This study aimed to determine SIRT1 mRNA expression in leukocytes of women with GDM and without (control group) between 24-33 weeks of pregnancy, and examine correlations between SIRT1 expression and clinical characteristics. The results showed that leukocyte SIRT1 mRNA expression was 1.7 times higher in women with GDM compared to the control group, and SIRT1 expression positively correlated with glucose levels during oral glucose tolerance tests in the whole study group. Higher leukocyte SIRT1 expression was also associated with higher HDL-cholesterol levels in the

1. Leukocyte Sirtuin 1 mRNA overexpression is associated
with Gestational Diabetes Mellitus (GDM)
Iga A. Turek
Department of Structural Biology
Medical University of Lodz
Supervisor: Prof. Lucyna A. Woźniak
Co-supervisor: Dr Marzena Wójcik

2. Presentation overview
1. Introduction
– Gestational Diabetes Mellitus (GDM)
– Sirtuin 1 (SIRT1)
1. Project aims
2. Methodology
3. Results
4. Conclusions
Slide 2 from 11

3. Introduction
Slide 3 from 11
 GDM (Gestational Diabetes Mellitus)
 glucose intolerance with onset during
pregnancy.
 prevalence: up to 17%
 SIRT1 (Sirtuin 1)
 NAD+
-dependent histone deacetylase
 maintenance of glucose and lipid
homeostasis
 regulation of insulin secretion
 over 20 known substrates

4. Project aims:
to determine SIRT1 mRNA expression in leukocytes of GDM women
at 24-33 weeks of pregnancy
to correlate changes in leukocyte SIRT1 expression with clinical
characteristics of subjects
Slide 4 from 11

5. Methodology
Slide 5 from 11
RNA isolation
leukocytes separation
GDM (the HAPO criteria)
n=135
control group (NGT)
n=52
venous blood
leukocytes
RNA
RBC lysis buffer in hypotonic
conditions
qRT-PCR
SIRT1
Primer sequence 5’→3’ cDNA amplicon size
Reverse: TGTGACAGAGAGATGGCTGG
142Forward: GCTCGCCTTGCTGTAGACTT

6. Results

7. SIRT1 expression
 leukocyte SIRT1 mRNA expression was 1.7-fold higher in GDM vs.
NGT pregnant women
Slide 7 from 11

8. Correlations of SIRT1 expression
Positive correlations of SIRT1 expression with:
A.glucose concentration at 2 h of OGTT in the whole study group (NGT + GDM)
B.HDL-cholesterol in NGT group
Slide 8 from 11

9. Results:
 increased leukocyte SIRT1 mRNA expression in the GDM women
 association of leukocyte SIRT1 overexpression with hyperglycemia in
diabetic subjects
 positive correlation between leukocyte SIRT1 expression and HDL-
cholesterol in health pregnant women
Slide 9 from 11

10. Conclusions:
 association of GDM with a change in leukocyte SIRT1 expression at its
gene level
 leukocyte SIRT1 expression is related to hyperglycemic conditions
 potential protective role of leukocyte SIRT1 against CVD in healthy
pregnancy
Slide 10 from 11

11. Thank you
for your attention