Irisin plays a pivotal role in protecting the heart from ischemia and reperfusion injury. The study found that irisin treatment improved heart function after ischemia and significantly reduced infarct size. Irisin increased antioxidant enzymes and p38 phosphorylation while decreasing apoptosis markers. It also protected mitochondria by suppressing opening of the mitochondrial permeability transition pore and reducing mitochondrial swelling. The results indicate that irisin's cardioprotective effects are linked to improvements in mitochondrial function.

1. Irisin plays a pivotal role to protect the heart against
ischemia and reperfusion injury
Prepared by: Dewan Md. Sumsuzzman
Department of Rehabilitation Science,
Inje University, South Korea.

2. Summary
Hypothesis: Whether mitochondrial function are involved in irisin-induced cardioprotective effects.
Purpose of study: To determine the effect of irisin on myocardial I/R injury in the Langendorff perfused
heart and cultured myocytes.
Methods: Adult C57/BL6 mice were treated with irisin (100 mg/kg) or vehicle for 30 min to elicit
preconditioning. The isolated hearts were subjected to 30 min ischemia followed by 30 min reperfusion.
Left ventricular function was measured and infarction size were determined using by tetrazolium
staining. Western blot was employed to determine myocardial SOD-1, active-caspase 3, annexin V, p38,
and phospho-p38. H9c2 cardiomyoblasts were exposed to hypoxia and reoxygenation for assessment of
the effects of irisin on mitochondrial respiration and mitochondrial permeability transition pore (mPTP).
Result: Irisin treatment improved ventricular function and marked reduction of infarct size. Notably,
irisin treatment increased SOD-1 and p38 phosphorylation, by suppressing levels of active-caspase 3,
cleaved PARP, and annexin V. Furthermore, irisin treatments suppressed the opening of mPTP,
mitochondrial swelling, and protected mitochondria function.
Conclusion: This result indicate that, irisin-induced cardioprotective effects is linked with the
improvement of mitochondrial function.

3. Introduction

4. Mechanism of action
Fig: Mechanism of irisin

5. FNDC5 gene expression in different tissue
Fig: Tissue expression of FNDC5 in chickens.
Li, X. et al.,Gene, 2015, 570, 221–229.

6. Effects of irisin on the oxidative stress in different
animal model
B
Fig: The effects of irisin on the oxidative stress [A&b] A) DMT2 model B) MCAO model,
Zhu, D.,Journal of Molecular and Cellular Cardiology, 2015, 87, 138–147.
Dong-Jie Li ., Metabolism. 2017 Mar;68:31-42.
A

7. Activation of p38 is associated with cardiac
protection
Fig: Time course of p38 phosphorylation by anisomycin

8. Antioxidant function & protective effects against myocardial
I/R injury

9. MATERIALS AND METHODS

10. Animals and cell culture
Animals: Two-month old C57/BL6 mice were used
in this experiment. Cell-culture:
H9C2
DMEM+FBS
Incubation at 37°C,
5% CO2.

11. Reagents and antibodies
. Ingredients Vendor
Irisin Cayman Chemical (Michigan,
USA).
All chemicals for the heart perfusion and mitochondria isolation Sigma-Aldrich
MitoCapture mitochondrial apoptosis detection kit BioVision (Tokyo, Japan)
Active-caspase 3 and
cleaved PARP polyclonal rabbit antibodies
Abcam (MA, USA)
Primary antibodies including polyclonal rabbit β-actin, polyclonal
rabbit p38, polyclonal rabbit phosphor-p38, Erk, phosphorylated Erk,
and polyclonal rabbit superoxide dismutase (SOD-1)
Santa Cruz
Biotechnology (Santa Cruz,
CA).

12. Langendorff isolated heart perfusion

13. Experimental protocol for myocardial I/R injury
Fig: The diagram showing the experimental protocol of myocardial ischemia and
reperfusion

14. Lactate dehydrogenase (LDH) leakage detection
● Lactate dehydrogenase (LDH) is an
oxidoreductase enzyme that catalyses the
interconversion of pyruvate and lactate. Cells
release LDH into the bloodstream after tissue
damage or red blood cell hemolysis.
● Since LDH is a fairly stable enzyme, it has
been widely used to evaluate the presence of
damage and toxicity of tissue and cells.
● The release of LDH was determined using a
commercially available kit (Roche). Fig: Protocol summary for LDH Cytotoxicity Assay Kit

15. Immunochemical staining
● H9c2 cardiomyoblasts were fixed via 4%
paraformaldehyde and then blocked with the
incubation of polyclonal anti-active caspase 3
antibody, which was followed by goat anti-
rabbit Alexa Fluor 555 secondary antibody.
● The percentage of apoptotic positive cells
was determined BY DAPI.

16. Western blot
P38,
phospho-P38,
Erk,
SOD-1,
Active caspase-3,
Beta-actin.

17. Mitochondrial membrane potential & RT-PCR
Mitochondrial membrane potential:
● A reduction in mitochondrial membrane
potential is an early indicator of apoptosis
induction.
● After the cardiomyoblasts were treated with
H/R, the cells were incubated in 1ml of
incubation buffer containing 1 μl of
MitoCapture for 20 min at 37°C in an
incubator. The fluorescent signals were
measured with a microscope. The red
fluorescent signals were excited at 530 nm
and detected at 630 nm, and the green
fluorescence was excited at 488 nm and
detected at 530 nm.
RT-PCR:
Irisin:
Forward: GAACAAAGATGAGGTGACCA
Reverse: ACCACAACAATGATCAGCA.
GAPDH was used in this experiment as the
internal control.

18. Mitochondrial permeability transition pore (mPTP)
● The cells were washed with Hanks’ balanced salt solution 10 mM HEPES (pH
7.2) before staining with 1 μmol/L calcein-AM (Molecular Probes) in the
presence of 8 mmol/L cobalt chloride (CoCl2) at room temperature for 20
min in darkness.
● CoCl2 was added to quench the cytoplasmic signal so that only the
fluorescence mitochondria were captured.

19. Generation of mitochondrial swelling
Fig: Schematic representation of Mitochondrial Swelling workflow.
Homogenization
250mM mannitol
75mM sucrose
100 μM EDTA
10mM HEPES
+
500 μM EGTA
Cell wash
with PBS
Centrifugation
(100*g, 10 mins)
Collect
supernatants
& Centrifugation
(1000*g, 10 mins)
Pellets wash with
Supplement
+
0.5% BSA
Re-suspend
Mitochondria
in
Ice-cold buffer
Add
50 μM of
calcium
Mitochondrial
Swelling
Ice-cold
buffer
Supplement

20. Results & Discussion

21. Ventricular function in the baseline
Table-1: Baseline ventricular functional parameters

22. Irisin improves post-ischemic ventricular functional recovery
Fig: The effects of irisin on ventricular function in post-ischemic hearts.
(A and B) The effects of irisin on ventricular function in LVSP, LVDP, LVDEP, LV dP/dt max, LV dP/dt min, RPP, CF, and HR during ischemia
and reperfusion.

23. Irisin improves post-ischemic ventricular functional recovery
Fig: The effects of irisin on ventricular function in post-ischemic hearts.
(C) Representative left ventricular pressure records in experimental hearts subjected to I/R

24. Irisin reduces infarction size of hearts after I/R
Fig: Irisin treatment reduced myocardial infarct size.
(A) Representative sections of hearts demonstrating reduction of post-ischemic infarct size 30 min after
treatment with irisin. Viable areas are stained brick red, whereas infarcted areas are gray or white.
(B) Irisin treatment reduced myocardial infarct size in postischemic heart. There is a significant decrease in
the infarcted area after irisin treatment.

25. Irisin treatment reduces myocardial apoptosis and oxidative
stress
Fig: The effects of irisin on cellular signaling in myocardium.

26. Irisin reduced cell cytotoxicity in H9c2 cardiomyoblasts
exposed to hypoxia/reoxygenation
Fig: Irisin reduced the release of LDH in H9c2 cardiomyoblasts exposed to hypoxia/reoxygenation.
(A) The in vitro experimental protocol of hypoxia/reoxygenation in H9c2 cardiomyoblasts.
(B) Irisin treatment attenuated LDH leakage in H9c2 cardiomyoblasts exposed to hypoxia/reoxygenation.

27. Irisin reduced cell cytotoxicity in H9c2 cardiomyoblasts
exposed to hypoxia/reoxygenation
Fig: Irisin treatment reduced the active caspase-3-positive nuclei in cardiomyoblasts exposed to H/R.
(A) Representative images showing the apoptotic H9c2 cardiomyoblasts: active caspase-3-positive nuclei in red
(white arrows); nuclei were stained in blue (DAPI).
(B) Quantification of active caspase-3-positive nuclei between groups.

28. Irisin protects H9c2 cells from hypoxia/ reoxygenation
induced mitochondrial damage
Fig: Effects of irisin on mitochondrial membrane depolarization.
A.) Irisin attenuated the mitochondrial damages in H9c2 cardiomyoblasts exposed to
hypoxia/reoxygenation.
A

29. Irisin inhibited the mPTP opening
Fig: Effect of irisin on mitochondrial permeability transition pore (mPTP) opening in cardiomyoblasts exposed to
hypoxia/reoxygenation.
B) Onset of mPTP is demonstrated by loss of green fluorescence signal from mitochondria.
C) Quantitation analysis of mPTP in H9c2 cardiomyoblasts exposed to hypoxia/reoxygenation.
(D) Quantitative analysis of mitochondrial swelling in different treatments.

30. Findings & Perspectives

31. Findings
Irisin
Active caspase-3
Cleaved PARP
SOD-1
p38 phosphorylation
Mitochondrial apoptosis
Mitochondrial PTP
Mitochondrial swelling
Fig: Critical role of irisin in protecting the heart against I/R injury.

32. Limitation
❖ Although this studies demonstrated that irisin attenuated cell death
under hypoxia, but they did not estimate the effect of irisin on cell
necrosis, which is a limitation and holds merit for future investigations.

33. Thank you