0% 11.1% 0.0% 0.0% 100.0%
Fresh 35 3 0 0 0 38
92.1% 7.9% 0.0% 0.0% 0.0% 100.0%
RT 136 1 0 1 1 138
97.9% 0.7% 0.0% 0.7% 0.7% 100.0%
Total 200 5 1 1 1 207
96.1% 2.4% 0.5% 0.5% 0.5% 100.0%
Abbreviations: RT, room temperature; Lm, Listeria monocytogenes; -ve, negative.
H.N. Altayb, R.M. Badri, K. Chaieb et al. Saudi Journal of Biological Sciences 30 (2023) 103653
5
6. Asadgol, Z., Mohammadi, H., Kermani, M., Badirzadeh, A., Gholami, M., 2019. The
effect of climate change on cholera disease: the road ahead using artificial
neural network. PLoS One 14, e0224813.
de Noordhout, C.M., Devleesschauwer, B., Angulo, F.J., Verbeke, G., Haagsma, J., Kirk,
M., Havelaar, A., Speybroeck, N., 2014. The global burden of listeriosis: a
systematic review and meta-analysis. Lancet Infect. Dis. 14, 1073–1082.
Deng, W., Liou, S.R., Plunkett III, G., Mayhew, G.F., Rose, D.J., Burland, V., Kodoyianni,
V., Schwartz, D.C., Blattner, F.R., 2003. Comparative genomics of Salmonella
enterica serovar Typhi strains Ty2 and CT18. J. Bacteriol. 185, 2330–2337.
Donkor, E.S., 2020. Cockroaches and food-borne pathogens. Environ. Health Insights
14. 1178630220913365.
Elmanssury, A., Elnadif, D., Safa, A., 2022. Prevalence of diarrhea and association
with socio-demographic factors among children under five in Mayo Camp-
Khartoum State Sudan. Pakistan J. Medical Health Sci. 16, 1100.
Elsafi, S. H. 2021. Difference in the extreme flooded years in Khartoum region using
water Indices from Landsat images (1988-1994-1998-1999-2013-2020). ﻣ
ﺠ
ﻠ
ﺔ
ﺑ
ﺤ
ﻮ
ﺙ
ﮐ
ﻠ
ﻴ
ﺔ
ﺍ
ﻵ
ﺩ
ﺍ
ﺏ
.
ﺟ
ﺎ
ﻣ
ﻌ
ﺔ
ﺍ
ﻟ
ﻤ
ﻨ
ﻮ
ﻓ
ﻴ
ﺔ .
Hassabo, A., Eisa, M., Ishag, I., Osman, S., Bushara, I., 2012. Usage of antibiotic as milk
preservative in the slums of Khartoum state. J. Anim. Prod. Adv 2, 138–141.
Heredia, N., García, S., 2018. Animals as sources of food-borne pathogens: a review.
Animal nutrition 4, 250–255.
HIT AFRICAN, F. 2019. Public health round-up. Bull World Health Organ, 97, 793-
794.
Hunt, K., Drummond, N., Murphy, M., Butler, F., Buckley, J., Jordan, K., 2012. A case of
bovine raw milk contamination with Listeria monocytogenes. Ir. Vet. J. 65, 13.
Ibrahim, S., Asakir, S., Idris, A., Martinez-Urtaza, J., Elsafi, H.H., 2013. Prevalence of
Salmonella species among asymptomatic food handlers in Khartoum State,
Sudan. Brit. J. Biomed. Sci. 70, 88.
Ibrahim, M.E.A., Saeed, H.A., 2020. Serodetection of Hepatitis A Virus among Food-
handlers in Khartoum Locality, Sudan. Microbiology.
Havelaar, A.H., Kirk, M.D., Torgerson, P.R., Gibb, H.J., Hald, T., 2018. World Health
Organization Global Estimates and Regional Comparisons of the Burden of
Foodborne Disease in 2010. University of Southern California Los Angeles.
Javid, F., Taku, A., Bhat, M.A., Badroo, G.A., Mudasir, M., Sofi, T.A., 2018. Molecular
typing of Staphylococcus aureus based on coagulase gene. Vet. World 11, 423.
Kaferstein, F.K., Motarjemi, Y.M., Moy, G.G., Quevado, F., 2019. Food safety: a
worldwide public. International Food Safety Handbook: Science, International
Regulation, and Control, 1.
Khalid, A.M., Ali, A.A., Hussain, S.K., Awad, F.N., Elhassan, I.H., Ismaiel, A.E., Basheer,
E.O., 2019. Microbial characteristics of meat products in Khartoum State. Int. J.
Innovative Sci. Eng. Technol. 6, 225.
Kunna, E. 2020. Sudan: Managing COVID-19 Pandemic During a Time of Transition.
Lei, I.-F., Roffey, P., Blanchard, C., Gu, K., 2008. Development of a multiplex PCR
method for the detection of six common foodborne pathogens. J. Food Drug
Anal. 16.
Lim, J.Y., Yoon, J.W., Hovde, C.J., 2010. A brief overview of Escherichia coli O157: H7
and its plasmid O157. J. Microbiol. Biotechnol. 20, 5.
Mao, N., Cubillos-Ruiz, A., Cameron, D.E., Collins, J.J., 2018. Probiotic strains detect
and suppress cholera in mice. Sci. Transl. Med. 10, eaao2586.
Moosavy, M.-H., Esmaeili, S., Mostafavi, E., Amiri, F.B., 2014. Isolation of Listeria
monocytogenes from milks used for Iranian traditional cheese in Lighvan
cheese factories. Ann. Agric. Environ. Med. 21.
Moskvitina, E.A., Yanovich, E.G., Kurilenko, M.L., Kruglikov, V.D., Titova, S.V.,
Levchenko, D.A., Vodopyanov, A.S., Lopatin, A.A., 2020. Cholera: Monitoring of
Epidemiological Situation around the World and in Russia. Forecast For.
Nagwa, B., Elhag, E.R.B.B., Ahmed, A.M., 2015. The Prevalence of Staphylococci in.
Odeyemi, O.A., 2016. Public health implications of microbial food safety and
foodborne diseases in developing countries. Food Nutr. Res. 60.
Olaimat, A.N., Al-Holy, M.A., Shahbaz, H.M., Al-Nabulsi, A.A., Abu Ghoush, M.H.,
Osaili, T.M., Ayyash, M.M., Holley, R.A., 2018. Emergence of antibiotic resistance
in Listeria monocytogenes isolated from food products: a comprehensive
review. Compr. Rev. Food Sci. Food Saf. 17, 1277–1292.
Sabeel, S., Salih, M.A., Ali, M., El-Zaki, S.E., Abuzeid, N., Elgadi, Z.A.M., Altayb, H.N.,
Elegail, A., Ibrahim, N.Y., Elamin, B.K., 2017. Phenotypic and genotypic analysis
of multidrug-resistant Mycobacterium tuberculosis isolates from Sudanese
patients. Tuberculosis Res Treatment.
Salcedo, C.M. 2018. Modification of the treatment protocol as a strategy in the
control of the cholera epidemic in Haiti 2016-2017.
Salih, M.M.E., 2020. Assessment of the Microbial Qualities of Exported Sheep and
Goats’ Carcasses and the Hygiene Conditions of an Export Slaughterhouse in
Khartoum State-Sudan. Sudan University of Science & Technology.
Shanan, S., Abd, H., Hedenström, I., Saeed, A., Sandström, G., 2011. Detection of
Vibrio cholerae and Acanthamoeba species from same natural water samples
collected from different cholera endemic areas in Sudan. BMC. Res. Notes 4, 109.
Sulieman, A.M.E., Dafallah, F.E., Abdel-Rahman, E.H., Alshammari, N.I., Shommo, S.
A., Ibrahim, S.E., 2020. Isolation, Identification and Characterization of
Salmonella spp. from Chicken purchased at Wad Madani City, Gezira State,
Sudan. Advancements Life Sci. 8, 98–102.
Swaminathan, B., Gerner-Smidt, P., 2007. The epidemiology of human listeriosis.
Microbes Infect. 9, 1236–1243.
Further Reading
Sausages at Khartoum State IJSR – Int. J. Sci. Res. 4 175-178.
H.N. Altayb, R.M. Badri, K. Chaieb et al. Saudi Journal of Biological Sciences 30 (2023) 103653
6