Momen A et al 2014 J Receptors Signal Transduction

http://informahealthcare.com/rst
ISSN: 1079-9893 (print), 1532-4281 (electronic)
J Recept Signal Transduct Res, Early Online: 1–8
! 2014 Informa Healthcare USA, Inc. DOI: 10.3109/10799893.2014.920393
ORIGINAL ARTICLE
Enhanced proliferation and altered calcium handling in RGS2-deficient
vascular smooth muscle cells
Abdul Momen1
, Talat Afroze1
, Al-Muktafi Sadi1
, Amir Khoshbin1
, Hangjun Zhang2
, Jaehyun Choi1
, Steven Gu2
,
Syed H. Zaidi1
, Scott P. Heximer2
*, and Mansoor Husain1
*
1
Division of Experimental Therapeutics, Toronto General Research Institute, University Health Network, Toronto, Ontario, Canada and
2
Department of Physiology, Heart and Stroke/Richard Lewar Centre of Excellence in Cardiovascular Research, University of Toronto, 1 King’s
College Circle, Toronto, Ontario, Canada
Abstract
Context: Regulator of G-protein signaling-2 (RGS2) inhibits Gq-mediated regulation of Ca2+
signalling in vascular smooth muscle cells (VSMC). Objective: RGS2 knockout (RGS2KO) mice are
hypertensive and show arteriolar remodeling. VSMC proliferation modulates intracellular Ca2+
concentration [Ca2+
]i. RGS2 involvement in VSMC proliferation had not been examined.
Methods: Thymidine incorporation and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT) conversion assays measured cell proliferation. Fura-2 ratiometric imaging
quantified [Ca2+
]i before and after UTP and thapsigargin. [3
H]-labeled inositol was used for
phosphoinositide hydrolysis. Quantitative RT-PCR and confocal immunofluorescence of select
Ca2+
transporters was performed in primary aortic VSMC. Results and discussion: Platelet-derived
growth factor (PDGF) increased S-phase entry and proliferation in VSMC from RGS2KO mice to
a greater extent than in VSMC from wild-type (WT) controls. Consistent with differential PDGF-
induced changes in Ca2+
homeostasis, RGS2KO VSMC showed lower resting [Ca2+
]i but higher
thapsigargin-induced [Ca2+
]i as compared with WT. RGS2KO VSMC expressed lower mRNA
levels of plasma membrane Ca2+
ATPase-4 (PMCA4) and Na+
Ca2+
Exchanger (NCX), but higher
levels of sarco-endoplasmic reticulum Ca2+
ATPase-2 (SERCA2). Western blot and immuno-
fluorescence revealed similar differences in PMCA4 and SERCA2 protein, while levels of NCX
protein were not reduced in RGS2KO VSMC. Consistent with decreased Ca2+
efflux activity,
45
Ca-extrusion rates were lower in RGS2KO VSMC. These differences were reversed by the
PMCA inhibitor La3+
, but not by replacing extracellular Na+
with choline, implicating differences
in the activity of PMCA and not NCX. Conclusion: RGS2-deficient VSMC exhibit higher rates
of proliferation and coordinate plasticity of Ca2+
-handling mechanisms in response to PDGF
stimulation.
Abbreviations: RGS: regulator of G-protein signalling; MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide; PMCA4: plasma membrane Ca2+
ATPase-4; NCX: Na+
Ca2+
exchanger; SERCA2: sarco-endoplasmic reticulum Ca2+
ATPase-2; PDGF: platelet-derived
growth factor; G-protein: guanine nucleotide binding protein; GPCR: G-protein coupled
receptor; VSMC: vascular smooth muscle cell; [Ca2+
]i: intracellular Ca2+
concentrations; PDGF:
platelet-derived growth factor; P2Y2R: purinergic receptor P2Y2; UTP: uridine tri-phosphate
Keywords
Ca2+
, PMCA4, proliferation, RGS2, vascular
smooth muscle cell
History
Received 26 March 2014
Revised 29 April 2014
Accepted 29 April 2014
Published online 20 May 2014
Introduction
Heterotrimeric G-protein coupled receptors (GPCR) are
ubiquitously expressed throughout the cardiovascular system
and mediate cellular responses to a myriad of hormones
and neurotransmitters (1,2). Hypertension often involves
GPCR activation in vascular smooth muscle cells (VSMC),
the end-effector cell-type controlling peripheral resistance
to blood flow. This can lead to rapid transient increases
in vascular constriction, whereas chronic increases in periph-
eral resistance may be mediated by more permanent vascular
remodeling. Some of the most widely used drugs used to
lower blood pressure (3) and reduce remodeling of arterial
vessels (4) act upstream or at the level of GPCR in VSMC
to reduce signal throughput (e.g. angiotensin receptor
antagonists).
*These senior authors have contributed equally to this work.
Address for correspondence: Mansoor Husain, University Health
Network, Toronto General Hospital Research Institute, TMDT-3-901,
101 College Street, Toronto, Ontario, Canada M5G 1L7. Tel: +1 416
581 7489. Fax: +1 416 581 7489. E-mail: mansoor.husain@uhn.ca
JournalofReceptorsandSignalTransductionDownloadedfrominformahealthcare.combyUniversityofTorontoon05/23/14
Forpersonaluseonly.

‘‘Regulators of G protein signalling’’ (RGS) is a protein
superfamily whose members share a 120 amino acid
homology domain (RGS domain), accelerate GTPase activity
of G protein a subunits, and negatively regulate G protein
signalling (5). One such family member, RGS2, is highly
expressed in VSMC and is unique among the over 35 other
RGS proteins in its ability to both selectively and potently
attenuate Gqa-mediated signalling [reviewed in (6,7)]. Rgs2
knockout mice are hypertensive (8–10) and show pathological
remodeling of kidney arterioles (9). While numerous studies
have investigated the mechanisms whereby increased
Gq-dependent Ca2+
signaling in the absence of a specific
Gq inhibitor can lead to the enhanced vasoconstrictor-
mediated responses in VSMC (10,11), no study to date has
examined the potential effect of RGS2-deficiency on the
phenotypic modulation of VSMC.
Interestingly, RGS2 has been found to carry out a pro-
angiogenic function in myeloid derived suppressor cells
(MDSC) which sculpt the tumor microenvironment through
increased vascularisation (12). This study found the target
protein that mediates this pro-angiogenic function down-
stream of RGS2 to be monocyte chemoattractant protein-1
(MCP-1). Rgs2 knockout (RGS2KO) MDSC secreted lower
levels of MCP-1, leading to reduced angiogenesis in tumors
from RGS2KO mice.
Not much is known about the signaling pathways
employed by RGS2 in modulating growth of VSMC. In this
context, an earlier study found that growth stimulation
of VSMC via sphingosine-1-phosphate (S1P) treatment
caused an up-regulation of Rgs2 mRNA by utilizing a
signaling pathway independent of phosphatidylinositol
3-kinase, protein kinase C, and mitogen-activated protein
kinase kinase (13).
Coordinate increases in [Ca2+
]i are also required for
cell cycle progression in VSMC (14) and are achieved
through the regulated expression of Ca2+
-regulatory genes
such as the ubiquitously expressed plasma membrane
Ca2+
ATPases (PMCA)-1 and À4 (15–17) and the inositol
1,4,5-trisphosphate receptor type-1 (IP3R1) (18,19), and
specific Ca2+
-sensitive cell cycle proteins (20). Notably,
manipulating expression levels of select Ca2+
-regulatory
genes can have effects on both VSMC proliferation (15)
and vasomotor function (21,22), For example, over-
expression of PMCA1 has been shown to inhibit cell
cycle-associated increases in [Ca2+
]i and G1 to S phase cell
cycle progression and proliferation of cultured rat VSMC
(15). However, potential links between RGS proteins
(with their known ability to modulate Ca2+
transients),
and VSMC proliferation had not previously been examined.
To address this, we sought to determine the role of RGS2
as a regulator of [Ca2+
]i in VSMC under proliferative
stimuli. Our results show that chronic exposure to the
mitogen platelet-derived growth factor (PDGF) resulted
in differential changes in proliferation, and both resting
and releasable [Ca2+
]i in RGS2KO versus WT VSMC.
We also demonstrate unique adaptive changes in the
expression and activity of specific Ca2+
-regulatory
genes in RGS2-deficient cells, including PMCA4, which
are consistent with the altered growth characteristics of
these cells.
Materials and methods
Animals
Mice genetically deficient in Rgs2 (RGS2KO) were kindly
provided by Josef Penninger and David Siderovski (23).
Mice used in all studies were backcrossed412 generations
onto a C57BL/6J background. All animal protocols were
approved by the institutional animal care committee.
Reagents
Unless specified otherwise, all chemicals were purchased
from Sigma, Mississauga, ON, Canada.
Cell culture conditions
Primary mouse aortic SMC were isolated from RGS2KO and
wild-type (WT) C57BL/6J mice (Charles River Laboratories,
Wilmington, MA) as previously described (24) with modifi-
cations (17). Briefly, mice were euthanized with sodium
pentobarbital. Descending aortae were collected (3–4 mice/
preparation) in isolation medium (DMEM with 25 mM
HEPES, pH 7.4, 100 mg/l gentamicin, 2.5 mg/ml amphotericin
B, and 1 mg/ml BSA). In a sterile hood, aortae were cleaned
free of fat and connective tissue, and incubated for 30 min
at 37
C in isolation medium containing 200 units/ml
collagenase type III, 0.1 mg/ml elastase (132 units/mg), and
0.5 mg/ml soybean trypsin inhibitor. Tunica adventitia was
removed as an everted tube and the remaining medial tubes
were digested further for 45 min, before mincing and final
digestion for 1 h. Following the removal of tissue pieces
by gravity for 2 min, cells were collected by centrifugation
(500Â g). Cell pellets were re-suspended in the growth
medium (DMEM, 10% FBS, 1% penicillin-streptomycin,
50 mg/l gentamicin, 2.5 mg/ml amphotericin B, and 50 ng/ml
PDGF) in T-25 flasks in a humidified atmosphere of 5% CO2,
95% air, at 37
C. At confluence, cells were removed from
flasks with a brief trypsin treatment (0.05%), suspended in the
culture medium, and split 1:3. Experiments were carried
out in cells at $90% confluence, passages 9–10, and in
the presence of PDGF-containing medium. In experiments
when cells were cultured at passage 0, PDGF was not added
to the media.
[3
H]-thymidine incorporation
Primary aortic SMC were seeded in 6 well plates (1Â 106
per
well). The next day, synchronization was achieved by serum
starvation (0.25% FBS) for 48 h. Following this, cells were
treated with the growth medium containing 50 ng/ml PDGF
for 16 h, to which 1 mCi/ml [3
H]-thymidine was added for a
further 4 h. At the end of the labeling period, cells were
harvested and washed. Their incorporation of [3
H]-thymidine
was quantified by liquid scintillation counting.
MTT colorimetric assay
Active mitochondria cleave 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide (MTT) to produce formazan in
amounts directly proportional to the number of viable cells,
representing thus an index of cell proliferation. Primary aortic
SMC seeded in 96-well plates underwent PDGF treatment as
2 A. Momen et al. J Recept Signal Transduct Res, Early Online: 1–8
Forpersonaluseonly.

described above. After two washes in PBS, they were
incubated for 4 h at 37
C with 1 mg/ml of MTT (in phenol
red-free DMEM supplemented with 2 mM L-glutamine and
1 mM sodium pyruvate) in a reaction volume of 100 ml. After
the removal of MTT solution, DMSO was added to dissolve
formazan crystals. The plate was shaken for 5 min at 55
C
for complete dissolution. Dye absorbance in viable cells was
measured at 595 nm, with 630 nm used as a reference
wavelength.
Determination of [Ca2+
]i
Primary aortic SMC were seeded at low density onto #1 glass
coverslips and cultured as described above in 6-well plates.
Cells were loaded in culture media with 4 mM Fura-2-AM
(Invitrogen-Molecular Probes, Burlington, ON) for 45 min at
37
C, washed, and incubated in PBS without Fura-2 for
10 min at 37
C to allow hydrolysis of the AM ester. Cover
slips were mounted in a modified Leyden open-bath chamber
(BioScience Tools, San Diego, CA) and imaged on an
Olympus IX70 inverted microscope (Carsen Group,
Markham, ON) using a 40Â objective. Excitation light was
provided by a DeltaRam monochrometer, and fluorescence
imaging was performed with ImageMaster imaging software
via an IC200-B camera (Photon Technologies Inc., London,
ON). Cytosolic regions of cells were selected as regions of
interest (ROIs). Alternating excitation wavelengths (340 ± 5/
380 ± 5 nm) were provided at $1 excitation pair per second in
conjunction with a 495-nm dichroic mirror and a 510 ± 20-nm
emission filter (Chroma Technology Corp., Bellows Falls,
VT). Paired images were collected after 100 ms exposure.
Fluorescent ratio values for the image pairs were determined
for each ROI. Baseline fluorescence ratios (FR) of non-
stimulated cells were collected for 30 frames prior to the
addition of 100 mM UTP or 2 mM thapsigargin. The percent-
age increase from baseline FR levels to the peak stimulated
FR was calculated. Identical excitation/emission conditions
and data collection parameters were maintained for all
individual experiments performed in this study.
Phosphoinositide hydrolysis assay
Gq-dependent inositol phosphate production was measured as
described previously (25) with the following modifications.
After 24 h labeling with complete DMEM (with 10% fetal
bovine serum and without inositol) containing 4 mCi/ml myo-
[3
H]inositol, VSMCs were treated with 200 mM UTP in the
presence of 5 mM LiCl. Incubations were carried out for
exactly 45 min before stopping the reaction and collecting
total inositol-containing and inositol phosphate-containing
fractions. Inositol phosphate levels were expressed as a
fraction of the total soluble [3
H]-labeled inositol material
[inositol phosphate+ total inositol-containing fraction]. Data
presented are means of triplicate samples and are represen-
tative of three independent experiments.
Real-time RT-PCR
Total RNA was extracted with Trizol (Invitrogen, Burlington,
ON) from primary VSMC from WT or RGS2KO mice. RNA
was DNAse-treated and used for reverse transcriptase real-
time PCR reaction with microglobulin primers to validate the
absence of genomic DNA. Then, cDNA was prepared using
SuperScript II (Invitrogen, Burlington, ON) with random
hexamers and treated with RNase H. Between 25 and 75 ng of
cDNA was used for real-time PCR reactions in an ABI 7900
Sequence Detection System (Applied Biosystems, Foster
City, CA) using the SYBR GREEN kit (ABI) and employing
primers for GAPDH, RGS2, and Ca2+
regulatory genes
PMCA4, SERCA2a/b, IP3R1, and Na+
Ca2+
Exchanger-1
(NCX1; Table 1). Amounts (ng) of each specific mRNA were
estimated from the standard curve and all data were normal-
ized to the amount (ng) of the housekeeping gene GAPDH.
Data were plotted as fold increases compared with the values
of wild-type mice. Statistical analysis employed Student’s t
test.
Immunofluorescence
Primary aortic SMCs cultured on coverslips were fixed,
permeabilized, and stained with an anti-SERCA2 antibody
(1:100 dilution) (Affinity Bioreagents, Golden, CO) and a
Texas Red-conjugated fluorescent secondary antibody (1:500)
(Invitrogen-Molecular Probes, Burlington, ON) as previously
described (18). Quantification of relative SERCA2 fluores-
cence was conducted on an Olympus IX/81 Fluoview confocal
imaging system (Olympus America Inc., Melville, NY).
Briefly, cell boundaries were delineated from 3 or more
observation fields on each cover slip (n410 cells from two
separate experiments). Cell fluorescent intensity was quanti-
fied at 15 planes in 15 mm wide z-stacks using Olympus
FV1000 software (Olympus Surgical Technologies,
Southborough, MA) as described (26).
Western blot
Primary aortic SMC from 4 to 6 T-175 flasks were harvested
and lysed in 4 ml hypotonic buffer containing 5 mM Tris-Cl,
pH 8.0; 1 mM EDTA; 2 mM DTT; 1 mM PMSF; and
Table 1. Primer sequences employed for quantitative gene expression analyses.
q-RT-PCR primers Sequence (Ta)
Mouse NCX1 forward ATCTGCGTTGTGTTCGCGTGGGTAG (60
C)
Mouse NCX1 reverse TCAATGATCATCCCCCTCTGCTTGC (60
C)
Mouse PMCA4 forward ACGTCTTCCCACCCAAGGTTC (60
C)
Mouse PMCA4 reverse CCAGCAGCCCACACTCTGTC (60
C)
Mouse IP3R1 forward AGTTTGGCCAACGATTTCCTG (67
C)
Mouse IP3R1 reverse GCTTCCTGAGCACGTCTCCTAC (67
C)
Mouse SERCA2 common forward TGAGACGCTCAAGTTTGTGG (60
C)
Mouse SERCA2a reverse ATGCAGAGGGCTGGTAGATG (60
C)
Mouse SERCA2b reverse ACAAACGGCCAGGAAATG (60
C)
DOI: 10.3109/10799893.2014.920393 RGS2 regulates VSMC proliferation and PMCA4 3
Forpersonaluseonly.

1Â COMPLETE protease inhibitor cocktail (Roche, Laval,
PQ) with 50–100 strokes in a Dounce homogenizer. After
clearing nuclei and debris with a spin at 900Â g, the
supernatant was centrifuged at 100 000Â g for 1 h at 4
C.
The microsomal pellet was then resuspended in 0.5–1.0 ml of
resuspension buffer (25 mM HEPES, pH 7.5; 150 mM NaCl;
5 mM EDTA; 1 mM mercaptoethanol; 1% Triton X-100;
COMPLETE protease inhibitor cocktail; 1 mM PMSF; 1 mM
Na3VO4; 1 mM NaF). Membranes were spun again at
1000Â g for 5 min at 4
C and supernatants were immediately
frozen in liquid nitrogen in aliquots. Protein concentration
was estimated with the BCA protein assay (Sigma, Oakville,
ON). Microsomal suspension (250–500 mg) was used for
immunoprecipitation with anti-PMCA4 (Husain lab devel-
oped; (27)), anti-SERCA2 (Affinity Bioreagents, Golden,
CO) or anti-NCX1 (Abcam, Cambridge, MA) antibodies, and
anti-mouse IgG immobilized to Sepharose (Pierce, Rockford,
IL). The immunoprecipitate was resolved on 3–8% NuPage
Tris-Acetate gels (Invitrogen, Burlington, ON), blotted, and
hybridized with anti-PMCA4, SERCA2, or NCX1 antibodies.
Non-immunoprecipitated microsomal proteins were resolved
and blotted similarly, hybridized to a monoclonal anti-actin
antibody (Sigma, Oakville, ON), and visualized by chemilu-
minescence. Band intensities were quantified on the BioRad
GS800 densitometer using BioRad’s Quantity One software
(BioRad, Mississauga, ON).
45
Ca efflux
These studies were conducted as previously described (15)
with modifications. Aortic SMC were incubated with cul-
ture media containing 10 mCi/ml 45
CaCl2 for 1 h at 37
C.
Steady-state equilibration of intracellular 45
Ca was inferred
from maximum 45
Ca uptake having occurred by 1 h of
loading. Cells were washed five times with PBS to remove
extracellular Ca2+
. For experiments in which the extracellular
Na+
concentration ([Na+
]e) was manipulated, NaCl in the
efflux solution was replaced with equimolar concentration of
choline chloride (145 mM). In experiments involving La3+
,
1 mM LaCl3 was added to the efflux solution. The amount
of released 45
Ca was determined over five consecutive 30-s
intervals. Each experiment was repeated three times, with
all experimental and control samples run in quadruplicates for
each 30 s interval. Efflux data were plotted as an exponential
decay of relative starting intracellular 45
Ca over time.
Statistical analysis
Data are reported as mean ± SE. The data were analyzed
using one-way and two-way ANOVA with Tukey’s or Dunn’s
post-hoc analysis and Student’s t-tests. In all instances,
p50.05 was considered significant.
Results
RGS2-deficient VSMC exposed to PDGF show
increased rates of proliferation
To examine the role of RGS2 in the regulation of VSMC
proliferation and Ca2+
signaling under conditions that simu-
late arterial remodeling in vivo, we cultured primary
mouse aortic VSMC from wild-type (WT) and Rgs2-deficient
(RGS2KO) mice in PDGF-containing medium for 9–10
passages. Consistent with a role for RGS2 in the suppression
of VSMC proliferation, RGS2KO cells showed greater
incorporation of 3
H-thymidine (Figure 1A), and increased
mitochondrial conversion of the MTT substrate to a colori-
metric product, an indirect measure of cell number
(Figure 1B), when compared with WT controls.
As VSMC proliferation is regulated by coordinated control
of [Ca2+
]i (16,18), and RGS2 is a highly selective inhibitor
of Gq-mediated Ca2+
signaling (6,7), we anticipated that
altered Ca2+
dynamics may play a role in the increased
proliferative response of RGS2KO cells.
Ca2+
homeostasis is altered in PDGF-treated VSMC
from RGS2-deficient mice
To determine whether the accelerated proliferation of
RGS2KO VSMC is associated with differences in [Ca2+
]i,
we used ratiometric imaging of Fura-2AM-loaded VSMC
from RGS2KO and WT mice to define basal [Ca2+
]i and Ca2+
responses to (i) activation of a G-protein coupled purinergic
receptor (P2Y2R), and (ii) blockade of the sarco/endoplasmic
reticulum Ca2+
ATPase (SERCA), with UTP and thapsigar-
gin, respectively. Previously, we and others showed that
Figure 1. RGS2KO VSMC show enhanced proliferation in response to
PDGF. (A) In each experiment, triplicate wells of VSMC from wild-type
(WT) and RGS2KO mice were cell cycle-synchronized (48 h serum
starvation and 16 h PDGF stimulation) and labeled with 3
[H]-thymidine
for 4 h. Total acid-precipitable 3
[H] cpm/well were determined for each
well; data shown are mean ± SE of three independent experiments. (B)
VSMC from WT and RGS2KO mice were seeded in 96-well plates (5000
cells per well), and the MTT assay was performed on subsequent days.
Each experimental condition was repeated in quadruplicate; data shown
are mean ± SE of three independent experiments. *p50.05 versus WT
by two-way ANOVA.
Forpersonaluseonly.

freshly isolated RGS2KO VSMC, cultured in the absence of
PDGF, showed increased peak [Ca2+
]i following a Gq-
dependent stimulus (9,10). Unlike previous observations, after
chronic PDGF exposure (up to passage 10), GPCR-mediated
increases in Ca2+
no longer differed between RGS2KO and
WT VSMC (Figure 2A). As RGS2KO cells continued to
show increased levels of GPCR-dependent second messenger
inositol phosphates in response to UTP (Figure 2B), the
loss of an enhanced [Ca2+
]i response to UTP cannot be
attributed to a PDGF-induced loss of Gq-dependent signaling.
Rather, RGS2KO VSMC showed decreased resting [Ca2+
]i
and increased [Ca2+
]i in response to thapsigargin treatment
as compared with WT VSMC after long-term PDGF
exposure (Figure 2A). Together, these data suggest that
Ca2+
handling mechanisms in RGS2KO cells were adapted
in a different (and somewhat unexpected) manner following
PDGF-stimulation, as compared with identically harvested
and cultured WT cells.
Expression of Ca2+
regulatory genes is altered
in RGS2KO cells
To explore the molecular bases of our findings, we next
examined the expression and activity of the major Ca2+
-
regulators known to be expressed in VSMC (16–18). In
RGS2KO VSMCs at passage 0 (without PDGF treatment),
quantitative real-time RT-PCR revealed that PMCA4 mRNA
levels were 75% lower than in WT VSMC (WT: 1.0 ± 0.2
versus RGS2KO: 0.25 ± 0.05; n¼ 3; p50.05), while the
expression levels of other Ca2+
regulatory genes (NCX,
SERCA2, and IP3R1) were unchanged (p¼ NS). Consistent
with the unique adaptive changes in Ca2+
regulation
observed, later passage PDGF-treated VSMCs from RGS2-
deficient animals showed marked differences in the relative
mRNA expression levels for several genes known to regulate
Ca2+
homeostasis in VSMCs (Figure 3). Specifically,
SERCA2a and SERCA2b message levels appeared higher
in RGS2KO versus WT VSMC, however, neither increase was
statistically significant. Rather, support for our findings
that RGS2KO VSMC contained relatively increased expres-
sion of SERCA2 came from both immunofluorescent labeling
of SERCA2 (Figure 4A–C) and immunoblotting of micro-
somal preparations (Figure 4D). In both cases, RGS2KO
VSMC showed increased levels of immunoreactive SERCA2
protein compared with WT controls. Together, these data
provided one potential explanation for the observed lower
levels of basal [Ca2+
]i and the heightened response to
thapsigargin observed in RGS2KO VSMC.
In addition, these later passage PDGF-treated VSMC from
RGS2-deficient animals showed significant decreases in the
Figure 2. RGS2KO VSMC show altered regulation of resting and
releasable [Ca2+
]i following chronic PDGF treatment. (A) Passage 9–10
VSMC from wild-type (WT) and RGS2KO mice were Fura-2 loaded and
stimulated with UTP (100 mM) or thapsigargin (Tg; 2 mM) in the
presence of PDGF. Peak [Ca2+
]i were measured as the stimulus-
dependent maximum relative change in the 340/380 fluorescence ratio
(FR). Data shown are mean FR ± SE, with 17–75 cells imaged for each
experimental condition over the course of five independent experiments.
*p50.001 versus WT by two-way ANOVA. (B) Basal and UTP-
stimulated inositol phosphate production of VSMC from WT and
RGS2KO mice. Cells were labeled overnight with myo-[3
H]inositol, and
treated with either water (baseline) or 200 mM UTP in the presence of
10 mM LiCl. Inositol phosphate (IPx) levels were measured 45 min after
treatment, expressed as the mean percentage (soluble IPx/total soluble
inositol-containing material) of triplicate samples. The ability of UTP to
elicit an increased second messenger (IP3) response was retained in
chronic PDGF-treated cultures from RGS2KO VSMC. Data shown are
mean ± SE (n¼ 3 experiments; each experiment consisting of three
replicates); *p50.001 versus WT by two-way ANOVA.
Figure 3. RGS2KO VSMC show altered expression of Ca2+
regulatory
genes. Wild-type (WT) and RGS2KO VSMC were cultured at passage 10
in media supplemented with PDGF and the mRNA expression levels of
Ca2+
transporters PMCA4, NCX, SERCA2a, SERCA2b, and IP3R1
were measured by quantitative real-time RT-PCR. Absolute quantities of
each Ca2+
transporter mRNA (ng) were first normalized to GAPDH
mRNA levels. Then, the GAPDH-normalized value of each Ca2+
transporter in RGS2KO cells was divided by the mean GAPDH-
normalized value in WT cells to obtain expression values in RGS2KO
relative to WT cells. Data shown are mean ± SE (n¼ 3 independent
experiments); *p50.01 by Students’ t-test.
Forpersonaluseonly.

mRNA expression levels of plasma membrane Ca2+
extru-
ders, namely PMCA4 and NCX were observed (Figure 3).
While NCX mRNA levels were reduced, NCX protein levels
were not decreased in RGS2KO VSMC. In contrast,
antibodies developed for proteins produced by the PMCA4a
and PMCA4b splice variants (27) confirmed by immunoblot
that RGS2KO VSMC express lower levels of both PMCA4
variants as compared with WT cells (Figure 5A).
PMCA-mediated Ca2+
extrusion is compromised in
RGS2-deficient cells
To determine the relative functional effect of reduced PMCA4
and unchanged NCX expression levels on Ca2+
extrusion in
RGS2KO cells, we next performed 45
Ca loading and meas-
urements of Ca2+
-efflux in identically cultured VSMC.
Baseline rates of Ca2+
-efflux were greater in WT VSMC
(open circles) as compared with RGS2KO cells (closed
circles) (Figure 5B). Notably, replacing extracellular Na+
with
choline (i.e. disabling NCX) reduced Ca2+
efflux to a similar
extent in both WT (open triangles) and RGS2KO (closed
triangles) VSMC, suggesting that the difference in Ca2+
-
efflux rates between these groups was not due to differences
Figure 5. RGS2KO VSMC show decreased expression of PMCA4
protein and decreased PMCA-dependent 45
Ca efflux. (A) Representative
immunoblots demonstrating relative abundance of NCX, PMCA4a and
PMCA4b in equal amounts of microsomal protein obtained from VSMC
of WT and RGS2KO mice (n¼ 2 blots). (B) 45
Ca efflux assays were
performed in $90% confluent asynchronous VSMC (see Methods
section for details). The mean relative residual intracellular 45
Ca (± SE;
NB: log scale) over time (four consecutive 30 s intervals) are shown
(n¼ 3 experiments, with quadruplicate samples per time point). VSMC
from WT mice (open circles) have higher rates of 45
Ca efflux than those
from KO mice (*p50.05, by two-way ANOVA). Replacing extracellular
Na+
with choline ([choline]e¼ 145 mM; [Na+
]e¼ 0 mM) did not diminish
the higher rate of 45
Ca efflux observed in WT (open triangles) versus
RGS2KO (closed triangles) cells (*p50.05, by two-way ANOVA).
In contrast, the non-selective PMCA-inhibitor La3+
(1 mM) abolished
the difference in 45
Ca efflux rate between WT (open squares) and
RGS2KO (closed squares) (p¼ NS).
Figure 4. RGS2KO VSMC show increased expression of SERCA2
protein. Cover slips with passage 9–10 VSMC from WT (panel A) and
RGS2KO mice (panel B) were simultaneously processed for immuno-
fluorescent detection of SERCA2 and imaged by confocal microscopy
as described in Methods section. (C) Relative fluorescence intensity
from (n410) cells was quantified under identical imaging conditions,
and expressed as mean ± SE (from two separate experiments).
(D) Representative immunoblots (n¼ 2 blots) demonstrating relative
abundance of SERCA2 (110 kDa band) is shown for equal amounts
of membrane protein (actin served as a loading control) from cultured
VSMC of WT and RGS2KO mice. Arrows represent molecular weight
markers 117 and 71 kDa.
Forpersonaluseonly.

in NCX activity. Indeed, when the non-selective PMCA
inhibitor La3+
was tested, it reduced the Ca2+
-efflux rate
of WT VSMC (open squares) to a greater extent than in
RGS2KO cells (closed squares), such that the net Ca2+
-efflux
rates of the two groups no longer differed after La3+
treatment. Taken together, these data suggest that the primary
difference in Ca2+
-efflux rates between WT and RGS2KO
cells is mediated by differences in PMCA4 expression and
function.
Discussion
Using two different but complementary methods, 3
H-thymi-
dine incorporation and mitochondrial MTT conversion, our
results demonstrate that RGS2-deficient (RGS2KO) VSMC
cultured in the presence of PDGF show increased rates of
proliferation as compared with similarly treated wild-type
(WT) VSMC. This is the first direct demonstration of a role
for RGS2 in the regulation of VSMC proliferation. Based
on our previous data in freshly isolated cells (9), and because
the best characterized function of RGS2 in VSMC is
inhibition of Gq-mediated IP3/calcium signaling, we antici-
pated larger GPCR-mediated [Ca2+
]i responses in RGS2KO
VSMC. As RGS2-deficient cells exposed to chronic PDGF
treatment retained enhanced levels of inositol phosphate
generation following UTP stimulation, we were surprised to
find that peak [Ca2+
]i in response to this Gq-mediated signal
did not differ between RGS2KO and WT cells. These data
indicated that adaptation of the Ca2+
handling mechanisms
had occurred. In support of this, RGS2-deficient pancreatic
acinar cells have also been shown to have profoundly adaptive
calcium handling and control mechanisms (28). Moreover,
differences in baseline [Ca2+
]i and the peak [Ca2+
]i response
to thapsigargin were consistent with a more global adaptation
of Ca2+
handling mechanisms, since these were identified in
the absence of a GPCR agonist.
Upon examination of several important regulators of
VSMC Ca2+
handling, our real-time RT-PCR analysis of
RGS2-deficient cells demonstrated that these cells expressed
significantly reduced levels of PMCA4, a molecule involved
in extrusion of cytosolic Ca2+
. Immunoprecipitation and
immunoblotting studies confirmed that protein expression of
two PMCA4 isoforms, PMCA4a and PMCA4b, were reduced
in RGS2KO VSMC.
The likely functional consequence of reduced PMCA4
expression in RGS2-deficient cells is reduced net Ca2+
efflux
and an increased [Ca2+
]i response to SERCA blockade,
in complete agreement with our assessment of these cells.
Consistent with a relatively greater functional importance of
PMCA4, our data also showed that treatment of VSMC with
La3+
, but not choline, abolished differences in Ca2+
efflux
rates between the RGS2-deficient and WT VSMC. Thus, it
seems likely that differential PMCA4 regulation in response
to chronic PDGF stimulus is a major contributor to the overall
differences in Ca2+
efflux between WT and RGS2-deficient
cells. Notably, this difference may reflect a VSMC-specific
mechanism, since pancreatic acinar cells lacking RGS2 show
increased efflux rates relative to WT controls (28).
It is also noteworthy that following chronic PDGF
treatment, SERCA2a mRNA and SERCA2 protein levels
were increased in RGS2KO as compared with WT VSMC,
which may explain the lower baseline [Ca2+
]i observed
in RGS2-deficient cells. These data are also in agreement
with previous work showing that RGS2-deficient pancreatic
acinar cells also express higher levels of SERCA2b as
compared with WT controls (28). Although we were regret-
tably not able to parse the physiological effects of altered
PMCA4 versus SERCA2 expression levels in RGS2KO
cells from our Fura2AM-defined Ca2+
-imaging experiments
(data not shown), results from our mRNA, protein, and 45
Ca
efflux analyses are consistent with a role for PMCA4 in the
phenotype of RGS2KO VSMC.
It is interesting to speculate on the mechanisms whereby
loss of a Gq inhibitor in VSMC can lead to the profound
change in proliferation and adaptation of Ca2+
-regulatory
mechanisms observed. It remains to be determined whether
increased levels of Gq or PLCb activity, or their downstream
effector molecules, can directly regulate the promoters of
PMCA, NCX, or SERCA. Alternatively, the amino terminal
domain of RGS2 has also been shown to functionally interact
with other intracellular signaling partners including adenylyl
cyclase (29), TRPV6 channels (30), and tubulin (31), all of
which may result in the observed changes in proliferation and
calcium handling through a less conspicuous mechanism.
Independent of the mechanism, our current data support
a model whereby the loss of RGS2 results in the adaptation
of PMCA4 and SERCA expression that tunes the cells
differently to mitogenic stimuli.
Conclusions
RGS2-deficient VSMC exhibit higher rates of proliferation
and coordinate plasticity of Ca2+
-handling mechanisms in
response to PDGF stimulation. These data are the first to
link RGS2 (and its well-established role in the modulation of
vasoconstrictor responses and blood pressure in vivo), with
a primary VSMC phenotype of enhanced proliferation and
growth-permissive calcium dynamics in mitogen-stimulated
conditions ex vivo. The significance of this finding in late-
stage (passages 9–10) cultures is that it implicates RGS2
in the regulation of VSMC proliferation (and, therefore, in
potential disorders of VSMC proliferation, such as athero-
sclerosis, restenosis, and hypertension) independent of its
effects on systemic hemodynamics in vivo.
Acknowledgements
This work received technical support from the Cell Biology of
Atherosclerosis Group at the University of Toronto and the Heart
Stroke/Richard Lewar Centre of Excellence (HSRLCE) in
Cardiovascular Research.
Declaration of interest
There are no conflicts of interest to report. This study was supported
by a Canadian Institutes of Health Research (CIHR) Operating Grant
(FRN: MOP-64352) to M. H., and a Heart and Stroke Foundation
of Ontario (HSFO) Grant-in-Aid (NA5921) to S. P. H. M. H. is a Career
Investigator of the HSFO (CI5503) and S. P. H. is a Canada Research
Chair. A. M. S. was supported by a Canadian Hypertension Society
(CHS)/Canadian Institutes of Health Research (CIHR) Postdoctoral
Fellowship (FRN: JHF-64595). J. C. was supported in part by doctoral
student stipend awards from the Ontario Graduate Scholarship and
the CIHR.
Forpersonaluseonly.

References
1. Bridges TM, Lindsley CW. G-protein-coupled receptors: from
classical modes of modulation to allosteric mechanisms. ACS
Chem Biol 2008;3:530–41.
2. Wang G, Wu G. Small GTPase regulation of GPCR anterograde
trafficking. Trends Pharmacol Sci 2012;33:28–34.
3. Trenkwalder P. Combination therapy with AT(1)-receptor blockers.
J Hum Hypertens 2002;16:S17–25.
4. Mulvany MJ. Small artery remodeling in hypertension. Curr
Hypertens Rep 2002;4:49–55.
5. Wieland T, Mittmann C. Regulators of G-protein signalling:
multifunctional proteins with impact on signalling in the cardio-
vascular system. Pharmacol Ther 2003;97:95–115.
6. Gu S, Cifelli C, Wang S, Heximer SP. RGS proteins: identifying
new GAPs in the understanding of blood pressure regulation and
cardiovascular function. Clin Sci (Lond) 2009;116:391–9.
7. Zhang P, Mende U. Functional role, mechanisms of regulation,
and therapeutic potential of regulator of G protein signaling 2 in the
heart. Trends Cardiovasc Med 2013;24:85–93.
8. Hercule HC, Tank J, Plehm R, et al. Regulator of G protein
signalling 2 ameliorates angiotensin II-induced hypertension in
mice. Exp Physiol 2007;92:1014–22.
9. Heximer SP, Knutsen RH, Sun X, et al. Hypertension and
prolonged vasoconstrictor signaling in RGS2-deficient mice.
J Clin Invest 2003;111:445–52.
10. Sun X, Kaltenbronn KM, Steinberg TH, Blumer KJ. RGS2 is a
mediator of nitric oxide action on blood pressure and vasocon-
strictor signaling. Mol Pharmacol 2005;67:631–9.
11. Tang KM, Wang GR, Lu P, et al. Regulator of G-protein signaling-
2 mediates vascular smooth muscle relaxation and blood pressure.
Nat Med 2003;9:1506–12.
12. Boelte KC, Gordy LE, Joyce S, et al. Rgs2 mediates pro-angiogenic
function of myeloid derived suppressor cells in the tumor
microenvironment via upregulation of MCP-1. PLoS One 2011;6:
e18534.
13. Hendriks-Balk MC, Hajji N, van Loenen PB, et al. Sphingosine-
1-phosphate regulates RGS2 and RGS16 mRNA expression in
vascular smooth muscle cells. Eur J Pharmacol 2009;606:25–31.
14. Husain M, Bein K, Jiang L, et al. c-Myb-dependent cell cycle
progression and Ca2+ storage in cultured vascular smooth muscle
cells. Circ Res 1997;80:617–26.
15. Husain M, Jiang L, See V, et al. Regulation of vascular smooth
muscle cell proliferation by plasma membrane Ca(2+)-ATPase.
Am J Physiol 1997;272:C1947–59.
16. Afroze T, Husain M. c-Myb-binding sites mediate G(1)/S-
associated repression of the plasma membrane Ca(2+)-ATPase-1
promoter. J Biol Chem 2000;275:9062–9.
17. Afroze T, Yang LL, Wang C, et al. Calcineurin-independent
regulation of plasma membrane Ca2+ ATPase-4 in the vascular
smooth muscle cell cycle. Am J Physiol Cell Physiol 2003;285:
C88–95.
18. Afroze T, Sadi AM, Momen MA, et al. c-Myb-dependent
inositol 1,4,5-trisphosphate receptor type-1 expression in vascular
smooth muscle cells. Arterioscler Thromb Vasc Biol 2007;27:
1305–11.
19. Wang Y, Chen J, Wang Y, et al. Crucial role of type 1, but not
type 3, inositol 1,4,5-trisphosphate (IP(3)) receptors in IP(3)-
induced Ca(2+) release, capacitative Ca(2+) entry, and prolifer-
ation of A7r5 vascular smooth muscle cells. Circ Res 2001;88:
202–9.
20. Choi J, Chiang A, Taulier N, et al. A calmodulin-binding site on
cyclin E mediates Ca2+-sensitive G1/s transitions in vascular
smooth muscle cells. Circ Res 2006;98:1273–81.
21. Gros R, Afroze T, You XM, et al. Plasma membrane calcium
ATPase overexpression in arterial smooth muscle increases vaso-
motor responsiveness and blood pressure. Circ Res 2003;93:
614–21.
22. Schuh K, Quaschning T, Knauer S, et al. Regulation of vascular
tone in animals overexpressing the sarcolemmal calcium pump.
J Biol Chem 2003;278:41246–52.
23. Oliveira-Dos-Santos AJ, Matsumoto G, Snow BE, et al. Regulation
of T cell activation, anxiety, and male aggression by RGS2. Proc
Natl Acad Sci USA 2000;97:12272–7.
24. Cornwell TL, Lincoln TM. Regulation of intracellular Ca2+ levels
in cultured vascular smooth muscle cells. Reduction of Ca2+ by
atriopeptin and 8-bromo-cyclic GMP is mediated by cyclic GMP-
dependent protein kinase. J Biol Chem 1989;264:1146–55.
25. Heximer SP, Srinivasa SP, Bernstein LS, et al. G protein selectivity
is a determinant of RGS2 function. J Biol Chem 1999;274:34253–9.
26. Kolodziejska KM, Noyan-Ashraf MH, Nagy A, et al. c-Myb-
dependent smooth muscle cell differentiation. Circ Res 2008;102:
554–61.
27. Afroze T, Yang G, Khoshbin A, et al. Calcium efflux activity of
plasma membrane Ca2+ ATPase-4 (PMCA4) mediates cell cycle
progression in vascular smooth muscle cells. J Biol Chem 2014;
289:7221–31.
28. Wang X, Huang G, Luo X, et al. Role of regulator of G protein
signaling 2 (RGS2) in Ca(2+) oscillations and adaptation of Ca(2+)
signaling to reduce excitability of RGS2À/À cells. J Biol Chem
2004;279:41642–9.
29. Salim S, Sinnarajah S, Kehrl JH, Dessauer CW. Identification of
RGS2 and type V adenylyl cyclase interaction sites. J Biol Chem
2003;278:15842–9.
30. Schoeber JP, Topala CN, Wang X, et al. RGS2 inhibits the
epithelial Ca2+ channel TRPV6. J Biol Chem 2006;281:29669–74.
31. Heo K, Ha SH, Chae YC, et al. RGS2 promotes formation of
neurites by stimulating microtubule polymerization. Cell Signal
2006;18:2182–92.
Forpersonaluseonly.

Momen A et al 2014 J Receptors Signal Transduction

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Similar to Momen A et al 2014 J Receptors Signal Transduction

Similar to Momen A et al 2014 J Receptors Signal Transduction (20)

Momen A et al 2014 J Receptors Signal Transduction